CN104513859B - Function marker of rice grain length gene GS3 and application of function marker - Google Patents
Function marker of rice grain length gene GS3 and application of function marker Download PDFInfo
- Publication number
- CN104513859B CN104513859B CN201410852508.4A CN201410852508A CN104513859B CN 104513859 B CN104513859 B CN 104513859B CN 201410852508 A CN201410852508 A CN 201410852508A CN 104513859 B CN104513859 B CN 104513859B
- Authority
- CN
- China
- Prior art keywords
- grain length
- rice
- primer
- functional label
- allele
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Abstract
The invention belongs to the technical field of agricultural biotechnology and provides a function marker of a rice grain length gene GS3 and application of the function marker. According to the function marker, three primers gs3In, gs3F and gs3R are designed and synthesized for simultaneously amplifying different paddy rice DNAs in a PCR (Polymerase Chain Reaction) system, and whether amplification products contain gs3 allelic genes or not is detected through electrophoresis. In the process, the amplification products do not need to be subjected to enzyme digestion, and whether the amplification products contain the gs allelic genes or not can be directly detected through electrophoresis, so that the process is simplified, whether rice germplasm resources or breeding populations contain gs allelic genes or not can be quickly and accurately identified, the breeding progress in breeding application is accelerated, and the efficiency is improved.
Description
Technical field
The invention belongs to agricultural biological technical field, relate to functional label and the application thereof of a kind of Oryza sativa L. grain length gene GS3.
Background technology
Oryza sativa L. is important cereal crops, and the population for whole world half provides grain ration.Along with the growth of world population, water
Rice as staple food crop be faced with improve yield in the urgent need to.Expecting the year two thousand thirty, rice yield needs to improve
More than 40% needs that could meet the mankind.
Oryza sativa L. single plant yield is weighed three factors by number of productive ear, number of grain per ear and grain and together decides on, for Oryza sativa L.
For overall yield, these three factor surface is independent but interrelated, a lot of in the case of there will be this and disappear that
Long contradiction.When number of productive ear and number of grain per ear reach the higher level of a relative ideal, improve the weight of seed
It will be one of key factor improving rice yield.Research shows, rice grain weight by the wide decision of Oryza sativa L. grain length and grain,
Main effect QTL (quantitative trait locus, the quantitative trait locus) site controlling Oryza sativa L. grain length identified at first
GS3 is to control rice grain weight and the main effect QTL of grain length, is the most also to control rice grain width and the minor effect of grain-filling degree
QTL.GS3cDNA total length 956bp, comprises 5 exons, be encoded to one by 232 aminoacid form across
Memebrane protein.Show through sequence analysis, compared with granule kind, big grain kind GS3 exon 2 encodes the 55th
The codon TGC of position cysteine is mutated into termination codon TGA, causes protein translation to terminate in advance (having lacked 178
Individual aminoacid).
In existing research, GS3 exploitation has functional label sf28, is made up of positive and negative two primers, needs after PCR amplification
Restriction enzyme enzyme action digests overnight, then carries out electrophoresis detection, and cost is high, the longest, is not suitable with high-throughout molecule
Marker assisted selection.
Summary of the invention
For above technical problem, the invention provides functional label and the application thereof of a kind of Oryza sativa L. grain length gene GS3.
The functional label of Oryza sativa L. grain length gene GS3, allelic dominant point of the grain length of described Oryza sativa L. grain length gene GS3
Sub-labelling M-GS3 is by following three primers acquisition functional label:
Gs3F primer: ATTGGCTTGATTTCCTGTGC；
Gs3In primer: GCAGGCTGGCTTACTTTCTT；
Gs3R primer: TTGCTCTTACGGGAGGACAC；
Wherein, the sequence of described gs3In is mated with described GS3 allele, and introduces a mispairing at 3 ' ends.
As a further improvement on the present invention, during amplifying rice genomic DNA, if contain 720bp and 308bp simultaneously
Article two, characteristic bands, then be containing grain length gs3 allele；If containing only the characteristic bands of 720bp, then for not containing
Grain length gs3 allele.
As a further improvement on the present invention, the functional label of described Oryza sativa L. grain length gene GS3 uses following steps to carry out
Molecular marker:
Step 1): the extraction of rice plant genomic DNA；
Step 2): PCR expands: join in PCR reaction system by described gs3F, gs3In and gs3R primer,
And described rice plant genomic DNA is carried out amplification obtain amplified production；Described PCR response procedures is: 94 DEG C pre-
Degeneration 5min；Then 94 DEG C of degeneration 30s, 55 DEG C of degeneration 30s, 72 DEG C of degeneration 45s, circulate 35 times；Then 72 DEG C
Amplified production is obtained after extending 10min；
Step 3): by amplified production electrophoresis in quality is than the agarose gel that concentration is 1.2%, then ethidium bromide
Dyeing, observes and takes pictures under uviol lamp and obtain electrophoretogram；
Step 4): it is analyzed according to electrophoretogram, if contain two characteristic bands of 720bp and 308bp, then simultaneously
For containing grain length gs3 allele；If containing only the characteristic bands of 720bp, then it is without grain length gs3 allele,
For short grained variety.
As a further improvement on the present invention, in above-mentioned steps, described PCR reaction system is the system of 20 μ L: 2.0 μ L
10 × Buffer, the gs3R of gs3In and 4mol/L of gs3F, 4mol/L of dNTPs, 4mol/L of 2.0 μ L
The each 1.0 μ L of primer, 0.2 μ L Taq archaeal dna polymerase, 2.0 μ L template DNAs, 12.8 μ L ddH2O。
Present invention also offers the application in rice breeding of the functional label of Oryza sativa L. grain length gene GS3.
Compared with prior art, the invention have the benefit that
The present invention is directed to technical problem, devise primer gs3In (3 ' the end mispairing that can mate long grain allele gs3
One base), and a primer gs3F at its upstream, one gs3R of downstream design.Article three, primer is simultaneously in PCR system
In expand, the sequence of long grain allele gs3 and gs3In only one of which base mispairing, therefore between gs3F and gs3In
308bp can expand out；And short grain allele GS3 and primer gs3In has two base mispairings, then the band of 308bp is the most not
Can expand out.So, amplified production is made without enzyme action, and whether direct electrophoresis detection contains the band of 308bp,
Just can detect whether containing gs allele；Simplify step, Rice Germplasm Resources can not only be identified fast and accurately
Or whether breeding population contains gs allele, and in breeding, accelerate selection-breeding process, improve efficiency.
Accompanying drawing explanation
Fig. 1 is grain length of the present invention allelic amplification schematic diagram；
Fig. 2 is the electrophoretogram that the present invention detects 24 rice varieties molecular markers.
In figure, M is Marker200, from top to bottom band be respectively 2000bp, 1000bp, 750bp, 500bp,
200bp and 100bp；1-II-32B；2-BX-16；3-hilllock 46B；4-spy B；The good rich B of 5-；6-112B；7-west is luxuriant and rich with fragrance
B；The 8-rich B of dragon；9-wins IIB；10-158B；11-ground paddy B；Her B of 12-good fortune；13-paddy prunus mume (sieb.) sieb.et zucc. No. 4；14-02428；
15-south round-grained rice 46；16-BL122；17-wins IIIB；The blue or green early B of 18-association；19-B5；20-IRBB7；21-L427；22-
Gold 23B；Fragrant B in 23-；The safe rich B of 24-.
Detailed description of the invention
Below with reference to drawings and Examples, technical solution of the present invention is further described.
Embodiment 1
It is embodied as step as follows:
(1) oryza sativa genomic dna extracts
Take respectively and plant 24 parts of rice leafs in Nanning, by CTAB method (cetyl trimethylammonium bromide method)
Extract oryza sativa genomic dna；
(2) PCR amplification
PCR reaction system is the system of 20 μ L: 2.0 μ L 10 × Buffer, 2.0 μ L dNTPs, gs3F, gs3In and gs3R
The each 1.0 μ L (4mol/L) of primer, 0.2 μ L Taq archaeal dna polymerase, 2.0 μ L template DNAs, 12.8 μ L ddH2O。
PCR response procedures is 94 DEG C of 5min；Then 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, circulate 35 times；Finally
72 DEG C extend 10min and obtain amplified production；
(3) amplified production is carried out in 1.2% agarose gel electrophoresis, ethidium bromide staining, observe under uviol lamp and clap
According to obtaining electrophoretogram；
(4) result and analysis:
The electrophoretogram of the molecular marker of 24 rice varieties refers to Fig. 1, the grain length phenotype of 24 rice varieties and gene traits
Refer to table 1.From Fig. 1 and Biao 1: genotype be "+" be the product having 720bp and 308bp two band in Fig. 1
Kind, its grain length is longer；Gene traits is the kind only having 720bp band in Fig. 1 for "-", and its grain length is the shortest.
1 24 rice varieties of table and grain length phenotype thereof and gene traits
| Numbering | Kind | Grain length mm | Genotype | Numbering | Kind | Grain length mm | Genotype |
| 1 | II-32B | 7.6 | - | 13 | Paddy prunus mume (sieb.) sieb.et zucc. No. 4 | 7.5 | - |
| 2 | BX-16 | 13.1 | + | 14 | 02428 | 6.7 | - |
| 3 | Hilllock 46B | 7.8 | - | 15 | South round-grained rice 46 | 7.6 | - |
| 4 | Special B | 8.2 | - | 16 | BL122 | 8.1 | - |
| 5 | Good rich B | 9.5 | + | 17 | Rich IIIB | 8.4 | - |
| 6 | 112B | 8.5 | - | 18 | The blue or green early B of association | 10.0 | + |
| 7 | The luxuriant and rich with fragrance B in west | 7.4 | - | 19 | B5 | 10.1 | + |
| 8 | The rich B of dragon | 8.8 | + | 20 | IRBB7 | 9.7 | + |
| 9 | Rich IIB | 7.9 | - | 21 | L427 | 9.6 | + |
| 10 | 158B | 8.7 | + | 22 | Gold 23B | 10.0 | + |
| 11 | Ground paddy B | 8.4 | - | 23 | Interior fragrant B | 10.4 | + |
| 12 | Her B of good fortune | 8.4 | - | 24 | Safe rich B | 11.9 | + |
Remarks: genotype be "+" be the kind having 720bp and 308bp two band in Fig. 1, gene traits for "-"
For Fig. 1 only has the kind of 720bp band；
Below in conjunction with embodiment 2, the application in rice breeding of the functional label of Oryza sativa L. grain length gene GS3 is illustrated.
Embodiment 2:
Experiment purpose: labelling auxiliary improvement keeps the grain length of the beautiful B of system
Embodiment: Three-line rice keeps the beautiful B of system to be one of the parent in the main load of Guangxi late rice, and its grain length is 7.9mm,
And the grain length of preferably perfume B is 10.1mm.We are with beautiful B and the most fragrant B hybridization, are then female parent with beautiful B, Hou Daiyong
Labelling M-GS3 selects the individual plant existed containing grain length allele GS3 to be male parent continuous backcross to BC2F1, then selfing,
Finally choose economical character consistent with beautiful B, and the strain 10 that grain length is more than 9.5mm.
Above content is to combine concrete preferred implementation further description made for the present invention, it is impossible to assert
Being embodied as of the present invention is confined to these explanations.For general technical staff of the technical field of the invention,
Without departing from the inventive concept of the premise, it is also possible to make some simple deduction or replace, should be all considered as belonging to this
The protection domain of invention.
Claims (5)
1. the functional label of Oryza sativa L. grain length gene GS3, it is characterised in that the allelic dominant molecular marker M-GS3 of grain length of described Oryza sativa L. grain length gene GS3 is by following three primers acquisition functional label:
Gs3F primer: ATTGGCTTGATTTCCTGTGC；
Gs3In primer: GCAGGCTGGCTTACTTTCTT；
Gs3R primer: TTGCTCTTACGGGAGGACAC.
Functional label the most according to claim 1, it is characterised in that: during amplifying rice genomic DNA, if contain two characteristic bands of 720bp and 308bp simultaneously, then it is containing grain length gs3 allele；If containing only the characteristic bands of 720bp, then it is without grain length gs3 allele.
Functional label the most according to claim 1 and 2, it is characterised in that use following steps to carry out molecular marker:
Step 1): the extraction of rice plant genomic DNA；
Step 2): PCR expands: joined in PCR reaction system by described gs3F, gs3In and gs3R primer, and described rice plant genomic DNA is carried out amplification obtains amplified production；Described PCR response procedures is: 94 DEG C of denaturation 5 min；Then 94 DEG C of degeneration 30s, 55 DEG C of degeneration 30s, 72 DEG C of degeneration 45s, circulate 35 times；Then amplified production is obtained after 72 DEG C of extension 10 min；
Step 3): by amplified production electrophoresis in quality is than the agarose gel that concentration is 1.2%, then ethidium bromide staining, observes and takes pictures under uviol lamp and obtain electrophoretogram；
Step 4): be analyzed according to electrophoretogram, if contain two characteristic bands of 720bp and 308bp simultaneously, is then containing grain length gs3 allele；If containing only the characteristic bands of 720bp, then it is without grain length gs3 allele, for short grained variety.
Functional label the most according to claim 3, it is characterised in that: described PCR reaction system is the system of 20 μ L: the 10 × Buffer of 2.0 μ L, each 1.0 μ L of gs3R primer, the 0.2 μ L Taq of gs3In and 4mol/L of gs3F, 4mol/L of dNTPs, 4mol/L of 2.0 μ L
Archaeal dna polymerase, 2.0 μ L template DNAs, 12.8 μ L ddH2O。
5. the functional label of the Oryza sativa L. grain length gene GS3 described in claim 1 application in rice breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410852508.4A CN104513859B (en) | 2014-12-31 | 2014-12-31 | Function marker of rice grain length gene GS3 and application of function marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410852508.4A CN104513859B (en) | 2014-12-31 | 2014-12-31 | Function marker of rice grain length gene GS3 and application of function marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104513859A CN104513859A (en) | 2015-04-15 |
| CN104513859B true CN104513859B (en) | 2017-01-11 |
Family
ID=52789731
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410852508.4A Expired - Fee Related CN104513859B (en) | 2014-12-31 | 2014-12-31 | Function marker of rice grain length gene GS3 and application of function marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104513859B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108239673A (en) * | 2016-12-26 | 2018-07-03 | 中国科学院植物研究所 | A kind of method for cultivating high-yield crop and its special specific gene pack section and special primer pair |
| CN106755434B (en) * | 2016-12-28 | 2018-03-09 | 海南波莲水稻基因科技有限公司 | The molecular labeling of rice grain length gene qGL3 a kind of and its application |
| CN107603977A (en) * | 2017-09-25 | 2018-01-19 | 华南农业大学 | Rice seed holding gene qSH1 functional label and its application |
| CN108103230B (en) * | 2018-01-24 | 2021-03-23 | 中国水稻研究所 | Specific PCR molecular marker for detecting long and thin grain allele on rice grain shape QTLqGL35.1 |
| CN111849999B (en) * | 2019-10-24 | 2022-11-29 | 扬州大学 | Rice GS3 mutant gene, molecular marker and application thereof |
-
2014
- 2014-12-31 CN CN201410852508.4A patent/CN104513859B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104513859A (en) | 2015-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104513859B (en) | Function marker of rice grain length gene GS3 and application of function marker | |
| Cabrita et al. | Suitability of isozyme, RAPD and AFLP markers to assess genetic differences and relatedness among fig (Ficus carica L.) clones | |
| CN106755479B (en) | SSR molecular marker V for identifying progeny plants of Gala apples and application thereof | |
| CN102154471B (en) | Molecular marking method for major quantitative trait loci(QTL) for rice grain length | |
| CN103276071B (en) | Genotype identification primer and method of rice amylose content control gene Wx and identification method | |
| Chen et al. | Genetic diversity analysis of barley landraces and cultivars in the Shanghai region of China | |
| Khodayari et al. | Genetic diversity of cultivated barley landraces in Iran measured using microsatellites | |
| CN106591489B (en) | Molecular marker of rice grain length gene GW7 and special primer sequence thereof | |
| Kumar et al. | Deployment of gene specific marker in development of kunitz trypsin inhibitor free | |
| CN108486278B (en) | Primer pair for identifying gibberellic disease resistance of Ningmai No. 9 and derivative variety thereof and application | |
| CN103276054B (en) | Primer for auxiliary detection of soybean hundred-grain weight, and detection method thereof | |
| CN105543366B (en) | Development and application of specific SNP codominant molecular marker in rice blast-resistant gene Pi25 gene | |
| CN103695418A (en) | Maize phosphate starvation responses intron length polymorphism marker for corn | |
| Siva et al. | Genetic diversity study of important Indian rice genotypes using biochemical and molecular markers | |
| CN102912014A (en) | Method for screening medium amylase content rice and primer special for method | |
| CN105624277B (en) | Method for obtaining molecular marker closely linked with tobacco plant height development character | |
| CN101845499B (en) | Primer pair for assisting for screening wheat powdery mildew and its uses | |
| Ren et al. | Molecular identification of wheat leaf rust resistance genes in sixty Chinese wheat cultivars | |
| CN106811509A (en) | With the molecular labeling SVmc2 of hasked millet color gene close linkage | |
| Li et al. | SRAP molecular marker of sugar content and juice yield in sweet sorghum | |
| CN1594588A (en) | Feature sequence amplification mark closely interlocked with Chinese cabbage tangerine core character and obtaining method thereof | |
| CN103045744B (en) | Method for synchronously identifying transgenic mannose gene, glucanase gene, xylanase gene and galactosidase gene plants | |
| CN110484651B (en) | Molecular marker in wheat yield related gene TaNRT2-6D and application thereof | |
| Moradi et al. | Assessment of genetic diversity and identification of SSR markers associated with grain iron content in Iranian prevalent wheat genotypes | |
| Yadav et al. | Genetic diversity in cultivated gene pool of Indian barley (Hordeum vulgare L.): an analysis using SSR markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170111 Termination date: 20201231 |