CN1262653C - Feature sequence amplification mark closely interlocked with Chinese cabbage tangerine core character and obtaining method thereof - Google Patents
Feature sequence amplification mark closely interlocked with Chinese cabbage tangerine core character and obtaining method thereof Download PDFInfo
- Publication number
- CN1262653C CN1262653C CN 03157031 CN03157031A CN1262653C CN 1262653 C CN1262653 C CN 1262653C CN 03157031 CN03157031 CN 03157031 CN 03157031 A CN03157031 A CN 03157031A CN 1262653 C CN1262653 C CN 1262653C
- Authority
- CN
- China
- Prior art keywords
- dna
- orange
- mark
- primer
- characteristic sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a characteristic sequence amplification mark closely linked with celery cabbage tangerine core characteristics, whose DNA sequence is disclosed in SEQ ID NO. 1 in the sequence list. A method for obtaining the characteristic sequence amplification mark comprises: firstly, genomic DNA is extracted, RAPD random primers are utilized to make the genomic DNA generate PCR reaction, and electrophoresis analysis is carried out to PCR products; a BSA method is adopted to search an RAPD mark linked with tangerine core characteristics, the linking distance is measured, and the linking relationship is verified; secondly, RAPD products linked with tangerine core characteristics are recovered, cloned and sequenced, and primer pairs with the length of 20 basic groups are designed according to sequences at both ends of the sequence result; SCAR primers are utilized for PCR amplification reaction, electrophoresis analysis is carried out to reaction products, the linking distance is measured, and the linking relationship is verified. The obtained SCAR mark has the advantages of simple analysis program, short period, little required amount of DNA (5 to 25 ng in general) and low quality requirement, and devices are simple. Compared with other marking types, the characteristic sequence amplification mark of the present invention has the advantages low cost, favorable repetitiveness, stable and reliable marking and convenient statistic.
Description
Technical field
The present invention relates to and the closely linked characteristic sequence amplification of the orange disposition shape of Chinese cabbage (SequenceCharacterized Amplified Region, SCAR) mark and preparation method thereof.
Background technology
Chinese cabbage originates in China, is to be subjected to one of vegetables that China people like deeply.The characteristics of China Chinese cabbage are that germ plasm resource is abundant, ecotype is various, distribution area is wide, output height, storage tolerance, the supply phase is long, eating method is various, plants simple and easy, saving of labor, cost is low, cheap, accounts for critical role in China's vegetable basket, the quality that Chinese cabbage produces directly influences vegetables market supply and people's lives, is genuine popular vegetables.Along with improving constantly of development of productivity and living standards of the people, the Chinese cabbage quality breeding is subjected to the attention of Chinese scholars day by day.The Chinese cabbage quality comprises commercial quality, flavor quality and nutritional quality.Commercial quality refers to mode of appearance, color and luster, bag ball mode, individual size, reguarity and the balling degree of packing etc.Along with the development of commodity economy, the importance of commercial quality will grow with each passing day.Flavor quality and nutritional quality are to the edible practical significance that has more of human consumer.Flavor quality comprise eat raw tender and crisp, flavor is sweet, prepared food is delicious, and is easily well-done; Nutritional quality is meant mainly that then what of nutrition Chinese cabbage include, as protein, sugar, amino acid, VITAMIN, Mierocrystalline cellulose (food fibre), mineral element etc.Along with the raising of living standards of the people, people also can be more and more high to the requirement of flavor quality and nutritional quality.Chinese cabbage ball look breeding (seed selection of gold zone and orange heart kind) is one of research contents of quality breeding.Vegetable Research Centre, Beijing Academy of Agriculture and Forest Sciences begins to carry out the seed selection work of the orange heart type breeds of Chinese cabbage nineteen ninety, cultivate and artificial inoculation disease resistance evaluation and screening technology in conjunction with Isolated microspore, " the orange heart in Beijing " breed breeding success in 1996, " a kind of selection of orange core white dish " obtained national inventing patent (patent No. is ZL 99103404.X) in 2002.
We find in Chinese cabbage ball look breeding process, and the orange bulbus cordis look of Chinese cabbage is the simple inheritance of single recessive gene control.In the past, the evaluation of ball look must be cutd open ball in harvesting time and carried out.Be to improve efficiency of selection and accelerate the seed selection process, research and development and the chain molecule marker of orange disposition shape, it is very necessary to set up orange disposition shape molecular mark system.Utilize and the closely linked molecule marker of breeding objective proterties, objective trait is followed the tracks of selection, be called molecular mark.At present, the molecule marker that is used for assistant breeding mainly contains restriction fragment length polymorphism (RFLP), randomly amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), microsatellite DNA or simple repeated sequence (SSR) etc.In above several marks, the RAPD mark is the molecule marker by the PCR-based of arbitrary primer generation, because it has simple, need template DNA amount few (general 15-25ng), primer is the advantage with versatility that designs at random, be subjected to numerous investigators' welcome, and be used widely at aspects such as the mark of the evaluation of germ plasm resource and classification, objective trait gene, construction of genetic atlas.But RAPD is marked with following shortcoming: 1) mark is the dominant marker, can not distinguish heterozygous and homozygous; 2) because it uses short primer (9-10 base) and low temperature thermal oxidation (36-42 ℃) and allows base to mismatch, RAPD detects the influence that is subject to envrionment conditions, poor reproducibility.In order to address these problems, Paran and Michelmore have set up SCAR (Sequence Characterized Amplified region, distinguished sequence amplification) marking method.The SCAR labeled primer is the oligonucleotide about 20 bases normally, and generally extension amplification outcome and the order-checking back by the RAPD mark obtains, the SCAR mark now become with the RAPD mark be converted into can practical application stable marking tool.
Summary of the invention
The purpose of this invention is to provide a kind of and the closely linked SCAR mark of the orange disposition shape of Chinese cabbage, this SCAR mark can be used in the orange heart molecular mark.
Another object of the present invention provides the preparation method of this SCAR mark.
For achieving the above object, the present invention takes following design:
The closely linked characteristic sequence amplification of a kind of and orange disposition shape of Chinese cabbage (SCAR) mark, it has the described dna sequence dna of SEQ ID NO:1 in the sequence table.
The preparation method of the closely linked characteristic sequence amplification of a kind of and orange disposition shape of Chinese cabbage (SCAR) mark, described method comprises the steps:
1) with the screening of chain special randomly amplified polymorphic DNA (RAPD) mark of the orange heart: extract genomic dna, use the RAPD random primer that genomic dna is carried out the PCR reaction, the PCR product is carried out electrophoretic analysis; By the BSA method, seek and the chain RAPD mark of orange disposition shape, measure linkage distance and verify linkage relationship;
2) with the acquisition of the chain special SCAR mark of the orange heart: the RAPD product is reclaimed, clones and checks order, two ends sequences Design primer according to sequencing result is right, 20 bases of length, carry out pcr amplification reaction with the SCAR primer, reaction product is carried out electrophoretic analysis, measure linkage distance and verify linkage relationship.
Extraction genomic dna in the described step 1) is meant the blade grind into powder in liquid nitrogen that 1.5 grams is removed petiole, adds 9ml 2%CTAB extracting solution, 65 ℃ of water-baths of mixing 1 hour; From water-bath, take out centrifuge tube, add 1/3 volume 5M Potassium ethanoate, mixing ice bath 20 minutes; Add equal-volume chloroform/primary isoamyl alcohol extracting twice; Get supernatant and add 2/3 volume isopropanol precipitating DNA; The lavation buffer solution washing once dries up, and adds the dissolving of TE damping fluid; Add RNase A and make its final concentration reach 100 μ g/ml, 37 ℃ of water-baths of mixing 1 hour; With equal-volume chloroform/primary isoamyl alcohol extracting; Get supernatant, add 1/2 volume 7.5M ammonium acetate and 2 times of volume dehydrated alcohol deposit D NA; 70% washing with alcohol precipitation dries up, and adds an amount of ddH
2The O dissolving DNA.
PCR reaction conditions in the described step 1) is: contain 2.5 μ l, 10 * buffer in the reaction system of 25 μ l, 2.0 μ l 25mM MgCl
2, 2.0 μ l 2.5mM dNTP, 1U Taq archaeal dna polymerase, 30ngRAPD random primer, 50ng template DNA; Response procedures is, 94 ℃ of pre-sex change 4min, 94 ℃ of 15S then, 37 ℃ of 30S, 72 ℃ of 75S circulation 45 times down, and 72 ℃ are kept under 4 ℃ of conditions after extending 7min.
Described step 2) recovery, clone and the order-checking of RAPD product are meant with the recovery of Gene-Clean test kit purifying and have proved chain RAPD mark in, be connected to then on the pGEM@-T Vector Easy carrier, recombinant plasmid dna is carried out enzyme with EcoRI cut processing, verify amplified production with RAPD-PCR, whether the fragment that observation amplifies is consistent with original purpose fragment and endonuclease bamhi, and order-checking.
The condition of the pcr amplification reaction described step 2) is: the reaction system of 25 μ l comprises 2.5 μ l, 10 * buffer, 3.3 μ l 15mM MgCl
2, 2.0 μ l 2.5mM dNTP, 1.0 μ l Primer 1,1.0 μ lPrimer, 2,2.0 μ l template DNAs and 0.2 μ l TaqE; The response procedures of SCAR-PCR is: 94 ℃ of pre-sex change 5min 35 circulations of 37 ℃ of annealing of 94 ℃ of sex change 1min 1min 72 ℃ of extensions 2min then; Extend 7min, 4 ℃ of preservations at 72 ℃ again.
Described step 2) the mensuration linkage distance in also verifies that linkage relationship is meant: strain is that DNA carries out pcr amplification with the SCAR primer to DH, measures linkage relationship according to the phenotypic character of amplification and plant, uses Mapmaker Ver.3.0 and calculates genetic distance.
Described SCAR primer is: 5 '-GTTTCGCTCCCTTCTTCAAA-3 ' and 5 '-GTTTCGCTCCTCCATGACAT-3 '.
The present invention uses randomly amplified polymorphic DNA (Randomly Amplified Polymorphic DNA, RAPD) technology, at Chinese cabbage double haploid (the Doubled Haploid that sets up with microspores culture, DH) adopt mixing fractional analysis method (Bulked Segregating Analysis in the colony, BSA) screen RAPD mark with orange heart gene linkage, and transferred the RAPD mark to stable SCAR mark.
Advantage of the present invention is: the SCAR mark that the present invention obtains has that routine analyzer is simple, reaction time short, required DNA amount few (being generally 5-25ng) and specification of quality are not harsh; Equipment is simple, only needs 1 PCR instrument just can carry out; Compare with other labeling patterns, cost is low, good reproducibility, and mark is reliable and stable, is convenient to advantages such as statistics.
The invention will be further described below in conjunction with the drawings and specific embodiments.
Description of drawings
Fig. 1 is primer OPB01 to the figure as a result of each DH individual plant DNA cloning in two parents, Liang Chi and the pond
Fig. 2 is the SCAR mark amplification figure of primer SCB01 to DH colony
Embodiment
One. material and method:
1.1 material
For the examination material is that the strain of the Chinese cabbage common white heart is that 91-112 and orange heart strain are T12-19.Two materials provide by Vegetable Research Centre, Beijing Academy of Agriculture and Forest Sciences.91-112 be continuous selfing screened for 9 generations height for self-mating system, centre of sphere look is a white, the blade face is more flat, leaf-head is folded to be embraced.T12-19 carries out the double haploid system that microspores culture obtains by the hybrid F1 to Beijing local variety and Japanese introduced variety, centre of sphere look orange, and the blade face wrinkle, dark green leaf color is a little less than the plant strain growth gesture.F1 to 91-112 and T12-19 carries out microspores culture, obtains 100 double haploid strain systems, is used for molecule marking research.For further verifying the mark that obtains, F3 is for verifying that the ball look does not separate for the 78 strain F2 individual plants that also adopted orange heart 99-63 and white heart 99-2 to produce, these 78 individual plants, and wherein 42 strains are the orange heart, and 36 strains are the white heart.
1.2 research method
1.2.1 screening with the chain special RAPD mark of the orange heart
1.2.1.1 the extraction of genomic dna
With reference to the method for (1980) such as Murry (Murray M, Thompson W F.Rapid isolation ofhigh molecular weight plant DNA[J] .Nucl Acid Res, 1980,8:668-673.) carry out DNA extraction after being improved.
Restrain the blade grind into powder in liquid nitrogen that removes petiole, adding 9ml 2%CTAB extracting solution (2%CTAB, 1.4mM NaCl with 1.5,100mM Tris-HCl pH8.0,20mM EDTA pH8.0,1%PVP-40,0.2% beta-mercaptoethanol), 65 ℃ of water-baths of mixing are 1 hour; From water-bath, take out centrifuge tube, add 1/3 volume 5M Potassium ethanoate, mixing, ice bath 20 minutes; Add twice of equal-volume chloroform/primary isoamyl alcohol (24: 1) extracting; Get supernatant and add 2/3 volume isopropanol precipitating DNA; Lavation buffer solution (76% ethanol, 10mM ammonium acetate) washing once dries up, and adds TE damping fluid (10mM Tris-HCl, 1mM EDTA, pH7.4) dissolving; Add RNase A and make its final concentration reach 100 μ g/ml, 37 ℃ of water-baths of mixing 1 hour; With equal-volume chloroform/primary isoamyl alcohol (24: 1) extracting; Get supernatant, add 1/2 volume 7.5M ammonium acetate and 2 times of volume dehydrated alcohol deposit D NA; 70% washing with alcohol precipitation dries up, and adds an amount of ddH
2The O dissolving DNA.
DNA concentration uses ultraviolet spectrophotometer (Shimadzu UV-1201, Japan) with the OD260 pH-value determination pH, and detects the DNA extraction quality with 0.7% agarose gel electrophoresis.
1.2.1.2PCR the detection of amplification and product
Contain 2.5 μ l, 10 * buffer in the reaction system of 25 μ l, 2.0 μ l 25mM MgCl
2, 2.0 μ l2.5mM dNTP, 1U Taq archaeal dna polymerase, 30ng primer, 50ng template DNA.RAPD random primer, dNTP and 100bp Marker for ease of international exchange, are converted to Operon series primer numbering to Sangon series primer numbering available from Sangon company.Taq archaeal dna polymerase and reaction buffer are available from TaKaRa company.
Response procedures is, 94 ℃ of pre-sex change 4min, 94 ℃ of 15S then, 37 ℃ of 30S, 72 ℃ of 75S circulation 45 times down, and 72 ℃ are kept under 4 ℃ of conditions after extending 7min.The PCR instrument is Life express TC-48/H/ (t) the Thermal Cycler that Japan is big and company makes.
Get 10 μ l PCR reaction product and 2 μ l sample-loading buffer (0.09% bromjophenol blues, 60% glycerine, 60mM EDTA) mixing, click and enter in 1.4% sepharose that contains 0.5mg/L EB, sample introduction is 15 minutes under 120V, electrophoresis 2 hours under 80V takes out gel then, adopts the analysis of taking a picture of Kodak EDAS-120 gel analysis system.
1.2.2 acquisition with the chain special SCAR mark of the orange heart
1.2.2.1RAPD the recovery of product, clone and order-checking
Proved chain RAPD mark with the recovery of Gene-Clean test kit (Bio-Lab company) purifying, be connected to then on pGEM@-T Vector Easy (Promega company) carrier, recombinant plasmid dna is carried out enzyme with EcoRI cut processing, verify amplified production with RAPD-PCR, whether the fragment that observation amplifies is consistent with original purpose fragment and endonuclease bamhi.The checking back is given birth to worker company by Shanghai and is finished order-checking.Through the electrophoresis checking, amplified fragments is consistent with the target fragment size, and the about 850bp of fragment length after the order-checking of worker company is given birth in Shanghai, has obtained the sequence fragment of 845bp.
1.2.2.2SCAR primer design and PCR reaction
Two ends sequences Design primer according to sequencing result is right, length 16-20 base.As follows with the reaction conditions that the SCAR primer increases: the reaction system of 25 μ l comprises 2.5 μ l, 10 * buffer, 3.3 μ l 15mM MgCl
2, 2.0 μ l 2.5mM dNTP, 1.0 μ l Primer 1 (15ng/ μ l), 1.0 μ l Primer 2 (15ng/ μ l), 2.0 μ l template DNAs (5ng/ μ l) and 0.2 μ l TaqE (5U/ μ l).The response procedures of SCAR-PCR is: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 1min then, 37 ℃ of annealing 1min, 72 ℃ are extended 2min, 35 circulations; Extend 7min, 4 ℃ of preservations at 72 ℃ again.Get 10 μ l reaction product, with 2 μ l bromjophenol blue (0.25% bromjophenol blues, 40% aqueous sucrose solution) mixing, click and enter in 1.0% sepharose that contains 0.5 μ g/ml EB, under 5V/cm strength of electric field the about 1-2 of voltage stabilizing electrophoresis hour, after EB dyeing, analyze photograph with Kodak EDAS-120 gel analysis instrument.
Two, result and analysis
2.1 being the ball look of colony, identifies DH
Harvesting time 100 double haploid strain systems have been carried out the ball look and identified that wherein orange heart strain is 59, white heart strain is 41, through Chi-square test, and x
2=3.24＜x20.05=3.841, the theory that meets 1: 1 is separated, and illustrates that the orange heart is the simple inheritance of single-gene control.Now temporarily orange heart gene is named the gene into Or.
2.2 random primer screening
At first two parents are screened the RAPD primer that can produce polymorphism, 10 base primerses (A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, S, T, U, V, W, X, Y, Z) of 500 Operon series of 25 covers have been screened, 462 primers band clearly that can increase wherein, effectively the ratio of primer is 92.4%, bands of a spectrum add up to 2032, and on average the broadband number of each primer amplification is 4.1.124 of the primers that polymorphism difference is arranged between parents repeat through 2 times, remove the primer of poor repeatability, obtain 97 of the polymorphic primers of stable performance between parents.
In being, 59 orange heart DH strains systems and 41 white heart DH strains respectively select 8 strains at random, mix respectively and form orange heart pond and Bai Xinchi, utilize discrepant 97 primers that the DNA in two ponds is increased, find 13 primers variant bands of a spectrum between two ponds, but carry out individual plant when conclusive evidence opening the pond, wherein the mark of 12 primer amplifications not with orange bulbus cordis color base because of chain or chain not tight, see Table 1.And the molecular weight that primer OPB01 (5 '-GTTTCGCTCC-3 ') produces to be the band OPB01-845 of 845bp exist in each individual plant in orange heart pond, and in the individual plant of Bai Xinchi, do not exist, repeat 3 times, the consistent (see figure 1) of result determines that tentatively OPB01-845 and orange bulbus cordis color base are because of existing linkage relationship.
13 primer amplifications of table 1 to be marked at statistics in two ponds
| Primer | Mark | Individual plant in the orange heart pond | Individual plant among the Bai Xinchi | ||
| Underlined strain number | Unmarked strain number | Underlined strain number | Unmarked strain number | ||
| OPA04 OPB01 OPB05 OPB13 OPB19 OPE18 OPF16 OPJ14 OPM18 OPN17 OPO20 OPP17 OPT19 | OPA04-600 OPB01-845 OPB05-550 OPB13-620 OPB19-900 OPE18-350 OPF16-300 OPJ14-700 OPM18-980 OPN17-600 OPO20-460 OPP17-2000 OPT19-700 | 4 8 2 2 6 3 4 3 4 5 6 3 7 | 4 0 6 6 2 5 4 5 4 3 2 5 1 | 1 0 0 1 2 1 2 0 1 2 3 1 3 | 7 8 8 7 6 7 6 8 7 6 5 7 5 |
Fig. 1 primer OPB01 is to each DH individual plant DNA cloning result in two parents, Liang Chi and the pond
C: negative control; M: molecular weight standard (100bp DNA ladder); 1:P1,91-112; 2:P2, T12-19; 3: Bai Xinchi; 4: orange heart pond; 5～12: each individual plant among the Bai Xinchi; 13～20: each individual plant in the orange heart pond
2.3 the further checking of the mensuration of linkage distance and linkage relationship
To 100 DH strains is that DNA carries out pcr amplification with primer OPB01, and the 60 strains OPB01-845 that increases is arranged, and 40 strains this band that do not increase meets separation in 1: 1 through chi square test, and this result is consistent with the phenotype detected result.In the orange heart individual plant of 59 strains only 3 strains OPB01-845 does not appear through OPB01 amplification, the 4 strains OPB01-845 that increases is only arranged in the white heart individual plant of 41 strains, promptly in 100 DH strains systems 7 exchange strains systems are arranged, recombination fraction is 7%.Repeat once, as a result unanimity.Phenotypic character according to amplification and plant is measured linkage distance, the results are shown in Table 2.Use Mapmaker Ver.3.0 (Lander E S, Green P, Abrahamson J.MAPMARKER:an interactive computer package forconstructing primary genetic linkage maps of experimental and naturalpopulations.Genomics, 1987,1:174～181.) calculating genetic distance is 3.8cM (centimorgan), the LOD value is 19.05, shows that OPB01-845 and orange heart gene are close linkage.
The genetic distance measurement result of table 2 OPB01-845 mark and orange heart gene (Or)
| The ball look | The strain number | OPB01-84 5 marks are arranged | No OPB01-84 5 marks | The recombinant strain number | Genetic distance (cM) | The LOD value |
| The orange heart | 59 | 56 | 3 | 7 | 3.8 | 19.05 |
| The white heart | 41 | 4 | 37 |
For further confirming the linkage relationship of OPB01-845 and orange heart gene, choosing another colony---orange heart self-mating system 99-63 is hybridized 78 the F2 individual plants (F3 does not separate for the ball look) that obtain with white heart self-mating system 99-2, carry out pcr amplification with primer OPB01, wherein, 42 orange heart plant OPB01-845 that all increases; The 28 strains OPB01-845 that do not increase is arranged in 36 white heart plant, 8 strains this band that increases is arranged, this 8 strain is the exchange strain, identifies that with field ball look the rate of coincideing is 89.7%.This and 93% identical rate basically identical in DH colony.This result has further confirmed the close linkage relation of OPB01-845 and the orange heart gene of Chinese cabbage.
2.4 the sequencing result of specific fragment and SCAR primer are to design
The sequencing result of specific fragment OPB01-845 is as follows.The sequence total length is 845bp, and two ends respectively comprise an OPB01 sequence (5 '-GTTTCGCTCC-3 ').
According to sequencing result, two ends respectively prolong 10 bases, design a pair of 20 base primers SCB01L (5 '-GTTTCGCTCCCTTCTTCAAA-3 '), SCB01R (5 '-GTTTCGCTCCTCCATGACAT-3 ').Primer is given birth to worker company by Shanghai and is synthesized.
GTTTCGCTCCCTTCTTCAAATCTTCCGCAATTGACGGCGAATCTGATC
TGGGTTCGTCGGAAAAAGCTTCCGCCTTTGGCGAATCGGCGTCTTGGGTT
TTCGCGATTTTTCTTTTGTTCGGGGAGGGAGATGAATTGGAAGCTTGGGG
GGTCGTTTTCTTCTTGGCGGATGCGCGAGCGTTGGACATGAGAGCGTCGA
ATGCAGAGGGGCGAGAAGAAGACATTGCTCTGTGGTGGAGGCGCGAGGT
GAAGGGAAAGGGGGAAACCAATGCGGAGGAGAATCGAGTTTTAGTGCA
GAGAGAAGAAATGCATCGGAAGTGATTCGATGATCGAATCGCTAACATC
AGTTTGACTCAGAGAGAGAGAAAGGTAGAGTTTTTTTGAAATTAGGGTTT
ATGAATTTACGGAGAGGACACGTGTTGCAATCTTGAAGAAAGAAAAATA
TGGCGGCAGAGTTTCTCCTCTGCTTTGGACGTAGATGATGAGTATATATA
TACAAATTAATTTGAATATTTTGACTTATTAACTCTTTTTATTAACAATTA
TATATACTAGATCCTCTGTCCGCGCTACGCGCGGATTATAAATTTTAAAT
ATATTATTCATAATTATTATTAATATGTGAATATTTTTACTTTGTATTTAA
TTTAATTTTAATGTTTAATAGTATCTTTAGCAGTTTTCTATTATTTTTTTTT
ACGTTTTTGTTTTCTATAAATTTAGAAATTTTGTAAAATTTGGTATATGCA
CCACTTAGCTTTGGTCTTATGATATGTCTACATTTTATGAACACACTGAAA
ATGGTGTTGAAATCACGTTATCTTTT
ATGTCATGGAGGAGCGAAAC
Utilize synthetic SCAR primer, under 58 ℃ annealing temperatures and 35 round-robin conditions, obtained SCAR amplification preferably.This is first chain SCAR mark of present Chinese cabbage and orange disposition shape, with its called after SCB01-845 mark.
To 100 strains of DH colony is that DNA carries out pcr amplification with the SCAR primer to SCB01, can see the single band that increases about a long 845bp, the 60 strains OPB01-845 that increases is arranged in 100 DH strains system, 40 strains are not increased, and this is with, and this amplification is consistent with the separating resulting of RAPD mark OPB01-845 in DH colony.
The results are shown in shown in Figure 2, M wherein: molecular weight standard (100bp DNA ladder); CK: negative control; W: Bai Xinchi; Or: orange heart pond; 1-32:DH strain system.
To 78 F2 individual plants with the SCB01 primer to carrying out pcr amplification, 42 orange heart individual plants SCB01-845 that all increases, the 29 strains SCB01-845 that do not increase is arranged in 36 white heart individual plants, 8 strains this band that increases is arranged, and this pcr amplification result is consistent with the separating resulting of RAPD mark OPB01-845 in 78 F2 individual plants.
To carrying out pcr amplification in 100 DH strain systems and 78 F2 individual plants, amplification shows that all SCAR mark SCB01-845 is consistent with the separating resulting of RAPD mark OPB01-845, is collinearity and separates with design synthetic SCAR primer.This explanation RAPD mark OPB01-845 is successful is converted into SCAR mark SCB01-845.
The identical rate that SCAR mark SCB01-845 and field ball look are identified in DH colony is 93%, the identical rate that SCAR mark SCB01-845 and field ball look are identified in 78 F2 individual plants is 89.7%, 90% detection accuracy rate illustrates that this SCAR mark can be applied in the breeding assisted Selection, thereby improve the efficiency of selection in the breeding of ball look, accelerate breeding process.
Sequence table
＜110〉Beijing City Agriculture and Forestry Institute
＜120〉with closely linked characteristic sequence amplification label of the orange disposition shape of Chinese cabbage and preparation method thereof
<130>
<160>3
<170>PatentIn version 3.1
<210>1
<211>845
<212>DNA
＜213〉rape kind rape belongs to Chinese cabbage subspecies (Brassica campestris L.ssp.pekinensis)
<400>1
gtttcgctcc cttcttcaaa tcttccgcaa ttgacggcga atctgatctg ggttcgtcgg 60
aaaaagcttc cgcctttggc gaatcggcgt cttgggtttt cgcgattttt cttttgttcg 120
gggagggaga tgaattggaa gcttgggggg tcgttttctt cttggcggat gcgcgagcgt 180
tggacatgag agcgtcgaat gcagaggggc gagaagaaga cattgctctg tggtggaggc 240
gcgaggtgaa gggaaagggg gaaaccaatg cggaggagaa tcgagtttta gtgcagagag 300
aagaaatgca tcggaagtga ttcgatgatc gaatcgctaa catcagtttg actcagagag 360
agagaaaggt agagtttttt tgaaattagg gtttatgaat ttacggagag gacacgtgtt 420
gcaatcttga agaaagaaaa atatggcggc agagtttctc ctctgctttg gacgtagatg 480
atgagtatat atatacaaat taatttgaat attttgactt attaactctt tttattaaca 540
attatatata ctagatcctc tgtccgcgct acgcgcggat tataaatttt aaatatatta 600
ttcataatta ttattaatat gtgaatattt ttactttgta tttaatttaa ttttaatgtt 660
taatagtatc tttagcagtt ttctattatt tttttttacg tttttgtttt ctataaattt 720
agaaattttg taaaatttgg tatatgcacc acttagcttt ggtcttatga tatgtctaca 780
ttttatgaac acactgaaaa tggtgttgaa atcacgttat cttttatgtc atggaggagc 840
gaaac 845
<210>2
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉with the closely linked SCAR upstream region of gene of the orange disposition shape of Chinese cabbage primer
<400>2
<210>3
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉with the closely linked SCAR gene of the orange disposition shape of Chinese cabbage downstream primer
<400>3
Claims (7)
1, the closely linked characteristic sequence amplification label of the orange disposition shape of a kind of and Chinese cabbage, it has the described dna sequence dna of SEQ ID NO:1 in the sequence table.
2, the preparation method of the closely linked characteristic sequence amplification label of the orange disposition shape of a kind of and Chinese cabbage, it is characterized in that: described method comprises the steps:
1) with the screening of the chain special randomly amplified polymorphic DNA mark of the orange heart: extract genomic dna, use randomly amplified polymorphic DNA mark random primer that genomic dna is carried out the PCR reaction, the PCR product is carried out electrophoretic analysis; By mixing the fractional analysis method, seek and the chain randomly amplified polymorphic DNA mark mark of orange disposition shape, measure linkage distance and verify linkage relationship; Characteristic sequence amplification label primer is: 5 '-GTTTCGCTCCCTTCTTCAAA-3 ' and 5 '-GTTTCGCTCCTCCATGACAT-3 ';
2) with the acquisition of the chain characteristic sequence amplification label of the orange heart: the randomly amplified polymorphic DNA marked product is reclaimed, clones and checks order, two ends sequences Design primer according to sequencing result is right, 20 bases of length, carry out pcr amplification reaction with characteristic sequence amplification label primer, reaction product is carried out electrophoretic analysis, measure linkage distance and verify linkage relationship.
3, the preparation method of the closely linked characteristic sequence amplification label of the orange disposition shape of according to claim 2 and Chinese cabbage, it is characterized in that: the extraction genomic dna in the described step 1) is meant the blade grind into powder in liquid nitrogen that 1.5 grams is removed petiole, add 9ml 2%CTAB extracting solution, 65 ℃ of water-baths of mixing 1 hour; From water-bath, take out centrifuge tube, add 1/3 volume 5M Potassium ethanoate, mixing ice bath 20 minutes; Add equal-volume chloroform/primary isoamyl alcohol extracting twice; Get supernatant and add 2/3 volume isopropanol precipitating DNA; The lavation buffer solution washing once dries up, and adds the dissolving of TE damping fluid; Add RNase A and make its final concentration reach 100 μ g/ml, 37 ℃ of water-baths of mixing 1 hour; With equal-volume chloroform/primary isoamyl alcohol extracting; Get supernatant, add 1/2 volume 7.5M ammonium acetate and 2 times of volume dehydrated alcohol deposit D NA; 70% washing with alcohol precipitation dries up, and adds an amount of ddH
2The O dissolving DNA.
4, the preparation method of the closely linked characteristic sequence amplification label of the orange disposition shape of according to claim 2 and Chinese cabbage, it is characterized in that: the PCR reaction conditions in the described step 1) is: contain 2.5 μ l, 10 * buffer in the reaction system of 25 μ l, 2.0 μ l 25mM MgCl
2, 2.0 μ l 2.5mM dNTP, 1U Taq archaeal dna polymerase, 30ng RAPD random primer, 50ng template DNA; Response procedures is, 94 ℃ of pre-sex change 4min, 94 ℃ of 15S then, 37 ℃ of 30S, 72 ℃ of 75S circulation 45 times down, and 72 ℃ are kept under 4 ℃ of conditions after extending 7min.
5. the preparation method of according to claim 2 and the closely linked characteristic sequence amplification label of the orange disposition shape of Chinese cabbage, it is characterized in that: the recovery of randomly amplified polymorphic DNA marked product described step 2), clone and order-checking are meant with the recovery of Gene-Clean test kit purifying and have proved chain randomly amplified polymorphic DNA mark, be connected to then on the pGEM@-T Vector Easy carrier, recombinant plasmid dna is carried out enzyme with EcoRI cut processing, verify amplified production with RAPD-PCR, whether the fragment that observation amplifies is consistent with original purpose fragment and endonuclease bamhi, and order-checking.
6. the preparation method of according to claim 2 and the closely linked characteristic sequence amplification label of the orange disposition shape of Chinese cabbage, it is characterized in that: the condition of the pcr amplification reaction described step 2) is: the reaction system of 25 μ l comprises 2.5 μ l, 10 * buffer, 3.3 μ l 15mM MgCl
2, 2.0 μ l 2.5mMdNTP, 1.0 μ l Primer 1,1.0 μ l Primer, 2,2.0 μ l template DNAs and 0.2 μ l TaqE; The response procedures of SCAR-PCR is: 94 ℃ of pre-sex change 5min 35 circulations of 37 ℃ of annealing of 94 ℃ of sex change 1min 1min 72 ℃ of extensions 2min then; Extend 7min, 4 ℃ of preservations at 72 ℃ again.
7. the preparation method of according to claim 2 and the closely linked characteristic sequence amplification label of the orange disposition shape of Chinese cabbage, it is characterized in that: the mensuration linkage distance described step 2) also verifies that linkage relationship is meant: strain is that DNA carries out pcr amplification with characteristic sequence amplification label primer to DH, phenotypic character according to amplification and plant is measured linkage relationship, uses Mapmaker Ver.3.0 and calculates genetic distance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03157031 CN1262653C (en) | 2003-09-11 | 2003-09-11 | Feature sequence amplification mark closely interlocked with Chinese cabbage tangerine core character and obtaining method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03157031 CN1262653C (en) | 2003-09-11 | 2003-09-11 | Feature sequence amplification mark closely interlocked with Chinese cabbage tangerine core character and obtaining method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1594588A CN1594588A (en) | 2005-03-16 |
| CN1262653C true CN1262653C (en) | 2006-07-05 |
Family
ID=34660172
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03157031 Expired - Fee Related CN1262653C (en) | 2003-09-11 | 2003-09-11 | Feature sequence amplification mark closely interlocked with Chinese cabbage tangerine core character and obtaining method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1262653C (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1314816C (en) * | 2005-03-21 | 2007-05-09 | 北京市农林科学院 | Molecular mark of watermelon linked to gene resistant to field pumpkin yellowwatermelon yellow mosaic virus and uses |
| CN100460521C (en) * | 2006-10-17 | 2009-02-11 | 西北农林科技大学 | SCAR marking method for identifying Chinese cabbage variety and detecting seed purity |
| CN101440366B (en) * | 2007-11-23 | 2010-10-27 | 北京市农林科学院 | Specific fragment tightly linked to musk melon powdery mildew resistance gene Pm-2F and obtaining method thereof |
| CN101899439B (en) * | 2007-11-23 | 2013-05-01 | 北京市农林科学院 | Specific fragment closely associated with resistance gene Pm-2F of melon powdery mildew and obtainment method thereof |
| CN102703445B (en) * | 2012-05-31 | 2013-07-24 | 山东省农业科学院蔬菜研究所 | Specific molecular markers of eIF4E.a mutation site of Chinese cabbage and application of Specific molecular markers |
| CN115369123B (en) * | 2022-09-22 | 2023-07-25 | 河南省农业科学院园艺研究所 | KASP (KASP) mark of dominant orange gene BrOr of Chinese cabbage and application thereof |
-
2003
- 2003-09-11 CN CN 03157031 patent/CN1262653C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1594588A (en) | 2005-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103583470B (en) | A kind of breeding method of the blue or green shank and recessive white feather chicken strain based on molecule assisted Selection | |
| CN105505927B (en) | Grass carp sugar tolerance can relevant SNP marker and its application | |
| CN108220408B (en) | Grain-saving green-shin recessive white feather broiler new strain breeding method | |
| CN106498052B (en) | Molecular labeling, detection method and its application of one influence goat early growth | |
| CN107058516B (en) | Molecular marker of rice grain width gene GW2 and application thereof | |
| CN103563851B (en) | Method for cultivating dominant-green-shin white feather broiler strain based on molecular assistant selection | |
| CN114182045B (en) | Soybean high-protein content related molecular marker located on chromosome 14 and method for identifying soybean high-protein content | |
| CN105506162B (en) | SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof | |
| CN106868112B (en) | molecular identification method for culter alburnus, triangular bream and filial generation thereof | |
| CN106755357A (en) | Differentiate CAPS molecule labelling methods and the application of atropurpureus striped pericarp tomato | |
| CN109554486A (en) | SNP marker relevant to grass carp character and its application | |
| CN105087768B (en) | A kind of method of the anti-bean weevil kind of molecular marking supplementary breeding mung bean | |
| EP3831955A1 (en) | Fine mapping and validation of qtl underlying fiber content and seed coat color traits and identification of snp markers for marker assisted selection of these traits derived from yellow seed coat (ysc) canola line yn01-429 and its lineage | |
| CN104073486A (en) | SNP site related to rapid growth of largemouth black bass as well as identification method and application thereof | |
| CN104823919A (en) | Cultivation method and application of recessive white feather new strain of Xiaoxiang chicken in southeast of Guizhou province | |
| CN1262653C (en) | Feature sequence amplification mark closely interlocked with Chinese cabbage tangerine core character and obtaining method thereof | |
| CN114959050A (en) | Method for identifying parent and child of red swamp crayfish based on four-base microsatellite fluorescent multiplex PCR | |
| CN108486278B (en) | Primer pair for identifying gibberellic disease resistance of Ningmai No. 9 and derivative variety thereof and application | |
| KR101660951B1 (en) | Single nucleotide polymophism maker for selecting watermelon clutivar and uses thereof | |
| KR102064039B1 (en) | Method for identification and parentage using marker in Ephinephelus akaara | |
| CN105624318A (en) | SNP site related to growth trait of paralichthys olivaceus as well as screening method and application of SNP site | |
| CN108250285B (en) | Haplotype marker related to rapid growth of largemouth bass and application thereof | |
| Yi et al. | Microsatellite analysis of genetic diversity and genetic structure in five consecutive breeding generations of mandarin fish Siniperca chuatsi (Basilewsky) | |
| CN110592079A (en) | Rice long and thin granule gene SLG7 molecular marker primer and application thereof | |
| CN110041422B (en) | SNP (Single nucleotide polymorphism) locus related to growth of largemouth bass and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |