CN108486278B - Primer pair for identifying gibberellic disease resistance of Ningmai No. 9 and derivative variety thereof and application - Google Patents

Abstract

The invention provides a group of primer pairs for identifying gibberellic disease resistance of Ningmai No. 9 and derived varieties thereof and application, wherein the sequences of the primer pairs are respectively shown as nucleotide sequences SEQ ID NO.1 and SEQ ID NO.2, after PCR amplification and agarose gel electrophoresis are carried out on wheat genome DNA by using the primers, if an amplification product contains a 819 b-sized strip, the wheat to be detected is proved to have gibberellic disease resistance genes, and otherwise, the wheat is susceptible; the method can quickly and intuitively obtain the scab resistance result of the wheat variety, and is suitable for large-scale breeding screening.

Description

Primer pair for identifying gibberellic disease resistance of Ningmai No. 9 and derivative variety thereof and application

Technical Field

The application relates to the field of wheat breeding, in particular to a group of primer pairs for identifying gibberellic disease resistance of Ningmai No. 9 and derived varieties thereof and application thereof.

Background

Wheat scab is a major fungal disease widely spread worldwide caused by fusarium and is one of the important diseases harming wheat production in China. In recent years, due to changes of climate warming and cultivation systems, the incidence range of wheat scab in China is on a trend of continuously expanding, the current common incidence area is expanded from the traditional incidence area, namely a winter wheat area in the middle and lower reaches of Yangtze river and a spring wheat area in the northeast of China, to a wheat area in the south of Huang-Huai, and diseases in the northern, southwest and northwest of Huang-Huai are obviously increased. The annual incidence area in the whole country in nearly five years exceeds 20 percent of the wheat planting area. Scab causes a decrease in wheat yield, typically resulting in 10% -15% yield loss each year, and even failure in pandemics. Gibberellic disease causes severe reduction of wheat yield, and mycotoxins such as Deoxynivalenol (DON) secreted by gibberellic disease affect wheat quality and food safety and seriously harm human and animal health. Therefore, the active and effective prevention and control of wheat scab has great significance for grain safety and food safety.

Ningmai No. 9 is a main cultivated variety of high-quality, high-yield and disease-resistant weak gluten wheat mainly developed in Jiangsu province, and is bred by adopting an improved group method by taking local Yangmai No. 6 as a female parent and taking Japanese West breeze as a male parent. The variety has the characteristics of high quality and weak gluten special quality, wheat yellow mosaic disease resistance, gibberellic disease resistance and the like, a batch of new wheat varieties suitable for being planted in wheat areas in the middle and lower reaches of Yangtze river have been bred by taking the variety as a parent, and the variety is an important parent for wheat breeding in China. Among them, at least 14 varieties approved by the state or Jiangsu province since 2006 have been obtained. Ningmai No. 9 as a new generation of backbone parent has important value for breeding new varieties of high-yield, high-quality and disease-resistant wheat. The effectiveness of the early generation gibberellic disease resistance selection of wheat cross breeding can be effectively improved by selecting a specific primer and applying the specific primer to gibberellic disease resistance molecular marker assisted breeding with Ningmai No. 9 and derived varieties as female parents. At present, primers for detecting gibberellic disease resistance of Ningmai No. 9 and derived varieties have not been reported.

Disclosure of Invention

Aiming at the problems, in order to rapidly identify the gibberellic disease resistance in No. 9 and derived varieties thereof and ensure that the resistance QTL can be reliably applied to the wheat breeding taking Ningmai No. 9 as a parent, the applicant designs a general primer which can be operated in a laboratory and can be distinguished by utilizing agarose gel electrophoresis according to the sequence difference between resistant varieties and applies the primer to the molecular marker assisted breeding of the wheat with the gibberellic disease resistance. By selecting the specific molecular marker and applying the specific molecular marker to the gibberellic disease resistant molecular marker assisted breeding with Ningmai No. 9 and derived varieties as female parents, the efficiency of early generation gibberellic disease resistance selection in wheat hybridization breeding can be effectively improved.

The purpose of the invention is realized as follows: a pair of primers for identifying gibberellic disease resistant genes of Ning Mai No. 9 and derived varieties thereof has an upstream primer nucleotide sequence shown as SEQ ID NO.1 and a downstream primer nucleotide sequence shown as SEQ ID NO. 2.

The application of the primer pairs with the nucleotide sequences respectively shown as SEQ ID NO.1 and SEQ ID NO.2 in identifying and identifying the gibberellic disease resistance of No. 9 and derived varieties thereof is to perform PCR amplification reaction by taking the genomic DNA of wheat to be detected as a template, perform electrophoresis separation detection on an amplification product in agarose gel, if the amplification product contains a band with the size of about 819 bp, the wheat to be detected has the gibberellic disease resistance of Ningmai No. 9, and otherwise the wheat to be detected has no gibberellic disease resistance.

In the application of the primer sequences:

the reaction system for PCR amplification (25. mu.L) was: 20-100ng wheat genome DNA to be detected, 0.25 muL of 5U/muL Taq enzyme, 1 muL of 10 mumol/L SEQ ID NO.1 and 2 respectively, 0.5 muL of 10 mmol/L dNTP and 10 XPCR Mg²⁺2.5 mu L of Plus buffer solution, and the balance of sterile distilled water;

the reaction conditions for PCR amplification are as follows: pre-denaturation at 94 ℃ for 5 min, followed by denaturation at 94 ℃ for 30 sec, annealing at 58 ℃ for 30 sec, and extension at 72 ℃ for 40 sec for 35 cycles; finally, the extension is carried out for 5 min at 72 ℃ and the product is stored at 4 ℃.

The detection of the electrophoretic separation of the amplification products in agarose gel means that: and (3) carrying out electrophoretic separation on the amplification product in agarose gel (containing EB with the final concentration of 0.5 mu g/mL) with the mass fraction of 0.8-2%, carrying out voltage of 130V and electrophoresis time of 20 min, and judging whether the amplification product contains a 819 bp band.

In the present application, the derivative variety nima 9 refers to: the variety bred by taking Ningmai No. 9 as a parent is preferably Ningmai No. 13, Ningmai No. 14, Ningmai No. 18, Sheng-selected No. 4, Sheng-selected No. 6, Zhenmai No. 5, Zhenmai No. 8, Yangmai No. 18 and Yangmai No. 4.

In the application, the evaluation criteria of wheat resistance are referred to in the specification of wheat variety gibberellic disease resistance identification.

The invention has the advantages that: designing gibberellic disease resistance primers aiming at Ningmai No. 9 and derived varieties thereof, carrying out PCR amplification on wheat genome DNA through SEQ ID NO.1 and SEQ ID NO.2, carrying out labeled detection on an amplification product through agarose electrophoresis, and carrying out detection without using a sequencer or non-denaturing gel electrophoresis, wherein the operation is simple; the method directly judges whether the wheat material contains the resistance gene of the gibberellic disease of Ningmai No. 9 by judging whether the 819 bp strip can be amplified by PCR product electrophoresis, is very intuitive, and does not need sequencing or comparing the size of the strip.

Drawings

FIG. 1: and detecting the amplification result of the gibberellic disease resistant varieties of the primers SEQ ID NO.1 and SEQ ID NO.2 by agarose electrophoresis.

M: molecular weight standard DL 2000; lanes 1-8 are sequentially wheat varieties Ningmai No. 9, Ningmai No. 13, Ningmai No. 14, Shengcai No. 6, Yangmai No. 4, Annong 8455, Clark and Afu.

Detailed Description

The wheat variety and pathogenic bacteria (fusarium graminearum FG 0609) related in the embodiment are from the wheat research institute of food crop research institute of agricultural academy of Jiangsu province;

the DNA extraction kit was purchased from Tiangen Biochemical technology Ltd, model DP 305.

Example 1 screening of Sambucus graminis QTL site for resistance to gibberellic disease associated with Ningmai No. 9 and design of specific primers

This example utilizes the Recombinant Inbred Line (RIL) population of the hybrid progeny of Ningmai No. 9 and Yangma 158 to carry out QTL mapping for gibberellic disease resistance. The recombinant inbred material is planted in test bases in hospital of agricultural departments of Jiangsu province in 2015-2016 and 2016-2017 in two continuous growing seasons, and gibberellic disease resistance identification is carried out on the recombinant inbred material according to the wheat variety gibberellic disease resistance identification regulation. The plant genome DNA extraction kit (Tiangen DP 305) is used for extracting DNA, the Illumina 90 k gene chip is used for carrying out genome scanning on test materials (the specific information is shown in Wang et al 2014, recombination of polyploid herbal differentiation using a high-density 90000 single nucleotide polymorphism array), IcMapping 4.1 software based on composite mixed linear model mapping is used for carrying out QTL positioning analysis, and finally, the Ningmai NO. 9 major gibberellic disease resistance QTL is found to be positioned between the molecular markers BS00098868_51 and Tdum _ ligation 80344_ 144. Aiming at the molecular marker interval locus, an upstream primer and a downstream primer are further designed and respectively shown as SEQ ID NO.1 and SEQ ID NO. 2:

the upstream primer is SEQ ID NO. 1:

5’- CGCCTAGGTGAAGCTAAGAT-3’；

the downstream primer is SEQ ID NO. 2:

5’- GGGCAGAGATTCTTTCCTTT -3’。

example 2 specific amplification of the primers in Ningmai No. 9 and derived varieties

The detection method comprises the following steps:

respectively taking SEQ ID NO.1 and SEQ ID NO.2 as primers, and taking wheat (wheat varieties: Ningmai No. 9, Ningmai No. 13, Ningmai No. 14, Shengcai No. 6, Yangmai No. 4, Annong 8455, Clark and Aff.) genome DNA (a DNA extraction method is shown in the specification of a DNA extraction kit) to be detected as a template for carrying out PCR amplification.

The PCR reaction system is as follows: 20 ng of DNA, 0.25. mu.L of 5U/. mu.L of Taq enzyme, 1. mu.L of each of SEQ ID NO.1 and SEQ ID NO.2 at 10. mu.mol/L, 0.5. mu.L of dNTP at 10 mmol/L, 2.5. mu.L of Mg2+ Plus buffer solution for 10 XPCR, followed by supplementing the reaction system with sterile distilled water to 25. mu.L;

PCR reaction procedure: the reaction system was pre-denatured at 94 ℃ for 5 min, followed by denaturation at 94 ℃ for 30 sec, annealing at 58 ℃ for 30 sec, and extension at 72 ℃ for 40 sec for 35 cycles; finally, the extension is carried out for 5 min at 72 ℃ and the product is stored at 4 ℃.

The amplification products were separated by electrophoresis in a 1.5% agarose gel (containing EB at a final concentration of 0.5. mu.g/mL), and the results of the detection were shown in FIG. 1.

Amplification products contain 819 bp bands of Yongmai No. 9, Ningmai No. 13, Ningmai No. 14, Sheng Zi No. 6 and Yangmai No. 4, which prove that the amplification products all contain scab resistance genes of Ningmai No. 9 and are disease-resistant varieties, wherein the Ningmai No. 13, the Ningmai No. 14, the Sheng Zi 6 and the Yangmai No. 4 are derived varieties of the Ningmai No. 9.

While Annong 8455, Clark and Aff did not amplify a band, which proves that the gibberellic disease resistance gene is not contained and is a susceptible variety.

Example 3 field experiment

The primer pairs obtained in the examples were further verified by a conventional field resistance identification method: when each wheat variety is in the flowering period, selecting a spikelet at the middle upper part of the spike to inoculate 10 mu L of 1 multiplied by 10⁵Of Gibberella spAnd (3) bagging the spore liquid (FG 0609) for 3 days, preserving moisture, inoculating 20 wheat ears for each variety, and investigating the diseased ear rate of each wheat variety 21 days after inoculation.

The disease resistance identification result shows that the disease spikelet rates of the disease-resistant variety are respectively 20.1% (Ningmai No. 9), 19.9% (Ningmai No. 13), 33.1% (Ningmai No. 14), 19.0% (Shengcai No. 6) and 23.6% (Yangmai No. 4), which proves that the disease-resistant variety is indeed resistant to the gibberellic disease; the disease spikelet rates of the susceptible varieties are respectively 89.8% (Annong 8455), 76.5% (Clark) and 71.5% (Aff), which proves that the susceptible varieties are not resistant to the gibberellic disease and are susceptible varieties.

From the above experimental results it can be derived: the PCR amplification is carried out on the wheat genome DNA through SEQ ID NO.1 and SEQ ID NO.2, and the judgment whether the wheat material contains the Ningmai No. 9 gibberellic disease resistance gene or not can be carried out through agarose electrophoresis by directly judging whether a 819 bp strip is amplified or not.

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> primer pair for identifying gibberellic disease resistance of Ningmai No. 9 and derived variety thereof and application

<141> 2018-06-26

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgcctaggtg aagctaagat 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gggcagagat tctttccttt 20

Claims (3)

1. The application of a group of primer pairs in identifying gibberellic disease resistance of Ningmai No. 9 and derived varieties thereof; the nucleotide sequences of the primer pair are shown as SEQ ID NO.1 and SEQ ID NO. 2;

the Ningmai No. 9 and its derivative varieties are Ningmai No. 9, Ningmai No. 13, Ningmai No. 14, Shengchou No. 6 and Yangyaomai No. 4.

2. The application of claim 1, comprising the following steps:

and (3) carrying out PCR amplification by taking SEQ ID NO.1 and SEQ ID NO.2 as primers and taking the genome DNA of the wheat to be detected as a template, carrying out agarose gel electrophoresis on an amplification product, and if the amplification product contains a band with the size of 819 bp, judging that the wheat to be detected is the wheat containing the Ningmai No. 9 scab resistant gene, otherwise, judging that the wheat to be detected is the infected wheat.

3. The use of claim 2, wherein the PCR amplification system is as follows: 20-100ng wheat genome DNA to be detected, 0.25 muL of 5U/muL Taq enzyme, 1 muL of 10 mumol/L SEQ ID NO.1 and 2 respectively, 0.5 muL of 10 mmol/L dNTP and 10 XPCR Mg²⁺2.5 mu L of Plus buffer solution, and the solution is supplemented to 25 mu L with sterile distilled water;

the reaction conditions for PCR amplification are as follows: pre-denaturation at 94 ℃ for 5 min, followed by denaturation at 94 ℃ for 30 sec, annealing at 58 ℃ for 30 sec, and extension at 72 ℃ for 40 sec for 35 cycles; finally, the extension is carried out for 5 min at 72 ℃ and the product is stored at 4 ℃.

Images