CN1290865C - Transduction peptide-insecticidal crystal protein fased protein and its corresponding sequence and use - Google Patents

Abstract

The present invention belongs to the field of genetic engineering and particularly relates to construction for the sequence of protein fusion protein and expression and application for the fusion protein. The present invention particularly provides transduction peptide-insecticidal crystal protein fusing protein and application thereof. A research result related to PTD is applied to the field of microorganism insecticidal crystal protein for the first time. The new field of PTD application and the new path of overcoming pest drug resistance are developed. As proved by the result of the present invention, the fusion protein has pesticidal activity higher than that of single insecticidal crystal protein. The present invention has significant theoretical and practical significance for prevention and cure for pests and application for the PTD.

Description

Transduction peptide-insecticidal crystal protein fusion rotein and corresponding sequence and application

[technical field]

The invention belongs to the genetically engineered field, be specifically related to a kind of structure and Expression of Fusion Protein and application of fusion rotein sequence.The present invention specifically provides a kind of transduction peptide-insecticidal crystal protein fusion rotein and application thereof.

[background technology]

Transduction peptide (Protein Transduction Domain, PTD) (Schwarze SR, et al., Science, 1999,285:1569-1572) be automatically permeates cell membranes of a class, and can other biomacromolecule be carried a section of entering in the cytolemma as carrier and be rich in arginic polypeptide.Generally speaking, eukaryotic cytolemma all is impermeables to exhausted big number protein and length above 6 amino acid whose polypeptide.(Cell.1988 55:1179-1188) reports that the trans-activator TAT from HIV (human immunodeficiency virus) 1 (HIV-1) that joins in the cell culture fluid can automatically enter trans-activation LTR promotor in the culturing cell to Green in 1988 etc.Studies confirm that subsequently, it is owing to be positioned at the effect of one section polypeptide of 47-57 (YGRKKRRQRRR) position on the TAT albumen that TAT can stride across cytolemma automatically.The TAT of synthetic (47-57) (is called for short tat peptide, together following) and utilize the method for chemosynthesis that N-end or the C-that other macro-molecular protein is connected it held, or the fusion rotein of being made up of other macro-molecular protein and tat peptide that the method for utilizing genetic recombination makes up all can permeates cell membranes enter in the cell, and find this penetrating (or transduction) effect and cultured cells kind and culture temperature irrelevant (all can transduce for 4 ℃ and 37 ℃), and enter intracellular amount only be added in nutrient solution in the amount of fused protein relevant, and metabolic enzyme inhibitor has no effect to this transduction process.That is to say, the caused this transduction of tat peptide is that a kind of and present known biomacromolecule enters intracellular mode, as depends on acceptor, translocator or endocytosis fully different (Nagahara H, et al, Nature Medicine.1998,4 (12): 1449-1452; Xia H, Nature biotechnology.2001,19:640-644).Except that tat peptide, transcribe peptide sequence (Derossi D, et al.TheJournal of Biological chemistry.1996,27 (30): 18188-18193.) of the 43-58 position of factors A ntp from fruit bat feeler foot homology abnormal shape; 267-300 sequence (Elliott C from the conjugated protein VP22 of the single viral DNA of sore rash, Ohare P.Cell.1997,88:223-233) all have and on all four transduction function of tat peptide and transduction mechanism, therefore they also be collectively referred to as PTD (Ford K G, et al.Gene Therapy.2001,8:1-4).Schwarze in 1999 etc. have confirmed the transduction function of tat peptide the first time under the situation of live body.Molecular weight is injected in the mouse peritoneal under the live body situation greater than the fusion rotein that 120KD is made up of beta-galactosidase enzymes and tat peptide sequence, after 4 hours, mouse the institute in a organized way, comprise that brain (can penetrate hemato encephalic barrier) has all detected the activity of beta-galactosidase enzymes, do not have the contrast fusion rotein of TAT sequence then to detect activity less than enzyme.Result of study confirms the peculiar biological function of tat peptide, and it is not destroying under the bioactive situation of cytolemma, high molecular weight protein can be carried to enter in the cell, and make high molecular weight protein such as enzyme etc. keep its original biological activity.

(the Futaki S.et al.J.Bio.Chem.2001 of Kyoto Univ Japan Futaki research department, achievement in research 276:5836-5840) further shows, remove the peptide sequence TAT that derives from natural protein, VP22, outside the Antp, the pure arginine polypeptide that the arginine by different numbers of synthetic is formed and some other derive from DNA, be rich in the performance that arginic sequence has PTD equally on the rna binding protein, and find that PTD can also be as the carrier of DNA, carry genetic permeate through cell membranes and make it at cell inner expression (Futaki S., et al., Bioconjugate Chem.2001,12:1005-1011), and think PTD transduction mechanism may with relevant (the Suzuki T. of interaction of PTD and cytolemma phosphide bilayer, et al., J.Bio.Chem., 2002,277:2437-2443).The application of PTD especially has been subjected to fervent expectation and great attention at the gene therapy that medically is applied to human body diseases as carrying the carrier of genomic medicine or pharmaceutical grade protein and protein therapeutic.

Bacillus thuringiensis (Bacillus thuringiensis, Bt) be the microbial pesticide that purposes is the widest in the world, output is maximum at present, account for more than 95% of microbial pesticide total amount, because of its to pest efficient, to the person poultry safety, environmentally friendlyly worldwide be widely used.The gene of coding Bt insecticidal crystal protein also has been transferred in the multiple important grain and cotton crop as topmost killing gene, plays enormous function in pest control.But it is the resistance of insect to Bt that Bt Utilization of pesticides at present is being faced with fatal threat.Important Agricultural pests such as bollworm, small cabbage moth have all been found Bt has been produced drug-fast field population, and prevention effect significantly reduces.If appoint the development of insect to the Bt resistance, when resistance level acquires a certain degree, no matter be natural Bt preparation, through the Bt engineering bacteria of genetic improvement, still change passing on gene crops and all will becoming meaningless of Bt, its loss will be immeasurable.

After entering the insect midgut, the Bt parent toxin that Bt preparation or change the toxalbumin that the Bt plant expresses harmful organism is all had identical mechanism of action, molecular weight are about 120KD is hydrolyzed to the insecticidal crystal protein (ICP-insecticidal crystal protein) that molecular weight is about 60-65KD.According to structure and functional study, ICP roughly can be divided into the domain II I of structural domain I, C end of three part: N end and the domain II at middle part.Wherein domain II, III be responsible for insect midgut peritrophic membrane epithelial cell on receptors bind, the selectivity of decision ICP; Structural domain I inserts after ICP and receptors bind in the cytolemma, forms perforation and cause intracellular fluid to exosmose and cause the death of insect on film.Insect for anti-Bt, because of the receptor protein encoding gene on its midgut epithelial cell is undergone mutation, the receptor protein of sudden change has lost and ICP domain II or III bonded ability, also therefore caused ICP structural domain I not form perforation with membrane interaction, ICP has also just lost its parasiticidal effect (Gahan L.G., et al., Science.2001,293:857-860; Griffitts J.S., et al., Science.2001,293:860-864).It is at present unique known that this target site susceptibility that is caused by the sudden change of ICP binding site reduces, and the resistance mechanism that insect develops immunity to drugs to Bt (Griffitts J.S., et al., Science.2001,293:860-864).

Schnepf in 1981 and Whiteley have cloned the cry gene crylAal of first coding delta-endotoxin from bacillus thuringiensis, and have delivered its nucleotide sequence in 1985.H  fte in 1989 and Whiteley be according to the insecticidal activity and the homology of gene, and 42 kinds of genes of clone at that time are divided into 5 groups 14 classes.CryI has insecticidal activity to Diptera, Cyt to dipteral insect to Coleoptera, CryIV to lepidopteran and Diptera, CryIII to lepidopterous insects, CryII.Crickmore in 1998 etc. have proposed a kind of new Cry insecticidal crystal protein sorting technique, classify according to amino acid identity, have formed an open assortment system.Homology is the first estate below 45%, represents with Arabic numerals; Homology is second grade between 45%-78%, represents with capitalization English letter; Homology is the tertiary gradient between 78%-95%, represent with the small letter English alphabet; Homology is the fourth estate more than 95%, represents with Arabic numerals.As long as satisfy companion cell inclusion body (crystal) from Bt, target organism is had toxicity, perhaps have high homology with known Cry or Cyt albumen, just can include this categorizing system in.

The present invention is incorporated into the insecticidal crystal protein field with the application of PTD, make full use of the non-specific interaction between PTD and the cytolemma, particularly carry the ability of macromolecular substance permeate through cell membranes as carrier, increase the affine of Bt insecticidal crystal protein ICP domain II or III and insect midgut epithelial cell, particularly significantly increase the affine of ICP and resistant insect midgut epithelial cell, overcome because the resistance that the acceptor gene sudden change causes ICP not to be combined on the recipient cell to be produced.Confession examination insect of the present invention is the primary pest small cabbage moth on the vegetables, and small cabbage moth is the pest population that the field finds the Bt sterilant is produced resistance the earliest.Use two kinds of PTD in the embodiment of the invention, a kind of is up to the present to study maximum tat peptides, and another kind is the Rev peptide.The Rev peptide of synthetic has the transduction activity stronger than tat peptide, and it also is the main research object of contriver when the Futaki of Kyoto University research department, and verified Rev peptide has the ability of carrying high molecular weight protein as carrier.

[summary of the invention]

[technical problem that will solve]

1, clear and definite PTD is to the synergism of microbial insecticide crystallin;

2, the peptide-insecticidal crystal protein fusion rotein of clearly transduceing overcomes the ability of pest resistance to insecticide.

[technical scheme]

The invention provides a kind of transduction peptide-insecticidal crystal protein fusion rotein sequence that contains transduction peptide sequence and insecticidal crystal protein sequence.

Transduction peptide sequence of the present invention is transcribed factors A NTP for PTD sequence, the fruit bat homology abnormal shape of the trans-activator TAT of human immunodeficiency virus's genes encoding and is wrapped the PTD sequence of exanthema virus I type VP22 transcription factor merely, the Rev peptide sequence of synthetic, and the insecticidal crystal protein and expand to all analogue sequences of using PTD of being used to transduce.

Transduction peptide sequence of the present invention is according to being chosen in the triplet codon that efficiently expresses in the intestinal bacteria and introducing corresponding restriction enzyme site designed sequence at the sequence two ends in conjunction with the construction of expression vector needs.

Described transduction peptide sequence, the PTD sequence of preferred design synthetic TAT are the nucleotide sequence shown in SEQ IDNO.1, the SEQ ID NO.2.

Described transduction peptide sequence, preferred design synthetic Rev peptide sequence are the nucleotide sequence shown in SEQ ID NO.3, the SEQ ID NO.4.

Fusion rotein sequence provided by the invention, wherein the insecticidal crystal protein sequence is the sequence that derives from the cry gene of bacillus thuringiensis.

The insecticidal crystal protein sequence is to introduce corresponding restriction enzyme site according to the restriction enzyme site at the transduction peptide two ends that make up and the needs of construction of expression vector at the two ends of sequence.Concrete grammar is that the corresponding primer of design increases.

The present invention also provides transduction peptide-insecticidal crystal protein fusion protein expression vector.

The present invention also provides a kind of transduction peptide-insecticidal crystal protein expressing fusion protein and excretory method, and concrete steps are as follows:

1) design of transduction peptide-insecticidal crystal protein antigen-4 fusion protein gene is with synthetic;

2) contain the structure of the expression plasmid of transduction peptide-insecticidal crystal protein fusion rotein dna fragmentation;

3) contain the Expression of Fusion Protein of transduction peptide-insecticidal crystal protein fusion rotein dna fragmentation.

Transduction peptide provided by the invention-insecticidal crystal protein fusion rotein is used for the application of sterilant.

[beneficial effect]

First that relevant PTD is the up-to-date achievement in research of the present invention is applied to microbial insecticide crystallin field, open up PTD frontier of using and the new way that overcomes pest resistance to insecticide, inventive result proof fusion rotein has the insecticidal activity higher than independent insecticidal crystal protein albumen, and the present invention all has important theory and practice significance to control of harmful organism and the application of PTD.

[description of drawings]

Accompanying drawing 1, PTD are connected the product enzyme with the pET21b carrier and cut detected result, wherein

1：pET21b；2：pET21bT；3：pET21bR；

M：λDNA/Eco130I(19.3；7.7；6.2；4.2；3.5；2.7；1.9；1.5；0.92；0.42kb)。

Accompanying drawing 2, PTD are connected the back and are connected the double digestion detected result with the CryIAC functional gene with pET21b, wherein

M：λDNA/Eco130I；1：pET21b；2：pET-21bIAc；

3：pET-21bTIAc；4：pET-21bRIAc。

Accompanying drawing 3, PTD are connected the back and are connected the single endonuclease digestion detected result with the CryIAC functional gene with pET21b, wherein

M：λDNA/Eco130I；1：pET21b；2：pET-21bIAc；3：pET-21bTIAc；

4：pET-21bRIAc。

The SDS-PAGE of accompanying drawing 4, BET21bIAc, BET21bTIAc, BET21bRIAc abduction delivering product analyzes, wherein

M: the molecular weight of albumen standard (97.4,66.2,43.0,31.0,20.1kD)

1:BL21 (DE3)+pET21b; 2:BET21bIAc inducible protein precipitation;

3:BET21bIAc inducible protein supernatant; 4:BET21bRIAc inducible protein precipitation;

5:BET21bRIAc inducible protein supernatant; 6:BET21bTIAc inducible protein precipitation;

7:BET21bTIAc inducible protein supernatant.

[embodiment]

Embodiment 1, PTD and CryIAC genophore constructing plan

When design TAT, Rev base sequence, selected the triplet codon that in intestinal bacteria, efficiently expresses.Design the viscosity joint that is connected with the NdeI restriction enzyme site with pET21b carrier EcoRI, and in primer, add a BamHI restriction enzyme site.The PTD base sequence is as follows:

TAT：5′-TATGTATGGAAGAAAAAAACGTAGGCAACGAAGACGGGATCCG-3′

3′-ACATACCTTCTTTTTTTGCATCCGTTGCTTCTGCCCTAGGCTTAA-5′

Rev：5′-TATGACCAGACAAGCTAGACGTAATCGAAGAAGGAGATGGAGAGAGAGACAACGGGATCCG-3′

3′-ACTGGTCTGTTCGATCTGCATTAGCTTCTTCCTCTACCTCTCTCTCTGTTGCCCTAGGCTTAA-5′

The CryIAC toxalbumin has contaminated area gene primer design as follows, and wherein Acb is 5 ' the end upstream primer that has the BamHI restriction enzyme site, and Acs is 3 ' the end downstream primer that has the SalI restriction enzyme site, and the target gene fragment that PCR accesses is connected with pET21bPTD.Acn is 5 ' the end upstream primer that has the NdeI restriction enzyme site, and Acs is 3 ' the end downstream primer that has the SalI restriction enzyme site, and the target gene fragment that PCR accesses is connected with pET21b, in contrast.

Acb 5′cgcggatccggataacaatccgaacatc3′

Acs 3′gctgagtcactacttgcgcagctgcgca5′

Acn 5′cgcgcatatggataacaatccgaacatc3′

Acs 3′gctgagtcactacttgcgcagctgcgca5′

Embodiment 2, PTD are connected with the pET21b carrier

Cut product at the corresponding EcoRI/NdeI enzyme of tat peptide and Rev peptide and be connected, and forward in the JM110 host bacterium, extract plasmid DNA and detect with pET21b, cut because of the BamHI site in the pET21b plasmid, and in the synthesizing of TAT and Rev peptide, inserted the BamHI site.So available BamHI restriction enzyme detects, and the results are shown in Figure 1.Show that two kinds of PTD successfully are connected with pET21b.Corresponding bacterial classification is by the order-checking of precious biotech firm of Shanghai Shen You company and Dalian, consistent with designed composition sequence.

The clone of embodiment 3, CryIAc functional gene

With HD-73 type strain plasmid is template, carries out pcr amplification, obtains the amplified band of a treaty 2.2kb.Post reclaims this product, and the BamHI/SalI enzyme is cut behind extracting and purifying, is connected with the BamHI/SalI product of pET21b, pET21bT, pET21bR with suitable system, is transformed into intestinal bacteria JM110.Gained positive colony spot detects (seeing Fig. 2,3) through BamHI single endonuclease digestion, BamHI/SalI double digestion.The result shows that the success of CryIAc functional gene fragment and pET21b, pET21bT, the corresponding enzyme of pET21bR are cut product to be connected.Be template with carried pET21bIAc, pET21bTIAc, pET21bRIAc plasmid DNA again, do pcr amplification, can obtain the PCR product of 2.2kb, show that the fragment of inserting should be the CryIAc functional gene with CryIAc functional gene primer.PET21bIAc, pET21bTIAc, pET21bRIAc plasmid DNA are transformed into BL21 (DE3) host bacterium.Obtain corresponding positive colony spot, cut with PCR through corresponding enzyme and detect the corresponding bacterial classification BET21bIAc, BET21bTIAc, the BET21bRIAc that obtain.

The abduction delivering of embodiment 4, fusion rotein and determination of activity

With the sub-BET21bIAc of corresponding positive colony, BET21bTIAc, BET21bRIAc, switching activates in containing the LB liquid nutrient medium of penbritin, and 210r/min cultivates 12h for 37 ℃.Receive 210r/min in a large amount of LB liquid nutrient mediums by 1% inoculum size, add 0.7mmol/IPTG behind 30 ℃ of cultivation 2h, 150r/min, induce 26h for 25 ℃, each sample carries out SDS-PAGE electrophoresis detection (see figure 4), and the result shows that fusion gene can be by the albumen about the expression 72kD of expression vector pET21b more efficient in intestinal bacteria.Wherein, the BET21bTIAc expression amount is higher, and CK and BET21bRIAc expression amount are lower.And sedimentary expression amount is many than the supernatant amount.

The biological activity of experimental example 1, fusion gene expression product

Make insecticidal test with 3 small cabbage moth in age (Wuhan sensitive strain and Shenzhen resistant strain) larvas, will dissolve among a certain amount of 10mmoltris-HCl (pH=8) through BET21bIAc, BET21bTIAc, the BET21bRIAc gene expression product that ultrasonication is crossed.Get fresh cabbage leaves, make the roundleaf sheet of diameter 5cm with punch tool.In above protein liquid, soak leaf 10S, natural airing.Insert each strain small cabbage moth and give birth to survey, see Table 1.In sensitive population, each proteic supernatant or precipitation all have higher activity as can be known; In the mensuration of resistant population, the albumen killing rate that adds the PTD structure contrasts has higher activity.

The biological activity determination result of table 1 expression product

	Wuhan sensitive population mortality ratio (%)	Shenzhen CryIAc eliminates seed selection group mortality ratio (%)	Shenzhen Bt-k eliminates seed selection group mortality ratio (%)
				BET21bIAc inducible protein precipitate B ET21bIAc inducible protein supernatant BET21bRIAc inducible protein precipitate B ET21bRIAc inducible protein supernatant BET21bTIAc inducible protein precipitate B ET21bTIAc inducible protein supernatant BL21 (DE3)+pET21b	100 93.3 100 100 100 100 0	40 50 90 80 100 100 0	20 10 60 50 90 93.3 0

The purifying of experimental example 2, expression product and determination of activity

The pET serial carrier is made up by people such as Studier at first, and used carrier pET-21b is the efficient expression vector of being produced by Novagen company on pET carrier basis when expressing the cry1I gene.Having the T7lac promotor is the lacUV5 promotor of the λ DE3lysogens of t7 rna polymerase guidance, is an extremely strong promotor.Being close to its downstream is the lac operon, can be used for preventing the too early expression of virulent gene.Expressed fusion protein N end has 11 T7Tag amino acid, and the C end is HisTag amino acid, can be used for the purifying of target protein matter.Have Amp ^RThe resistance screening mark.The used recipient bacterium E.coli of pET BL21 has lacked lon proteolytic enzyme and ompT film exoproteinase, can increase the stability of expression product.In the pET21b carrier, have 6 histidine-tagged, when protein expression, can give expression to, with solidifying Ni at C end ²⁺Absorb the histidine-tagged albumen of chromatogram purification band (concrete grammar reference molecule clone three).Albumen enlivens measurement result and sees the following form 2 behind the purifying.Give birth to survey to test and show that the fusion rotein insecticidal activity that has TAT and Rev transduction peptide obviously strengthens.The LC that adds the fusion rotein of TAT ₅₀Be 4.25ug/mL, add the LC of Rev fusion rotein ₅₀Be 16.13ug/mL, and the CryIAc albumen LC of contrast ₅₀Be 20.55ug/mL, the insecticidal activity that adds the albumen antagonism strain of the peptide of transduceing also is better than contrast CryIAc albumen.

Table 2 purifying protein is given birth to and is surveyed the result

		LC 50mg/L	The relevant antagonism multiple	The synergy multiple
					PET+1AC gives birth to and surveys living survey of the living pET+Rev+ of survey of pET+TAT+ 1AC 1AC	Small cabbage moth sensitive population small cabbage moth resistant population small cabbage moth sensitive population small cabbage moth resistant population small cabbage moth sensitive population small cabbage moth resistant population	20.55 124.23 4.25 12.81 16.13 24.86	6.05 3.01 1.53	4.84 9.70 1.29 4.99

Sequence table

＜110〉Vegetable ﹠ Flower Inst., Chinese Academy of Agriculture Science

＜120〉transduction peptide-insecticidal crystal protein fusion rotein and application thereof

<160>4

<210>1

<211>43

<212>DNA

＜213〉artificial sequence

<400>1

TATGTATGGA AGAAAAAAAC GTAGGCAACG AAGACGGGAT CCG 43

<210>2

<211>45

<212>DNA

＜213〉artificial sequence

<400>1

ACATACCTTC TTTTTTTGCA TCCGTTGCTT CTGCCCTAGG CTTAA 45

<210>3

<211>61

<212>DNA

＜213〉artificial sequence

<400>1

TATGACCAGA CAAGCTAGAC GTAATCGAAG AAGGAGATGG AGAGAGAGAC 50

AACGGGATCC G 61

<210>4

<211>63

<212>DNA

＜213〉artificial sequence

<400>1

ACTGGTCTGT TCGATCTGCA TTAGCTTCTT CCTCTACCTC TCTCTCTGTT 50

GCCCTAGGCT TAA 63

Claims (8)

1. transduction peptide-insecticidal crystal protein fusion rotein is characterized in that the PTD of the trans-activator TAT that described transduction peptide is human immunodeficiency virus's genes encoding or the Rev peptide of synthetic.

2. fusion rotein according to claim 1, the nucleotides sequence of the tat peptide of wherein encoding are classified the sequence shown in SEQ ID NO.1, the SEQ ID NO.2 as.

3. fusion rotein according to claim 1, the nucleotides sequence of the Rev peptide of wherein encoding are classified the sequence shown in SEQ ID NO.3, the SEQ ID NO.4 as.

4. fusion rotein according to claim 1, wherein said insecticidal crystal protein are bacillus thuringiensis (Bacillus thuringiensis, the coded product of cry gene Bt).

5. the expression vector of gene order that contains arbitrary described fusion rotein of the claim 1～4 of encoding.

6. by the described expression vector transformed host cells of claim 5.

7. the method for the peptide of transduceing-insecticidal crystal protein expressing fusion protein is characterized in that comprising the steps:

1) design and synthetic transduction peptide-insecticidal crystal protein antigen-4 fusion protein gene, the peptide of wherein transduceing is tat peptide or Rev peptide;

2) structure contains the step 1) expression carrier;

3) with step 2) in expression vector transform the host and induce its expression.

8. the application of the described transduction peptide-insecticidal crystal protein of each of claim 1～4 in the preparation sterilant.