CN1308124A - Preparation and application of antibiotic peptide beer yeast - Google Patents
Preparation and application of antibiotic peptide beer yeast Download PDFInfo
- Publication number
- CN1308124A CN1308124A CN01107585A CN01107585A CN1308124A CN 1308124 A CN1308124 A CN 1308124A CN 01107585 A CN01107585 A CN 01107585A CN 01107585 A CN01107585 A CN 01107585A CN 1308124 A CN1308124 A CN 1308124A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- gene
- yeast
- plasmid
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The antheraea pernyi antibacterial peptide possesses broad-spectrum bacterioxidal action. According to amino acid sequences of 1-11 situs of natural untibacterial peptide A and amino acid sequences of 12-37 situs of antibacterial peptide D the antibacterial peptide AD gene is designed, cloned in beer yeast and expressed. By optimizing formula of culture medium and culture condition the high-density culture and high-efficiency expression (5000 unit/ml) can be obtained in a fermentation tank. The antibacterial peptide yeast product can be added in the feed for piglet in 5000 unit/kg of added in the drinking water for chicken in 60-100 unit/animall., can be used for preventing and curing animal diarrhea, and can be used as feed addtive instead of partial vitamins.
Description
The present invention relates to biological technical field.Especially antibacterial peptide gene is cloned in yeast and is prepared feed additive technology.
Tussah antibacterial peptide (Cecropin) is that the injection intestinal bacteria are induced the natural polypeptides of generation in tussah (Antheraea pernyi) pupa, has found that A, B and D etc. are multiple, has broad-spectrum bactericidal action.Extract antibacterial peptide yield low (below 0.02%) from tussah immunity pupa, it is more to consume raw material, and complex process is with high costs, and going into operation has big difficulty.Pupa slag and cocoon shell behind the extraction antibacterial peptide still need carry out deep processing.Can extract the 200-250Kg antibacterial peptide as 1000 tons of tussah cocoons (ten thousand yuan of 1000-1200) instrument, every Kg cost is more than 100,000 yuan.
The tussah antibacterial peptide as handling cocoon chrysalis with the heat shock method, is made the raw material of " breeding the pupa powder " conduct " kidney proheparin " medicine pharmaceutically using existing first-stage success, is the new drug of treatment ephritis and hepatitis, puts into production; Cocoon chrysalis immunity hemolymph is made the plain lyophilized powder of tussah, as the raw material of tussah cellulose capsule, enters a clinical trial phase as Western medicine two classes treatment hepatitis B new drug.Antibacterial peptide has prevention as fodder additives and treats the effect of livestock and poultry, could realize but must reduce cost.
According to the aminoacid sequence of tussah antibacterial peptide, design and synthesize its gene, clone in expression in escherichia coli, because the antibacterial peptide after expressing has killing action to the host, and expression rate is lower, and using value is not arranged; Antibacterial peptide gene and the reorganization of insect baculovirus polyhedron gene are at insect cell or insect expression in vivo.Because insect cell is cultivated the cost height, be difficult for large scale culturing with the polypide expression.
Abuse of antibiotics causes in the milk, meat, egg of livestock and poultry residually and have a strong impact on people's health in animal and fowl fodder in recent years, again because of a large amount of appearance of using microbiotic to cause endurance strain, brings difficulty to treatment.The European Community has forbidden that the shared microbiotic of people and animals mixes feed.With employed microbiotic in the existing poultry and livestock feed of natural bactericidal agent replacement is the demand of poultry and livestock feed industry, also is people's hope.
The objective of the invention is to design the synthesizing new antibacterial peptide gene, import in the cereuisiae fermentum and express, preparation is used as poultry and livestock feed additive, replace the microbiotic that uses in the present poultry and livestock feed, to reach prevention and treatment diseases of bird and livestock, overcome because adverse consequences that abuse of antibiotics brings and the purpose that reduces production costs.
The present invention is such realization: 1. according to tussah natural antibacterial peptide design antibacterial peptide AD aminoacid sequence,
The 1-11 amino acids is designed to tussah antibacterial peptide A sequence, the 12-37 amino acids is designed to silkworm antibacterial peptide D sequence; 2. with the synthetic F that contains 82 bases of dna synthesizer
1Polydeoxyribonucleotide fragment and contain 78 base F
2The polydeoxyribonucleotide fragment has 20 base complementrities between them; 3. design synthetic primer 1:5 ' GGATCCGTATGAAATGGAAG 3 '
Primer 2: 3 ' TCATTATTCTTAAGCAGGCTG 5 ' 4. passes through F
1, F
2With primer 1,2, with the synthetic antibacterial peptide AD gene of PCR (polymerase chain reaction) method with 134 base pairs; 5. with antibacterial peptide AD gene and pCR
TM2.1 plasmid (T carrier) is used T
4The dna ligase connection is built into pCR
TMThe AD recombinant plasmid; 6. use pCR
TMAD recombinant plasmid transformed e. coli jm109 obtains to contain pCR with isopropylthiogalactoside (IPTG) and bromine chloro-indole galactoside (X-gal) screening
TMThe transformant of AD recombinant plasmid; 7. cut with restriction endonuclease BamH I and Sal I enzyme and obtain antibacterial peptide AD gene (cecropin AD gene) fragment, this gene fragment has 134 base pairs (bp); 8. with antibacterial peptide AD gene fragment and shuttle plasmid pCLWA2 T
4Dna ligase connects, and is built into the recombinant expression plasmid pCAD that contains the antibacterial peptide AD gene; 9. cut evaluation with BamH I and Sal I enzyme, electrophoresis obtains the 134bp fragment; 10. with the lithium salts method recombinant expression plasmid is transformed in leucine auxotrophy type cereuisiae fermentum AB103; 11. with scarce leucine substratum screening antibacterial peptide AD Yeast engineering bacterium strain; 12. the antibacterial peptide AD Yeast engineering bacterium strain is obtained the antibacterial peptide AD yeast product with culture medium culturing.
(1) culture medium prescription:
Peptone 15 grams
NaCl 5-10 gram
Sucrose 15-20 gram
Add water to 1000mL
(2) fermentation condition:
Leavening temperature 29-31 ℃, fermentation pH5.5-6.5,500 rev/mins of stirring velocitys, air demand 2.4-2.5 liter/minute, inoculum size 3%.Fermented 72-80 hour, reach the expection tire after, logical steam reaches 100 ℃, 20 minutes, the deactivation thalline was put jar;
(3) concentrated, freeze-drying:
Put the fermented liquid behind the jar, concentrated with rising the diaphragm type vacuum thickener.Vacuum concentration condition: negative pressure 600mmHg, temperature is lower than 80 ℃, is concentrated to 1/10 volume.The concentrated solution freeze-drying is obtained lyophilized powder, be the antibacterial peptide beer yeast goods.The antibacterial potency of fermented liquid is the 5000-5500 units per ml.The mensuration of antibacterial peptide beer yeast disinfection vitality:
(1) detection substratum mother liquor:
Peptone 10.5g
Yeast extract paste 5.25g
NaCl??10.5g
Add water and become 250mL, transfer pH7.2,1 air pressure sterilization 30 minutes, 4 ℃ of preservations are standby.
(2) detection substratum:
Mother liquor 40mL
Inorganic salt 4mL
20% glucose 2mL
Vetstrep (the 220 μ L of 200,000 units/mL)
Distilled water 160mL
The prescription of inorganic salt:
Sal epsom (MgSO
47H
2O) 1.0g
Citric acid (C
6H
6O
7H
2O) 6.0g
Dipotassium hydrogen phosphate (K
2HPO
43H
2O) 5.0g
Sodium ammonium biphosphate (NaHNH
4PO
44H
2O) 7.5g
Add water constant volume 100mL.1 air pressure sterilization 20 minutes is standby.
(3) for the examination bacterial classification:
Intestinal bacteria K
12D
31, reach 10 with LB culture medium culturing to nectar degree
6Bacterial plaque/mL inoculates 5 μ L and detects with in the substratum in 6mL, shakes up, and after waiting to solidify in the impouring 7cm diameter culture dish, 4 ℃ of preservations.
(4) the antibacterial peptide sterilization detection of tiring:
Get 1g (or 1mL) for examination antibacterial peptide sample, be diluted to 10mL with sterilized water, heating
100 ℃ (water-bath) 10 minutes, 10000 rev/mins centrifugal 10 minutes, get supernatant liquor and detect
Sample.
Punch tool with external diameter 2.7mm punches on for the examination plate culture medium, draws respectively and treats
This liquid of test sample 5 μ L/ holes, other establishes contrast and standard substance contrast.Left standstill 10 minutes, and be inverted,
Cultivate 12-18 hour (or appropriate time) for 37 ℃, measure antibacterial circle diameter with vernier scale, heavy
Multiple three times, calculate its mean value.The following formula of substitution calculates its tire (unit)
The antibacterial peptide calculation formula of tiring:
U (sterilization is tired, unit)=2
x* 1000, X=[Y * (b/a)-2.7]/K
Y: sample antibacterial circle diameter (mm); A: standard substance actual measurement antibacterial circle diameter (mm);
B: standard substance standard antibacterial circle diameter (mm); K: the slope of standard substance concentration/antibacterial circle diameter.Antibacterial peptide beer yeast is in the application of poultry and livestock feed additive
Piglet is used fodder additives: add antibacterial peptide beer yeast preparation 5000-8000 unit/Kg in pig starter feed, raised continuously 1 month, can prevent and treat grice diarrhoea;
Chicken feed additive: in the chick tap water, add the every head of antibacterial peptide beer yeast preparation 60-100 unit/day, continuous 14 days, can prevent chick to suffer from diarrhoea and white dysentery.The advantage that the present invention has:
1. utilize the aminoacid sequence of 1-11 position antibacterial peptide A and the aminoacid sequence of 12-37 position antibacterial peptide D, the synthetic tussah antibacterial peptide AD gene of design is an original antibacterial peptide gene.
2. the antibacterial peptide AD gene clone efficiently expresses in cereuisiae fermentum, and its sterilization is tired and stability all increases than natural antibacterial peptide and improve.The sterilization of the fermented liquid 5000 units/mL that tires is significantly improved than tussah immune serum 2500-3000 unit/mL.
3. the antibacterial peptide AD gene is expressed in cereuisiae fermentum, can suitability for industrialized production.Can replace in intestinal bacteria or insect baculovirus, expressing, create favorable conditions for reducing cost.
4. the antibacterial peptide AD gene replaces some microbiotic as fodder additives, and prevention and treatment piglet and chick dysentery can not cause the generation of anti-drug resistance pathogenic bacteria, to the person poultry safety.
Implementation process of the present invention: one, the preparation example 1. antibacterial peptide AD genes of antibacterial peptide beer yeast is synthetic
According to the design of antibacterial peptide AD and gene thereof, with synthetic F1 (82 base) of dna synthesizer and F2 (78 base), each get 10nmol/L, make pcr amplification with primer 1 and primer 2.F
1Fragment (25pmol/ μ L) 1 μ L; F
2Fragment (25pmol/ μ L) 1 μ L, dNTP (pmol/ μ L) 2.5 μ L, 10 * PCR damping fluid, 5 μ L, distilled water 35.5 μ L, 92 ℃ of sex change 1min, Taq archaeal dna polymerase 1 μ L (3 μ), by 52 ℃ of 60sec, 72 ℃ of 60sec, 94 ℃, 30sec, totally 35 circulations after the termination, are reclaimed the PCR product.With the first time PCR product be template, make pcr amplification for the second time with primer 1 and primer 2, final step is extended 10min for 72 ℃.The PCR product reclaims the back at low melting point agarose gel electrophoresis, reclaims 134 (bp) fragment, obtains the antibacterial peptide AD gene ,-20 ℃ of preservations.2. the antibacterial peptide AD gene clone is in intestinal bacteria
With antibacterial peptide AD gene and pCR
TM(2.1 T carrier) plasmid T
4Dna ligase 1 μ L (5U) connects, connect product transformed into escherichia coli JM103 competent cell, screen white colony on the LB substratum that contains isopropylthio beta galactose glycosides (ITPG) and x-gal, the preparation plasmid is identified with BamH II and Sal I restriction enzyme digestion and electrophoresis.It is in full accord with design to measure its sequence on ABI 370 automatic dna sequencers.3. the antibacterial peptide AD gene clone is in cereuisiae fermentum
The antibacterial peptide AD gene is cut with BamH I and Sal I enzyme from the pCR-AD plasmid, and shuttle plasmid pCLWA2 cuts with BamH I and Sal I enzyme, uses T
4Dna ligase connects, and clones in cereuisiae fermentum AB103 with the lithium salts method.Lacking screening transformed yeast engineering bacteria on the leucic YEPD substratum.4. cereuisiae fermentum is expressed antibacterial peptide AD
Yeast engineering bacterium strain is cultivated in scarce leucine YEPD substratum, and 30 ℃, shake a bottle 200r/min, 48hr, static, 5000r/min is centrifugal, and 10min gets supernatant liquor, is transferred to pH4.0, and 90 ℃ of water-bath 20min put into ice bath immediately.4 ℃ of centrifugal 15min of 12000r/m get supernatant liquor; Get 20mL, vacuum freezing is to 2mL, the dialysis desalination, and vacuum is drained, and is dissolved in the 200uL distilled water-20 ℃ of preservations.5. the sterilization detection of tiring
Intestinal bacteria K
12D
31Be inoculated in the LB substratum, mix back a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices, the 2.7mm punch tool punching of cooling back.Get transgenic yeast nutrient solution 1mL, be diluted to 10mL, absorb 5uL (triplicate) in the hole, use tussah antibacterial peptide lyophilized powder 1g simultaneously, thin up becomes 10mL, absorbs 5uL in the hole, as positive control, make negative control with sterilized water and absorb 5uL in the hole, make negative control.Cultivated liquid for 37 ℃, measured antibacterial circular diameter, averaged.Calculate as follows and tire:
U (sterilization is tired, unit)=2
x* 1000, X=[Y * (b/a)-2.7]/K
Y: sample antibacterial circle diameter (mm); A: standard substance actual measurement antibacterial circle diameter (mm); B: standard substance standard antibacterial circle diameter (mm); K: the slope of standard substance concentration/antibacterial circle diameter.Two, application test
----the effect 1. antibacterial peptide AD yeast fermentation broths of-----antibacterial peptide AD cereuisiae fermentum raising piglet and chick prevention diarrhoea (5500 units of tiring/mL), behind vacuum concentration, it is 25000 units/g that concentrated solution is tired, dosage by 100 units/sun is put into drinking-water, is freely absorbed by chicken.2. chicken, 4 repetitions of 200 branches in every district are used in test; Positive control is Enrofloxacin (5mg/kg); Negative control is added with antibiotic not.Raise and the results are shown in following table after 14 days.
200 of the effects of antibacterial peptide AD yeast prevention chick diarrhoea, four repetitions
| Group | Suffer from diarrhoea on several (heads) | Add up to | Diarrhea rate (%) | First body weight (g/ head) | Full phase body weight (g/ head) | Rate of body weight gain (%) | |
| First week | Second week | ||||||
| The microbiotic group | ????2 | ????3 | ????5 | ????2.5 | ?134.9 | ?174.8 | ?29.5 |
| Control group | ????5 | ????8 | ????13 | ????6.5 | ?148.0 | ?186.0 | ?25.6 |
| Antibacterial peptide AD yeast group | ????3 | ????3 | ????6 | ????3.0 | ?141.0 | ??196.9 | ?39.0 |
Diarrhea rate: X has significance; Weightening finish is more obvious with antibacterial peptide AD yeast district.
Description of drawings:
Fig. 1 is an antibacterial peptide AD gene base sequence: wherein
The BamH I, EcoR I, Sal I: DNA restriction enzyme;
M, K, W ...: amino acid whose code name;
GGAT ...: the code name of deoxyribonucleotide;
F
1: the dna fragmentation of 82 bases;
F
2: the dna fragmentation of 78 bases;
Fig. 2 is synthetic and clone's synoptic diagram for the antibacterial peptide AD gene, wherein
Taq DNA polymerase:Taq DNA polymkeric substance;
T
4DNA ligase:T
4Dna ligase;
Cecropin A D gene: antibacterial peptide AD gene;
Lac Za: galactosidase gene;
Kam
+: kalamycin resistance gene;
Amp
+: ampicillin resistance gene
PCR
TM2.1: plasmid; PCR
TMAD: antibacterial peptide AD recombinant plasmid
F1:82 base fragment;
The F2:78 base fragment.
Pass through F
1, F
2With primer 1 and 2, with the synthetic antibacterial peptide AD gene of PCR (polymerase chain reaction) method with 134 base pairs; With antibacterial peptide AD gene and T carrier pCR
TM2.1 plasmid T
4The dna ligase connection is built into pCR
TMThe AD recombinant plasmid.
Fig. 3 is pCR
TM2.1 the recombinant plasmid enzyme is cut the evaluation gel electrophoresis spectrum, wherein
1.PCR molecular weight standard
2.PCR product, promptly the antibacterial peptide AD gene fragment has 134 alkali
Base is right;
3. recombinant plasmid pCR
TMAD EcoR I endonuclease bamhi, small segment
Be the antibacterial peptide AD gene fragment.
Fig. 4 is the structure synoptic diagram of reorganization expression plasmid of yeast, wherein
Cecropin AD gene: antibacterial peptide AD gene;
The Hind III, BamH I, Sal I: DNA restriction enzyme;
Kan
r, Amp
r: kalamycin resistance gene, ampicillin resistance gene;
PLac: galactosidase gene;
T
4DNALigase:T
4Dna ligase;
Leu
+: the leucine selective screening factor;
A-factor[p+s]: a factor (promotor and leader peptide sequences);
PCR
TMAD, pCAD: the plasmid that contains the antibacterial peptide AD gene;
PCLWA2: shuttle plasmid.
Use pCR
TMAD recombinant plasmid transformed e. coli jm109, screening obtains to contain the transformant of antibacterial peptide AD gene; Cut with restriction endonuclease BamH I and Sal I enzyme and to obtain antibacterial peptide AD gene (cecropin AD gene) fragment, this gene fragment has 134 base pairs (bp); With antibacterial peptide AD gene fragment and shuttle plasmid pCLWA2 T
4The dna ligase connection is built into the recombinant expression plasmid pCAD that contains the antibacterial peptide AD gene.
Fig. 5 is reorganization pCLWA2 plasmid enzyme restriction electrophoretogram, wherein
1-No.7 plasmid/Hind III+Sal I endonuclease bamhi;
2-pCLWA2/Hind III+Sal I endonuclease bamhi, negative control;
3-No.7 plasmid/Sal I enzyme is cut;
4-λ DNA/EcoR I+Hind III molecular weight standard.
1.pCAD plasmid is cut with Hind III+Sal I enzyme, gets the 134bp fragment;
2.pCLWA
2Plasmid is cut with Hind III+Sal I enzyme, does not show the 134bp fragment, does cloudy
The property contrast;
3.pCAD plasmid is cut with Sal I enzyme, does not show the 134bp fragment, makes positive control;
4. λ DNA cuts as molecular weight standard with EcoR I+Hind III enzyme.
Claims (3)
1. the preparation of antibacterial peptide beer yeast is characterized in that according to tussah natural antibacterial peptide gene design antibacterial peptide AD aminoacid sequence and gene thereof
With the synthetic F that contains 82 bases of dna synthesizer
1Polydeoxyribonucleotide fragment and contain 78 base F
2The polydeoxyribonucleotide fragment has 20 base complementrities between them;
Design synthetic primer 1:5 ' GGATCCGTATGAAATGGAAG 3 '
Primer 2: 3 ' TCATTATTCTTAAGCAGGCTG 5 '
Pass through F
1, F
2With primer 1,2, with the synthetic antibacterial peptide AD gene of PCR (polymerase chain reaction) method with 134 base pairs;
With antibacterial peptide AD gene and pCR
TM2.1 plasmid (T carrier) is used T
4The dna ligase connection is built into the pCRCAD recombinant plasmid;
With pCRCAD recombinant plasmid transformed e. coli jm109, obtain to contain the transformant of recombinant plasmid pCRCAD with isopropylthiogalactoside (IPTG) and bromine chloro-indole galactoside (X-gal) screening;
Cut with restriction endonuclease BamH I and Sal I enzyme and to obtain antibacterial peptide AD gene (cecropin ADgene) fragment, this gene fragment has 134 bases (bp);
With antibacterial peptide AD gene fragment and shuttle plasmid pCLWA2 T
4The dna ligase connection is built into the recombinant expression plasmid pCAD that contains the antibacterial peptide AD gene;
With the lithium salts method recombinant expression plasmid is transformed in leucine auxotrophy type cereuisiae fermentum AB103;
With scarce leucine substratum screening antibacterial peptide AD Yeast engineering bacterium strain;
The antibacterial peptide AD Yeast engineering bacterium strain is obtained the antibacterial peptide AD yeast product in culture medium culturing.
2. according to the preparation of the said antibacterial peptide beer yeast of claim 1, it is characterized in that the culture medium prescription of antibacterial peptide Yeast engineering bacteria is:
Peptone 15 grams
Yeast powder 10 grams
NaCl 5-10 gram
Sucrose 15-20 gram
Add water to the 1000mL fermentation condition:
Leavening temperature 29-31 ℃, fermentation pH5.5-6.5,500 rev/mins of stirring velocitys, air demand 2.4-2.5 liter/minute;
3. the application of antibacterial peptide beer yeast is characterized in that the antibacterial peptide beer yeast preparation that will have 5000-8000 unit/Kg is added on to feed piglet in the feed, adds antibacterial peptide beer yeast preparation 60-100 unit/day.In the water of head, drink for chick.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN01107585A CN1308124A (en) | 2001-02-28 | 2001-02-28 | Preparation and application of antibiotic peptide beer yeast |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN01107585A CN1308124A (en) | 2001-02-28 | 2001-02-28 | Preparation and application of antibiotic peptide beer yeast |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1308124A true CN1308124A (en) | 2001-08-15 |
Family
ID=4656502
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN01107585A Pending CN1308124A (en) | 2001-02-28 | 2001-02-28 | Preparation and application of antibiotic peptide beer yeast |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1308124A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1309824C (en) * | 2004-08-27 | 2007-04-11 | 广州维观生物科技有限公司 | Antibiotic peptide gene converted viscons bacillus engineering bacterium and its preparing method and use |
| CN1322007C (en) * | 2005-01-14 | 2007-06-20 | 广州华桑生物工程有限公司 | Antibacterial peptide DC and its preparing process and use |
| CN101381757B (en) * | 2008-03-27 | 2012-03-21 | 深圳市圣西马生物技术有限公司 | Solid fermentation preparation method of antibacterial peptide and application |
| CN115558613A (en) * | 2022-08-17 | 2023-01-03 | 江苏亢钧生物科技有限公司 | Culture medium for improving expression efficiency of inducing king cobra antimicrobial peptide OH-CATH30 and preparation method thereof |
-
2001
- 2001-02-28 CN CN01107585A patent/CN1308124A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1309824C (en) * | 2004-08-27 | 2007-04-11 | 广州维观生物科技有限公司 | Antibiotic peptide gene converted viscons bacillus engineering bacterium and its preparing method and use |
| CN1322007C (en) * | 2005-01-14 | 2007-06-20 | 广州华桑生物工程有限公司 | Antibacterial peptide DC and its preparing process and use |
| CN101381757B (en) * | 2008-03-27 | 2012-03-21 | 深圳市圣西马生物技术有限公司 | Solid fermentation preparation method of antibacterial peptide and application |
| CN115558613A (en) * | 2022-08-17 | 2023-01-03 | 江苏亢钧生物科技有限公司 | Culture medium for improving expression efficiency of inducing king cobra antimicrobial peptide OH-CATH30 and preparation method thereof |
| CN115558613B (en) * | 2022-08-17 | 2024-04-09 | 江苏亢钧生物科技有限公司 | Culture medium for improving expression efficiency of induced cobra antibacterial peptide OH-CATH30 and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106540240B (en) | Preparation and application of antibacterial peptide fusion cell factor CAMPILs co-expression biological agent | |
| CN1475137A (en) | Chicken feed additive | |
| CN1974775A (en) | Recombinant plasmid and engineering bacterium containing grass carp interferon gene and their application | |
| CN105061603A (en) | Preparation method for antimicrobial peptide-lysozyme fusion protein and application thereof | |
| CN112111474B (en) | Recombinant lysozyme LYZ-2 with improved enzyme activity, and mutant and application thereof | |
| CN1158382C (en) | Preparation and application of antibiotic peptide pichia yeast | |
| CN1308124A (en) | Preparation and application of antibiotic peptide beer yeast | |
| KR20090012500A (en) | Feed additive for fish or crustacean breeding containing arazyme as effective ingredient | |
| CN101356191A (en) | Neuropeptides for the culture of aquatic organisms | |
| CN1322814A (en) | Prepn and application of antibacterial peptide beer yeast | |
| CN108850640B (en) | Application of pichia pastoris fermentation product for expressing human lysozyme in broiler feed additive | |
| CN1653891A (en) | Method for breeding cock up fry | |
| CN1322815A (en) | Prepn and application of antibacterial peptide Pichia yeast | |
| CN1689431A (en) | Beverage for fattening animals | |
| CN1309824C (en) | Antibiotic peptide gene converted viscons bacillus engineering bacterium and its preparing method and use | |
| Gyan et al. | Effects of yeast antimicrobial peptide in aquaculture | |
| CN1236059C (en) | Grouper insulin-like growth factor II gene, carrier and recombinant strain containing the gene and application thereof | |
| CN1752210A (en) | Chicken interferon gamma, preparing process and use thereof | |
| CN102199215A (en) | MAPWA fusion antibacterial peptide, preparation method and application thereof | |
| CN102091089A (en) | Application of active burdock oligosaccharide to aquaculture | |
| KR20160085401A (en) | A feed additive including immunity induced silkworm and manufacturing method thereof | |
| CN102242138A (en) | Recombination expression of cynoglossus semilaevis antibacterial peptide hepcidin and application thereof | |
| CN1887344A (en) | Animal interferon compound and its prepn and application | |
| RU2561467C1 (en) | Method of production of preparation to increase meat and milk productivity of farm animals (versions) and preparation produced by method | |
| CN102994551A (en) | Method for expressing bombyx mori Cecropin B2 in bombyx mori larva by using double-promoter expression vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |