CN1322815A - Prepn and application of antibacterial peptide Pichia yeast - Google Patents
Prepn and application of antibacterial peptide Pichia yeast Download PDFInfo
- Publication number
- CN1322815A CN1322815A CN01112278A CN01112278A CN1322815A CN 1322815 A CN1322815 A CN 1322815A CN 01112278 A CN01112278 A CN 01112278A CN 01112278 A CN01112278 A CN 01112278A CN 1322815 A CN1322815 A CN 1322815A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- cga
- gtt
- aag
- gct
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Anathreraea pernyi antibacterial peptide has wide spectrum bactericidal effect. Based on the 1-11 site amino acid sequence of natural antibacterial peptide A and the 12-37 site amino acid sequence of antibacterial peptide D, antibacterial peptide AD gene is designed and cloned in Pichia yeast to express. By means of optimized culture medium formulation and culture condition, high density culture and high efficiency expression in fermentation tank is reached. The antibacterial peptide yeast product may be added into piglet feed or chicken drinking water to prevent and treat their diarrhea and to replace partial antibiotics.
Description
The present invention relates to biological technical field.Especially antibacterial peptide gene is cloned in yeast and is prepared feed additive technology.
Tussah antibacterial peptide (Cecropin) is that the injection intestinal bacteria are induced the natural polypeptides of generation in tussah (Antheraea pernyi) pupa, has found that A, B and D etc. are multiple, has broad-spectrum bactericidal action.Extract antibacterial peptide yield low (below 0.02%) from tussah immunity pupa, it is more to consume raw material, and complex process is with high costs, and going into operation has big difficulty.Pupa slag and cocoon shell behind the extraction antibacterial peptide still need carry out deep processing.(ten thousand yuan of 1000-1200) only can extract the 200-250Kg antibacterial peptide as 1000 tons of tussah cocoons, and every Kg cost is more than 100,000 yuan.
The tussah antibacterial peptide is pharmaceutically being used existing first-stage success,, makes that " breeding the raw material of pupa powder " as the kidney proheparin " medicine, is the new drug of treatment ephritis and hepatitis, puts into production as handling cocoon chrysalis with the heat shock method; Cocoon chrysalis immunity hemolymph is made the plain lyophilized powder of tussah, as the raw material of tussah cellulose capsule, enters a clinical trial phase as Western medicine two classes treatment hepatitis B new drug.Antibacterial peptide has prevention as fodder additives and treats the effect of livestock and poultry, could realize but must reduce cost.
According to the aminoacid sequence of tussah antibacterial peptide, design and synthesize its gene, clone in expression in escherichia coli, because the antibacterial peptide after expressing has killing action to the host, and expression rate is lower, and using value is not arranged; Antibacterial peptide gene and the reorganization of insect baculovirus polyhedron gene are at insect cell or insect expression in vivo.Because insect cell is cultivated the cost height, be difficult for large scale culturing with the polypide expression.
Abuse of antibiotics causes in the milk, meat, egg of livestock and poultry residually and have a strong impact on people's health in animal and fowl fodder in recent years, again because of a large amount of appearance of using microbiotic to cause endurance strain, brings difficulty to treatment.The European Community has forbidden that the shared microbiotic of people and animals mixes feed.With employed microbiotic in the existing poultry and livestock feed of natural bactericidal agent replacement is the demand of poultry and livestock feed industry, also is people's hope.
The objective of the invention is to design the synthesizing new antibacterial peptide gene, import in the pichia spp and express, preparation is used as poultry and livestock feed additive, replace the microbiotic that uses in the present poultry and livestock feed, to reach prevention and treatment diseases of bird and livestock, overcome because adverse consequences that abuse of antibiotics brings and the purpose that reduces production costs.The present invention is such realization: 1. according to tussah natural antibacterial peptide design antibacterial peptide AD aminoacid sequence,
BamHⅠ???M???K???W???K???L???F???K???K???I???E???K???V???G5′GGATCCGT?ATG?AAA?TGG?AAG?TTG?TTC?AAA?AAG?ATT?GAA?AAG?GTT?GGT3′CCTAGGCA?TAC?TTT?ACC?TTC?AAC?AAG?TTT?TTC?TAA?CTT?TTC?CAA?CCA
F
1
Q???R???V???R???D???A???V???T???S???A???G???P???A???V???A
--------------------------------------------→
CAA?AGA?GTT?AGA?GAC?GCT?GTC?ATC?TCT?GCT?GGT?CCT?GCT?GTT?GCC
GTT?TCT?CAA?TCT?CTG?CGA?CAG?TAG?AGA?CGA?CCA?GGA?CGA?CAA?CGG
←------------------------------------
F
2
T???V???A???Q???A???T???A???L???A???K
ACT?GTT?GCT?CAA?GCT?ACT?GCC?TTG?GCT?AAG?TAATAAGAATTCGTCGAC??3′
TGA?CAA?CGA?GTT?CGA?TGA?CGG?AAC?CGA?TTC?ATTATTCTTAAGCAGCTG??5′
EcoRⅠ??SalⅠ
The 1-11 amino acids is designed to tussah antibacterial peptide A sequence, the 12-37 amino acids is designed to silkworm antibacterial peptide D sequence; 2. with the synthetic F that contains 82 bases of dna synthesizer
1Polydeoxyribonucleotide fragment and contain 78 base F
2The polydeoxyribonucleotide fragment has 20 base complementrities between them; 3. design synthetic primer 1:5 ' GGATCCGTATGAAATGGAAG 3 '
Primer 2: 3 ' TCATTATTCTTAAGCAGGCTG 5 ' 4. passes through F
1, F
2With primer 1,2, with the synthetic antibacterial peptide AD gene of PCR (polymerase chain reaction) method with 134 base pairs; 5. with antibacterial peptide AD gene and pCR
TM2.1 plasmid (T carrier) is used T
4The dna ligase connection is built into the pCRCAD recombinant plasmid; 6. with pCRCAD recombinant plasmid transformed e. coli jm109, obtain to contain the transformant of recombinant plasmid pCRCAD with isopropylthiogalactoside (IPTG) and bromine chloro-indole galactoside (X-gal) screening; 7. the employing point mutation process makes the 37th Methionin (AAG) be transformed into asparagine (AAC); 8. design synthetic primer AB: primer A:5 ' GAG CTC GAG ATG AAA TGG AAG TTG TTC AAA AAG 3 ' primer B:3 ' CGA GTT CGA TGA CGG AAC CGA TTC TTG ATT CTT AAGCCG CCG 5 '
With the pCRCAD plasmid is that template adds primer A and B, and pcr amplification obtains improved antibacterial peptide gene called after antibiotic peptide CAD, and its dna sequence dna is
M???K???W???K???L???F???K???K???I???E???K5′GAG?CTC?GAG?ATG?AAA?TGG?AAG?TTG?TTC?AAA?AAG?ATT?CAA?AAG3′CTC?GAG?CTC?TAC?TTT?ACC?TTC?AAC?AAG?TTT?TTC?TAA?GTT?TTC
K???V???G???Q???R???V???R???D???A???V???I
AAG?GTT?GGT?CAA?AGA?GTT?AGA?GAC?GCT?GTC?ATC
TTC?CAA?CCA?GTT?TCT?CAA?TCT?CTG?CGA?CAG?GTT
S???A???G???P???A???V???A???T???V???A???Q
TCT?GCT?GGT?GCT?GCT?GTT?GCC?ACT?GTT?GCT?CAA
AGA?CGA?CCA?CGA?CGA?CAA?CGG?TGA?CAA?CGA?GTT
A???T???A???L???A???N
GCT?ACT?GCC?TTG?GCT?AAC?TAA?GAA?TTC?GGC?GGC?3′
CGA TGA CGG AAC CGA TTG ATT CTT AAG CCG CCG 5 ' 9. with antibiotic peptide CAD gene and pHIL-S1 plasmid recombinant conversion in bacillus coli DH 5 alpha, screen transformant pHIL-CAD5 at ampicillin resistance gene, sequencing result is 141 base pairs (bp); 10. with antibiotic peptide CAD gene and vector plasmid pPICZ α-A reorganization, clone, screen to such an extent that contain the transformant of recombinant plasmid pACAD5 with the Zerocin resistant gene in intestinal bacteria TOP10; 11. with the lithium salts method recombinant plasmid pACAD5 is changed in the pichia spp and to express, obtain antibiotic peptide CAD Pichia yeast engineering GSCAD5; 12. the pichia spp GSCAD5 bacterial strain that will contain antibiotic peptide CAD in substratum shake-flask culture as bacterial classification: culture medium prescription:
Peptone 10-20g
Yeast extract 5-10g
NaCl???????5-10g
Glucose 20g
Adding water inserts bacterial classification in the fermentor tank that substratum is housed to 1000mL and ferments the prescription of substratum:
Peptone 15g
Yeast powder 10g
NaCl5-10g
Sucrose 15-20g
Constant volume 1000mL
Fermentation condition: 30 ± 1 ℃ of medium pH 7~7.3 inoculum sizes of leavening temperature are the bacterial classification inoculation 30% (volume) with the 10OD turbidity
Fermenting process: after fermentor tank goes into to add substratum, fed the vapour pressure steam sterilizing 30 minutes, put and be as cold as 37 ℃, under aseptic condition, inoculate, at 304 ± 1 ℃, pH5.5~6.0, air flow 20-40 liter/minute, 500 rev/mins of stirring velocitys were cultivated after 24 hours, and sampling detects cell density and reaches 6OD and add 95% methyl alcohol when above, methyl alcohol add-on 1% (accounting for the fermented liquid total amount) is induced the generation antibacterial peptide, continue to cultivate after 72 hours, the sampling Detection cell density reaches more than the 10OD, 5000 units of tiring/mL.Feed 100 ℃ of steam, 20-30 minute, blowing.The centrifugal thalline of removing of fermented liquid concentrates 1/10 of original volume with rising the diaphragm type vacuum thickener, with the concentrated solution freezing dry powder, obtains lyophilized products and is the antibacterial peptide Pichia yeast goods.50000-58000 unit/g tires.
The application of antibiotic peptide CAD pichia spp
The antibiotic peptide CAD pichia spp can be used as the antibiotic prophylaxis diarrhea of livestock and birds.
Piglet is admixed in the feed by 5000-5500 unit/kg, can prevent and treat grice diarrhoea in continuous one month.
Chicken can add 60-100 unit/head day in drinking-water, can prevent and treat chick diarrhoea in continuous 14 days.Advantage of the present invention: 1. antibiotic peptide CAD is a new gene, comprises antibacterial peptide A, the advantage of D, and C end is consistent with natural structure for asparagine, improves that its sterilization is tired and stable.2. clone in pichia spp and express, reach high-density culture (120-130g wet thallus/L), 5000~5500 units of tiring/mL.3. express in yeast can suitability for industrialized production for antibacterial peptide, reduces cost, and reduces (below 100 times) than natural extract, can replace escherichia coli expression and insect rhabdovirus system and express.4. optimize culture medium prescription and fermentation condition, reduce cost, shorten the production cycle, by can suitability for industrialized production after the pilot scale.5. be applied to additive for farm animal feed, replace some microbiotic, the dysentery of prevention piglet and chick.
Implementation process of the present invention: one, antibacterial peptide Pichia yeast prepares the synthetic of 1. antibacterial peptide AD genes
According to the design of antibacterial peptide AD and gene thereof, with the synthetic F of dna synthesizer
1(82 base) and F
2(78 base) makes pcr amplification with primer 1 and primer 2.F
1And F
2Sheet acid (25mmol/uL) 1uL, d NTP (pmol/L) 2.5uL, 10 * PCR damping fluid 5uL, distilled water 35.5uL, 92 ℃ of sex change 1min add Taq archaeal dna polymerase 1uL (3u), by 52 ℃ of 60Sec, 70 ℃ of 60Sec, 90 ℃ of 30Sec totally 35 circulations stop the back and reclaim the PCR product.With the first time PCR product be template, make pcr amplification for the second time with primer 1 and primer 2, final step is extended 72 ℃ and is extended 10min.The PCR product at low melting point agarose gel electrophoresis, obtains the antibacterial peptide AD gene after reclaiming, and reclaims-20 ℃ of preservations in back.2. the antibacterial peptide AD gene clone is in intestinal bacteria
With antibacterial peptide AD gene and pCR
Tm2.1 (T carrier) plasmid is used T after cutting with BamH I and Sal I enzyme
4Dna ligase connects into recon pCR
TMAD clones in intestinal bacteria JM103, selects white colony on the LB substratum that contains isopropylthio beta galactose glycosides (ITPG), X-gal and penbritin, a large amount of back preparation pCRAD plasmids of cultivating.Cut the antibacterial peptide AD gene that rear electrophoresis obtains 134bp with BamH I and Sal I enzyme, make the sequence instrument automatically at ABI377DNA behind the purifying, it is in full accord with design to measure basic sequence.3. point mutation C-end is amide group antibacterial peptide AD gene C-hold to be Methionin, and password is AAG, transform each acid amides of Tianmen as with a some bulging method, and password is AAC, designs synthetic primer A and primer B, with pCR
TMThe AD plasmid is that template is to obtain the C-end to be the antibacterial peptide gene ADCAD of asparagine through pcr amplification.
PCRCAD plasmid (25m mol/uL) luL, d NTP (2m mol/L) 5uL, primer A (30p mol/uL) luL, primer B (30p mol/uL) 1uL, 10 * PCR damping fluid 5uL, distilled water 36uL, 95 ℃ of sex change 1min, add TaqDNA polysaccharase 1uL (3u), 72 ℃ finish first circulation after, by 52 ℃ of 60Sec, 70 ℃ of 60Sec, 90 ℃ of 30Sec totally 39 circulations, 10min is extended in final step.After the PCR product reclaims, obtain the antibiotic peptide CAD gene of 141bp at low melting point agarose gel electrophoresis.4. the antibiotic peptide CAD gene clone is in intestinal bacteria
Antibiotic peptide CAD gene and pHIL-S1 plasmid after cutting, EcoR I enzyme are used T
4Dna ligase connects into the pHIL-CAD5 recombinant plasmid, clones in bacillus coli DH 5 alpha, screens transformant with ampicillin resistance gene, extract transformant DNA, cut with EcoR I enzyme, electrophoresis obtains the band of 141bp, and it is in full accord with design to measure basic sequence through the ABI377 automatic dna sequencer.5. the structure of Yeast expression carrier
To contain and use T after the pHIL-CAD5 plasmid of antibiotic peptide CAD gene and shuttle plasmid pPICZ α-A cut with EcoR I enzyme
4Dna ligase connects into the pACAD5 recombinant plasmid, clones in intestinal bacteria TOP10, obtains Yeast expression carrier pACAD5 through the Zerocin antibiotics resistance gene screening.6. the antibiotic peptide CAD gene clone is in pichia spp
The pCAD5 plasmid is cloned in pichia spp with the lithium salts method after using the linearizing of Sac I restriction endonuclease.Get 50 μ L yeast competent cells, centrifugal back adds 240 μ L, 50% Macrogol 4000,36 μ L 1mol/L lithium chlorides, linearizing pCAD5 after 25 μ L (2mg/mL) sex change, behind the thorough mixing, 30 ℃ leave standstill 30min, 42 ℃ of heat shock 20-25min, be chilled to room temperature, the centrifugal 10min of 5000r/m, throw out is suspended in the 1mLYEPD substratum, gets 200 μ L and coats YEPD flat board (containing Zerocin 100 μ g/mL), cultivated 3-4 days, and selected transformant and be antibiotic peptide CAD gene transformation pichia spp for 30 ℃.7. the evaluation of pichia spp transformant
Extract total DNA of transgenic Pichia yeast, make probe, do Southem blot result and be positive with the antibacterial peptide gene fragment of digoxigenin labeled.Transgenic Pichia yeast is cultivated in the YEPD substratum, and 30 ℃+1 ℃, pH5.5-6.0 shakes a bottle 200r/min, behind the 48hr, adds nutrient solution volume 1% methanol induction antibiotic peptide CAD expression of gene, continues to be cultured to 72hr, stops cultivating.Measure anti-microbial activity with the Hultmark method, reach 5000 units/mL level.Two, the test effect of prevention of antibacterial peptide Pichia yeast fodder additives and treatment chick dysentery
With parasitic star 579 chicken breeds, body weight 34-39g/ head is sneaked in the feed with the dosage of 5000 units/kg and to be fed, and reference region is Enrofloxacin (a 5mg/kg body weight), and the check plot does not add antibiotic.200 of every processing divide 4 groups of repetitions, raise for 4 weeks continuously, and investigation sickness rate and weight increase situation see Table 1.
Mortality ratio variance analysis X
2=611, X
0.01=9.2, belong to utmost point conspicuous level.
Difference | Death toll (head) | Mortality ratio (%) | Initial stage body weight (g) | Final body weight (g) | ||||
1 week | 2 | 3 weeks | 4 weeks | Add up to | ||||
Antibacterial peptide Pichia yeast (5000 units/Kg) | ????1 | ????5 | ????1 | ????0 | ???7 | ????3.5 | ??34.5 | ?126.2 |
Enrofloxacin (5mg/Kg) | ????7 | ????1 | ????2 | ????1 | ???11 | ????5.5 | ??35.0 | ?121.0 |
Contrast | ????7 | ????12 | ????2 | ????1 | ???22 | ????11.0 | ??36.0 | ?117.0 |
Description of drawings:
Fig. 1 is antibacterial peptide AD aminoacid sequence and gene base sequence, wherein
M K W K amino acid code name;
G A G C deoxyribonucleotide code name;
The DNA sheet acid of F1:82 base;
The DNA sheet acid of F2:78 base;
Fig. 2 is the aminoacid sequence and the gene base sequence of antibiotic peptide CAD, wherein
M K W K amino acid code name;
G A G C deoxyribonucleotide code name;
N AA C: be the asparagine of the back transformation that suddenlys change
TTG Fig. 3 is that the antibiotic peptide CAD gene clone is in the bacillus coli DH 5 alpha synoptic diagram
PCRCAD: the plasmid that contains the antibiotic peptide CAD gene;
PHIL-S1: shuttle plasmid;
PHIL-CAD5: the yeast vector that contains antibiotic peptide CAD;
EcoR I: be the DNA restriction enzyme;
T
4DNAligase:T
4Dna ligase;
5 ' AOXI: methanol oxidase gene;
PCR: polymerase chain reaction;
CAD gene: improved antibacterial peptide AD contains asparagine residue;
MSC: multienzyme is cut the site; Fig. 4 is a yeast conversion vector construction synoptic diagram
CAD gcne: antibiotic peptide CAD gene:
PHIL-CAD5: the plasmid that contains the antibiotic peptide CAD gene;
PPILCZa-A: shuttle plasmid;
PACAD5: the yeast expression conversion carrier (plasmid) that contains the antibiotic peptide CAD gene;
EcoR I (E): DNA restriction enzyme;
T
4DNA ligase:T
4Dna ligase;
PCR: polymerase chain reaction;
AOXI: methanol oxidase gene;
Zerocin: a kind of antibiotic resistant gene;
MSC: multienzyme is cut the site.
Claims (4)
1, the preparation of antibacterial peptide Pichia yeast is characterized in that: design the antibacterial peptide AD aminoacid sequence according to the tussah natural antibacterial peptide:
BamHⅠ???M???K???W???K???L???F???K???K???I???E???K???V???G5′GGATCCGT?ATG?AAA?TGG?AAG?TTG?TTC?AAA?AAG?ATT?GAA?AAG?GTT?GGT3′CCTAGGCA?TAC?TTT?ACC?TTC?AAC?AAG?TTT?TTC?TAA?CTT?TTC?CAA?CCA
F
1
Q???R???V???R???D???A???V???I???S???A???G???P???A???V???A
-------------------------------------------→
CAA?AGA?GTT?AGA?GAC?GCT?GTC?ATC?TCT?GCT?GGT?CCT?GCT?GTT?GCC
GTT?TCT?CAA?TCT?CTG?CGA?CAG?TAG?AGA?CGA?CCA?GGA?CGA?CAA?CGG
←-------------------------------------
F
2
T???V???A???Q???A???T???A???L???A???K
ACT?GTT?GCT?CAA?GCT?ACT?GCC?TTG?GCT?AAG?TAATAAGAATTCGTCGAC??3′
TGA?CAA?CGA?GTT?CGA?TGA?CGG?AAC?CGA?TTC?ATTATTCTTAAGCAGCTG??5′
EcoRⅠ?SalⅠ
The 1-11 amino acids is designed to tussah antibacterial peptide A sequence, the 12-37 amino acids is designed to tussah antibacterial peptide D sequence;
With the synthetic F that contains 82 bases of dna synthesizer
1Polydeoxyribonucleotide fragment and contain 78 base F
2The polydeoxyribonucleotide fragment has 20 base complementrities between them;
Design synthetic primer 1:5 ' GGATCCGTATGAAATGGAAG 3 '
Primer 2: 3 ' TCATTATTCTTAAGCAGGCTG 5 '
Pass through F
1, F
2With primer 1,2, with the synthetic antibacterial peptide AD gene of PCR (polymerase chain reaction) method with 134 base pairs;
With antibacterial peptide AD gene and pCR
TM2.1 plasmid (T carrier) is used T
4The dna ligase connection is built into the pCRCAD recombinant plasmid;
With pCRCAD recombinant plasmid transformed e. coli jm109, obtain to contain the transformant of recombinant plasmid pCRCAD with isopropylthiogalactoside (IPTG) and bromine chloro-indole galactoside (X-gal) screening;
Adopt point mutation process, make the 37th Methionin (AAG) be transformed into asparagine (AAC);
Design synthetic primer AB: primer A:5 ' GAG CTC GAG ATG AAA TGG AAG TTG TTC AAA AAG 3 ' primer B:3 ' CGA GTT CGA TGA CGG AAC CGA TTC TTG ATT CTT AAGCCG CCG 5 '
With the pCRCAD plasmid is that template adds primer A and B, and pcr amplification obtains improved antibacterial peptide gene called after antibiotic peptide CAD, and its dna sequence dna is
M???K???W???K???L???F???K???K???I???E???K5′GAG?CTC?GAG?ATG?AAA?TGG?AAG?TTG?TTC?AAA?AAG?ATT?CAA?AAG3′CTC?GAG?CTC?TAC?TTT?ACC?TTC?AAC?AAG?TTT?TTC?TAA?GTT?TTC
K???V???G???Q???R???V???R???D???A???V???I
AAG?GTT?GGT?CAA?AGA?GTT?AGA?GAC?GCT?GTC?ATC
TTC?CAA?CCA?GTT?TCT?CAA?TCT?CTG?CGA?CAG?GTT
S???A???G???P???A???V???A???T???V???A???Q
TCT?GCT?GGT?GCT?GCT?GTT?GCC?ACT?GTT?GCT?CAA
AGA?CGA?CCA?CGA?CGA?CAA?CGG?TGA?CAA?CGA?GTT
A???T???A???L???A???N
GCT?ACT?GCC?TTG?GCT?AAC?TAA?GAA?TTC?GGC?GGC?3′
CGA?TGA?CGG?AAC?CGA?TTG?ATT?CTT?AAG?CCG?CCG?5′
In bacillus coli DH 5 alpha, screen transformant pHIL-CAD5 at ampicillin resistance gene with antibiotic peptide CAD gene and pHIL-S1 plasmid recombinant conversion, sequencing result is 141 base pairs (bp);
With antibiotic peptide CAD gene and vector plasmid pPICZ α-A reorganization, clone in intestinal bacteria TOP10, screen to such an extent that contain the transformant of recombinant plasmid pACAD5 with the Zerocin resistant gene;
With the lithium salts method recombinant plasmid pACAD5 is changed in the pichia spp and to express, obtain antibiotic peptide CAD Pichia yeast engineering GSCAD5;
The pichia spp GSCAD5 bacterial strain that will contain antibiotic peptide CAD in substratum shake-flask culture as bacterial classification:
Bacterial classification is inserted the fermentation cylinder for fermentation fill substratum cultivate, cultivate after 24 hours, sampling detection cell density reaches 6OD and adds 95% methyl alcohol when above, methyl alcohol add-on 1% (accounting for the fermented liquid total amount) is induced the generation antibacterial peptide, continues to cultivate after 72 hours, after the sampling Detection cell density reaches more than the 10OD, feed 100 ℃ of steam, 20-30 minute, blowing, fermented liquid is centrifugal, remove thalline, filtrate is concentrated to 1/10 of original volume, and concentrated solution is frozen into dry powder, is the antibacterial peptide Pichia yeast goods.
2, the preparation of antibacterial peptide Pichia yeast according to claim 1 is characterized in that the spawn culture based formulas is
Peptone 10-20g
Yeast extract 5-10g
NaCl???????5-10g
Glucose 20g
Add water to 1000mL
3, the preparation of antibacterial peptide Pichia yeast according to claim 1 is characterized in that the culture medium prescription of fermentation culture is.
Peptone 15g
Yeast sugar 10g
NaCl5-10g
Sucrose 15-20g
30 ± 1 ℃ of constant volume 1000mL leavening temperatures, medium pH 7~7.3, inoculum size is the bacterial classification inoculation 30% (volume) with the 10OD turbidity.
4, the application of antibacterial peptide Pichia yeast is characterized in that: admix with the pichia spp of 5000-5500 unit/Kg and feed piglet in the condiment, can prevent and treat grice diarrhoea; Press 60-100 unit/head, day, add in the entry,, can prevent and treat chick diarrhoea for chicken drinking-water.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN01112278A CN1322815A (en) | 2001-04-03 | 2001-04-03 | Prepn and application of antibacterial peptide Pichia yeast |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN01112278A CN1322815A (en) | 2001-04-03 | 2001-04-03 | Prepn and application of antibacterial peptide Pichia yeast |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1322815A true CN1322815A (en) | 2001-11-21 |
Family
ID=4659240
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN01112278A Pending CN1322815A (en) | 2001-04-03 | 2001-04-03 | Prepn and application of antibacterial peptide Pichia yeast |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1322815A (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1322007C (en) * | 2005-01-14 | 2007-06-20 | 广州华桑生物工程有限公司 | Antibacterial peptide DC and its preparing process and use |
CN102079778A (en) * | 2010-11-24 | 2011-06-01 | 华中科技大学 | Antibacterial protein and preparation method and application thereof |
CN102703457A (en) * | 2012-05-18 | 2012-10-03 | 中国农业科学院兰州兽医研究所 | Method for preparing and expressing antibacterial peptide gene |
CN103074362A (en) * | 2011-10-25 | 2013-05-01 | 上海高龙生物科技有限公司 | Production process and application of antibacterial peptide used in animal feed |
CN105753958A (en) * | 2016-05-11 | 2016-07-13 | 青岛农业大学 | Novel moronecidin mutant, and preparation method and application thereof |
CN108929866A (en) * | 2018-06-11 | 2018-12-04 | 黑龙江八农垦大学 | The new function and its antibacterial peptide of bacillus subtilis GGT protein degradation product are identified |
-
2001
- 2001-04-03 CN CN01112278A patent/CN1322815A/en active Pending
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1322007C (en) * | 2005-01-14 | 2007-06-20 | 广州华桑生物工程有限公司 | Antibacterial peptide DC and its preparing process and use |
CN102079778A (en) * | 2010-11-24 | 2011-06-01 | 华中科技大学 | Antibacterial protein and preparation method and application thereof |
CN102079778B (en) * | 2010-11-24 | 2013-09-18 | 华中科技大学 | Antibacterial protein and preparation method and application thereof |
CN103074362A (en) * | 2011-10-25 | 2013-05-01 | 上海高龙生物科技有限公司 | Production process and application of antibacterial peptide used in animal feed |
CN103074362B (en) * | 2011-10-25 | 2014-12-24 | 上海高龙生物科技有限公司 | Production process and application of antibacterial peptide used in animal feed |
CN102703457A (en) * | 2012-05-18 | 2012-10-03 | 中国农业科学院兰州兽医研究所 | Method for preparing and expressing antibacterial peptide gene |
CN105753958A (en) * | 2016-05-11 | 2016-07-13 | 青岛农业大学 | Novel moronecidin mutant, and preparation method and application thereof |
CN108929866A (en) * | 2018-06-11 | 2018-12-04 | 黑龙江八农垦大学 | The new function and its antibacterial peptide of bacillus subtilis GGT protein degradation product are identified |
CN108929866B (en) * | 2018-06-11 | 2021-04-06 | 黑龙江八一农垦大学 | New function of Bacillus subtilis GGT protein degradation product and identification of antibacterial peptide thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106540240B (en) | Preparation and application of antibacterial peptide fusion cell factor CAMPILs co-expression biological agent | |
CN1158382C (en) | Preparation and application of antibiotic peptide pichia yeast | |
CN101804203A (en) | Method for mass production of pseudorabies virus vaccine | |
CN1974775A (en) | Recombinant plasmid and engineering bacterium containing grass carp interferon gene and their application | |
CN1322815A (en) | Prepn and application of antibacterial peptide Pichia yeast | |
CN1641025A (en) | Pagrosomus major antibacterial peptide gene, and recombinant yeast expression vector and its preparing method | |
CN108850640B (en) | Application of pichia pastoris fermentation product for expressing human lysozyme in broiler feed additive | |
CN104686804B (en) | A method of activated peptide forage additive is prepared using aquatic product leftovers | |
CN107586329B (en) | Polypeptide separated from pomfret | |
CN1177055C (en) | Antibacterial peptide gene of fly and its cloning process | |
CN1308124A (en) | Preparation and application of antibiotic peptide beer yeast | |
CN1322814A (en) | Prepn and application of antibacterial peptide beer yeast | |
CN108635574A (en) | A kind of method and products thereof producing duck Tan Busu, bird flu bivalent inactivated vaccine | |
CN1115964C (en) | Composition for agricultural chemicals and preparation thereof | |
CN111172122B (en) | Duck reovirus attenuated strain and application thereof | |
EA015498B1 (en) | Process for preparing human g-csf | |
CN1309824C (en) | Antibiotic peptide gene converted viscons bacillus engineering bacterium and its preparing method and use | |
CN102242138B (en) | Recombination expression of cynoglossus semilaevis antibacterial peptide hepcidin and application thereof | |
CN102018957B (en) | Production method of hog cholera live vaccine | |
CN1887344A (en) | Animal interferon compound and its prepn and application | |
CN1467291A (en) | Avian interleukin-2 (IL-2) gene and eukaryon expressing plasmid and immunity reinforcing agent of bird vaccine | |
CN1375500A (en) | Thymic peptide fusion protein as one new interferon and its prepn. and use | |
CN1487083A (en) | Grouper insulin-like growth factor II gene, carrier and recombinant strain containing the gene and application thereof | |
CN106913867A (en) | A kind of Vickers, Aeromonas hydrophila bivalent inactivated vaccine and prepare with scale technology | |
CN106666240A (en) | Fermented feed for litopenaeus vannamei and production method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C06 | Publication | ||
PB01 | Publication | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |