CN109402292B - Primer pair for detecting wheat scab resistance and application thereof - Google Patents
Primer pair for detecting wheat scab resistance and application thereof Download PDFInfo
- Publication number
- CN109402292B CN109402292B CN201811515195.8A CN201811515195A CN109402292B CN 109402292 B CN109402292 B CN 109402292B CN 201811515195 A CN201811515195 A CN 201811515195A CN 109402292 B CN109402292 B CN 109402292B
- Authority
- CN
- China
- Prior art keywords
- wheat
- seq
- resistance
- primer pair
- scab
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a pair of primers for detecting wheat scab resistance and application thereof, wherein nucleotide sequences of the primer pair are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2; the invention also provides the application of the primer pair in predicting the scab resistance of wheat, namely, the primer pair with the nucleotide sequences respectively shown as SEQ ID NO.1 and SEQ ID NO.2 is subjected to PCR amplification by using the wheat whole genome DNA as a template, an amplification product is electrophoresed on 1% agarose gel to obtain a detection result, and if the amplification product contains a 1000bp strip, the scab resistance of a wheat variety is judged to at least reach an anti-resistance level; otherwise, judging the wheat variety infected with the gibberellic disease; the method can be applied to screening of wheat scab resistant materials and molecular marker-assisted selective breeding to shorten breeding time.
Description
Technical Field
The invention belongs to the field of wheat genetic breeding and molecular biology, and particularly relates to a primer pair for detecting wheat scab resistance and application thereof.
Background
Scab (Fusarium Head light) is one of the important diseases that harm crops such as wheat, barley, oat and rye, and affects the yield and quality of wheat crops. Gibberellic disease occurs in large areas in wheat growing areas in the middle and lower reaches of Yangtze river and northeast China, and the yield can be reduced by 20% in a pandemic year. After the infection of germs, the mycotoxin carried by the wheat grains affects the seed quality and is harmful to the health of people and animals. The change of farming mode and cultivation technique is difficult to solve the infection and spread of disease, the pesticide control has certain effect on controlling the occurrence and prevalence of gibberellic disease, but the production cost is increased, and the chemical pesticide inevitably causes environmental pollution. The utilization of gibberellic disease resistance genes for variety improvement is an effective way to reduce the harm of gibberellic disease.
The molecular marker assisted selection can carry out early selection on materials in the genetic breeding of wheat, reduce the identification cost of field disease resistance and improve the breeding efficiency. Wheat scab is a complex quantitative trait controlled by multiple genes, the detection range of single molecular marker assisted selection is limited, and the accuracy of the detection is to be improved. The SSR marker Xgwm533 linked to Fhb1 is physically located a large distance from the resistance QTL, and there is a separation between this marker and the resistance QTL in the different materials. Therefore, when the assist selection is performed using Xgwm533, the detection result thereof has a certain uncertainty. The molecular marker UMN10 needs an expensive sequencing analyzer for analysis, so the analysis method is complicated and is not used in most wheat genetic breeding laboratories.
The wheat variety 'Sumai No. 3' is one of the world recognized resistance sources with better scab resistance, a major scab resistant site Fhb1 is found on the short arm of the 3B chromosome, and the interpretable phenotypic variation rate is more than 20%. In the Fhb1 region, the gene TaPFT encodes a fusion protein containing 2 lectin domains and ETX/MTX2 toxin domain, and participates in the resistance reaction of wheat scab. However, when the effect of TaPFT is verified in germplasm resources containing different resistance levels, TaPFT is found not to be the only gene involved in gibberellic disease resistance, and a plurality of variant sites or genes in the Fhb1 region are preliminarily presumed to be involved in gibberellic disease resistance. Therefore, molecular markers derived from other mutation sites can be used for auxiliary selection of wheat scab, and the selection accuracy is further improved.
Disclosure of Invention
In order to improve the accuracy of wheat scab resistance selection assisted by a molecular marker, the invention provides a pair of primer pairs for amplifying a new variation sequence by PCR (polymerase chain reaction), wherein the molecular marker JAASM395 is designed, the wheat scab resistance can be judged according to the PCR detection result of the JAASM395 primer pair, and the method can be applied to wheat scab resistance material screening and molecular marker assisted selection breeding.
The invention is realized by the following technical scheme:
firstly, the invention provides a pair of primer pairs for detecting wheat scab resistance, and nucleotide sequences of the primer pairs are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.
Secondly, the invention also provides application of the primer pair in detecting wheat scab resistance, which comprises the following specific steps: carrying out PCR amplification on a primer pair (SEQ ID NO.1 and SEQ ID NO.2) of a molecular marker JAASM395 by using the wheat whole genome DNA as a template, carrying out electrophoresis on an amplification product on agarose gel with the mass percentage of 1% to obtain a detection result, and judging that the scab resistance of the wheat variety at least reaches an anti-resistance level if the amplification product contains a 1000bp strip; otherwise, the wheat variety is judged to be infected with the gibberellic disease.
In addition, the invention also provides a method for detecting the resistance of wheat scab, which comprises the following specific steps: taking wheat DNA as a template, carrying out PCR amplification by using primers with nucleotide sequences respectively shown as SEQ ID No.1 and SEQ ID No.2, carrying out electrophoresis on an amplification product on 1% agarose gel to obtain a detection result, and judging that the gibberellic disease resistance of the wheat variety at least reaches an anti-resistance level if the amplification product contains a 1000bp strip; otherwise, the wheat variety is judged to be infected with the gibberellic disease.
The PCR amplification system: 10 XBuffer 1. mu.l MgCl at 25mM concentration20.5. mu.l of dNTP at a concentration of 2.5mM, 10. mu.M of primer SEQ ID NO. 10.1. mu.l, 10. mu.M of primer SEQ ID NO. 20.1. mu.l, 5U/. mu.l of Taq polymerase 0.2. mu.l, template DNA 50ng, ddH2O is complemented to 10 mu l;
PCR amplification procedure: 3 minutes at 94 ℃; extension at 94 ℃ for 15 seconds, at 54.5 ℃ for 30 seconds, at 72 ℃ for 30 seconds, for 30 cycles; extension at 72 ℃ for 5 minutes.
In the invention, the detection method of the resistance of the wheat variety refers to the agricultural industry standard NY/T2954-2016 technical specification for identifying the scab resistance of wheat regional experimental varieties in the people's republic of China, wherein the resistance or resistance of the wheat variety refers to: inoculating by dripping single flower at ear part, and obtaining wheat variety with average severity less than 3; the wheat variety with the medium or high scab feeling is the wheat variety with the average severity of more than or equal to 3.
In the wheat scab resistance breeding, the scab resistance of wheat can be selected through the detection result of the molecular marker in the early generation, so that the breeding process is accelerated. The invention discloses a primer pair of an amplification molecular marker JAASM395, which is further used for PCR detection and identification of wheat scab resistance. In addition, the molecular marker primer pair is obtained through manual comparison and correction, the amplification efficiency is high, the amplification result specificity is good, and the accuracy of the wheat scab resistance molecular marker auxiliary selection is further improved, so that the molecular marker auxiliary selection efficiency is improved.
Drawings
FIG. 1 shows the amplification results of primer pairs with molecular markers P1 and P2 designed by software in resistant varieties
Wherein, M: the lanes DL2000 and 1-6 of the molecular weight standard are respectively the No.3, No. 8, No. 9 and No. 13 of Sumai, the No.3, No. 8, No. 9 and No. 13 of Taiwan wheat, and the lanes 7-12 are respectively the No. 8455, No. 22, No.4, No. Handan 6172, No. 22 of Xiaoyan and No. 55 of Wanmai.
FIG. 2 shows the result of the amplification of the primer pair JAASM395, a molecular marker, in a resistant variety,
wherein, M: the lanes DL2000 and 1-6 of the molecular weight standard are respectively the No.3, No. 8, No. 9 and No. 13 of Sumai, the No.3, No. 8, No. 9 and No. 13 of Taiwan wheat, and the lanes 7-12 are respectively the No. 8455, No. 22, No.4, No. Handan 6172, No. 22 of Xiaoyan and No. 55 of Wanmai.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The following examples relate to nucleotide sequences:
SEQ ID NO.1：GTCTCCGTTCAATTCGGTGAGT；
SEQ ID NO.2：GACAATGTGAAGGCGTTGTCTA；
SEQ ID NO.3：；CTTGACCTGAGAATTTACCCTGACC；
SEQ ID NO.4：；TGGAGATGCTCTAACACCGAAA；
SEQ ID NO.5：；AAAGCCAAGTCGCACTCCTCCT；
SEQ ID NO.6：；TTCGCACCAAAACCCCGTAATA。
examples relate to material sources:
wheat varieties or lines such as sumai No.3 (table 1): the wheat crop is preserved by the wheat crop research institute of the food crop research institute of agricultural science and academy of Jiangsu province;
gibberella: is Asian fusarium Fa0609, which is preserved by the wheat crop research institute of food crop research institute of agricultural academy of sciences of Jiangsu province.
Example 1 verification of molecular marker JAASM395 primer pairs in resistant varieties
The templates used for the PCR reaction in this example were: sumai No.3, Wangshuibai, Taiwan wheat, Ningmai No. 8, Ningmai No. 9 and Ningmai No. 13, which are anti-scab or anti-gibberellic disease varieties; jimai No. 22, Annong No. 8455, Huai mai No. 18, Xiaoyan 54, Yang mai No.4 and Wan mai No. 55 are varieties of scab infection. Extracting the genomic DNA of the wheat leaves by using a CTAB method, and quantifying the genomic DNA by using a micro-spectrophotometer Nanodrop.
When the software Primer premier5.0 is used for designing the molecular marker Primer of the variation site, the Primer design software cannot carry out sequence comparison and correction, cannot anchor the variation site, and cannot adjust the base type at the tail end of the Primer. The primer pair P1 (the nucleotide sequence of which is shown in SEQ ID NO.3 and SEQ ID NO.4) and P2 (the nucleotide sequence of which is shown in SEQ ID NO.5 and SEQ ID NO.6) designed by software is used for carrying out PCR amplification by taking the anti-susceptible variety as a template:
the PCR amplification system is a 10. mu.l system: 10 XBuffer 1. mu.l, MgCl20.5. mu.l (25mM), 0.5. mu.l dNTP (2.5mM), 0.1. mu.l primer SEQ ID NO.1 (10. mu.M), 0.1. mu.l primer SEQ ID NO.2 (10. mu.M), 0.2. mu.l Taq polymerase (5U/. mu.l), 50ng template DNA, ddH2O is complemented to 10 mu l;
PCR amplification procedure: 3 minutes at 94 ℃; extension at 94 ℃ for 15 seconds, 61 ℃ for 30 seconds, 72 ℃ for 60 seconds, for 30 cycles; extension at 72 ℃ for 5 min; the amplification products were detected by electrophoresis on a 1.0% agarose gel.
The amplification result is shown in FIG. 1, and it can be seen that the primer pair P1 can effectively amplify, but the amplification result cannot effectively identify the influenza strain; the primer pair P2 has low amplification efficiency on the template, and the amplification result cannot effectively identify the influenza variety.
On the basis, the applicant manually aligns and corrects the sequence of the variation site, manually adjusts the anchoring position of the tail end of the primer pair and adjusts the base type of the tail end so as to accurately and effectively amplify the molecular marker JAASM 395.
The genomic DNA of the variety is taken as a template, and primers are utilized to carry out PCR amplification on SEQ ID NO.1 and SEQ ID NO. 2:
the PCR reaction system is a 10. mu.l system: 10 XBuffer 1. mu.l, MgCl2(25mM) 0.5. mu.l, dNTP (2.5mM) 0.5. mu.l, primer SEQ ID NO.1 (10. mu.M) 0.1. mu.l, primer SEQ ID NO.2 (10. mu.M) 0.1. mu.l, Taq polymerase (5U/. mu.l) 0.2. mu.l, template DNA 50ng, ddH2O is complemented to 10 mu l;
PCR reaction procedure: 3 minutes at 94 ℃; extension at 94 ℃ for 15 seconds, 61 ℃ for 30 seconds, 72 ℃ for 60 seconds, for 30 cycles; extension at 72 ℃ for 5 min; the amplification products were detected by electrophoresis on a 1.0% agarose gel.
The gel imaging system records the result, the detection result is shown in figure 2, and the detection result contains molecular marker JAASM395 specific amplification product band (1000bp) with Sumai No.3, Wanshui, Taiwan wheat, Ningmai No. 8, Ningmai No. 9 and Ningmai No. 13, and does not contain specific amplification product band (1000bp) with Jimai No. 22, Annong No. 8455, Huai No. 18, Xiaoyan 54, Yangmai No.4 and Wanmai No. 55. The following results can be judged: sumai No.3, Wangshuibai, Taiwan wheat, Ningmai No. 8, Ningmai No. 9 and Ningmai No. 13 are anti-scab or anti-gibberellic disease varieties; jimai No. 22, Annong No. 8455, Huai mai No. 18, Xiaoyan 54, Yang mai No.4 and Wan mai No. 55 are varieties of scab infection.
The above results show that: the resistance result presumed by the molecular marker is consistent with the actual resistance level, the resistance of the wheat variety to the gibberellic disease can be judged by detecting whether the wheat variety contains a molecular marker JAASM395 specific band, and the detection result is correct and effective.
Example 2 identification of gibberellic disease resistance of wheat Using the molecular marker JAASM395 primer set
The test varieties (lines) are 48 parts of wheat varieties in total, and comprise Ningmai, Yangyang (radial) wheat, Huai-mai, Wan-mai and Annong series, and the names of the varieties (lines) are shown in Table 1. The wheat variety (line) was examined by the molecular marker JAASM395 detection method established in example 1; meanwhile, the detection was carried out with the published detection marker Gwm533, and the detection result was described as "present" or "absent". If the molecular marker JAASM395 exists, judging that the scab resistance of the wheat variety at least reaches the moderate level; and if the molecular marker JAASM395 does not exist, judging the wheat variety susceptible to the gibberellic disease.
The field resistance identification adopts a single flower drip method: culturing strong pathogenic wheat gibberellic disease F0609 conidium liquid (5 × 10)5Conidia/ml), dripping conidia solution into 1 floret at the middle part of ear at the early stage of flowering, spraying water mist 3-4 times a day after each variety of 10 ears is bagged by a plastic bag for 3 days, and spraying water mist for about 5 minutes each time to achieve the moisturizing effect. Investigating the severity of the inoculated ear 21 days after inoculation, and calculating the average severity, wherein the wheat variety with the average severity less than 2 is judged as "resistant", and the wheat variety with the average severity more than or equal to 2 and less than 3 is judged as "resistant"; a wheat variety with an average severity of 3 or more was judged as "susceptible", i.e., a wheat variety with a mild or high susceptibility to gibberellic disease (agricultural industry Standard NY/T2954-2016).
The results of the marker detection and determination and the results of the field identification and determination are shown in table 1:
TABLE 1 screening of wheat varieties (lines) resistant to gibberellic disease using the molecular marker JAASM395 primer set
According to the results of the combination marker determination and the field resistance identification in the table 1, the detection accuracy of the molecular marker JAASM395 primer pair is 85.4% (41/48), and the detection accuracy of Gwm533 is 75% (36/48). The molecular marker JAASM395 primer pair can be applied to screening of wheat scab resistant materials and molecular marker-assisted selective breeding, and compared with a single publicly published detection marker, the detection result of the molecular marker in the invention can improve the accuracy of wheat scab resistant molecular marker-assisted selection.
Sequence listing
<110> agricultural science and academy of Jiangsu province
<120> a pair of primers for detecting wheat scab resistance and application thereof
<141> 2018-12-12
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gtctccgttc aattcggtga gt 22
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gacaatgtga aggcgttgtc ta 22
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cttgacctga gaatttaccc tgacc 25
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tggagatgct ctaacaccga aa 22
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aaagccaagt cgcactcctc ct 22
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ttcgcaccaa aaccccgtaa ta 22
Claims (4)
1. The nucleotide sequences of a pair of primer pairs for detecting wheat scab resistance are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.
2. The use of the primer pair of claim 1 for detecting wheat scab resistance.
3. The application of claim 2, comprising the specific steps of: taking wheat genome DNA as a template, carrying out PCR amplification on primer pairs with nucleotide sequences respectively shown as SEQ ID No.1 and SEQ ID No.2, and then carrying out electrophoresis, wherein if a DNA band with the size of 1000bp appears, the wheat scab resistance is judged to at least reach the resistance level.
4. Use according to claim 3, wherein the PCR amplification system: 10 Xbuffer 1 μ l MgCl at 25mM concentration20.5 μ l of dNTP0.5 μ l with a concentration of 2.5mM, concentratedPrimer SEQ ID NO.10.1 mul with the degree of 10 muM, primer SEQ ID NO. 20.1 mul with the concentration of 10 muM, Taq polymerase 0.2 mul with the concentration of 5U/mul, template DNA 50ng, ddH2Complementing the O to 10 mu l;
PCR amplification procedure: (vii) 3 min 94; (ii) 94C 15 sec, 54.5C 30 sec, 72C 30 sec extension, 30 cycles; 72C for 5 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811515195.8A CN109402292B (en) | 2018-12-12 | 2018-12-12 | Primer pair for detecting wheat scab resistance and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811515195.8A CN109402292B (en) | 2018-12-12 | 2018-12-12 | Primer pair for detecting wheat scab resistance and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109402292A CN109402292A (en) | 2019-03-01 |
| CN109402292B true CN109402292B (en) | 2020-12-11 |
Family
ID=65458642
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811515195.8A Active CN109402292B (en) | 2018-12-12 | 2018-12-12 | Primer pair for detecting wheat scab resistance and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109402292B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114196781B (en) * | 2021-12-31 | 2022-11-08 | 中棉所长江科研中心 | Molecular marker for detecting wheat scab resistance and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6197518B1 (en) * | 1999-06-17 | 2001-03-06 | Her Majesty The Queen In Right Of Canada, As Represented By The Department Of Agriculture | Markers for fusarium head blight (FHB) disease resistance |
| CN102653759A (en) * | 2012-03-28 | 2012-09-05 | 南京农业大学 | Molecular marker of wheat scab resistance expansion gene Fhbl and application thereof |
| CN108359739A (en) * | 2018-04-24 | 2018-08-03 | 南京农业大学 | The SNP marker primer of one anti gibberellic disease related gene TaRLK-B and its application |
-
2018
- 2018-12-12 CN CN201811515195.8A patent/CN109402292B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6197518B1 (en) * | 1999-06-17 | 2001-03-06 | Her Majesty The Queen In Right Of Canada, As Represented By The Department Of Agriculture | Markers for fusarium head blight (FHB) disease resistance |
| CN102653759A (en) * | 2012-03-28 | 2012-09-05 | 南京农业大学 | Molecular marker of wheat scab resistance expansion gene Fhbl and application thereof |
| CN108359739A (en) * | 2018-04-24 | 2018-08-03 | 南京农业大学 | The SNP marker primer of one anti gibberellic disease related gene TaRLK-B and its application |
Non-Patent Citations (1)
| Title |
|---|
| Development and validation of diagnostic markers for Fhb1 region,a major QTL for Fusarium head blight resistance in wheat;Zhenqi Su等;《Theoretical and Applied Genetics》;20180822;第131卷(第11期);摘要，"Genotyping assays"部分，"Results"部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109402292A (en) | 2019-03-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Alam et al. | Chromosomal location and SSR markers of a powdery mildew resistance gene in common wheat line N0308 | |
| US20220162713A1 (en) | Methods and Compositions for Producing Brachytic Corn Plants | |
| CN109468315B (en) | Rice flooding-resistant gene Sub1 codominant molecular marker and application thereof | |
| CN107338310B (en) | Marker for detecting wheat scab-resistant gene PFT and using method thereof | |
| CN112080582A (en) | KASP molecular marker closely linked with spike length major QTL locus and application thereof | |
| CN109371159B (en) | Molecular marker for identifying wheat scab resistance and application thereof | |
| CN109852719B (en) | Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-5AL and using method | |
| Justesen et al. | Genetic diversity in potato field populations of Thanatephorus cucumeris AG-3, revealed by ITS polymorphism and RAPD markers | |
| CN108486278B (en) | Primer pair for identifying gibberellic disease resistance of Ningmai No. 9 and derivative variety thereof and application | |
| UA126564C2 (en) | Methods of making gray leaf spot resistant maize | |
| CN112795691B (en) | Molecular marker linked with corn stem thickness and application thereof | |
| CN106591489A (en) | Rice grain length gene GW7 molecular marker and special primer sequences thereof | |
| CN109402292B (en) | Primer pair for detecting wheat scab resistance and application thereof | |
| Imerovski et al. | Identification and validation of breeder-friendly DNA markers for Pl arg gene in sunflower | |
| CN109825604B (en) | Molecular marker closely linked with peach aphid resistance character, primer, kit and method for detecting peach aphid resistance character and application of primer, kit and method | |
| CN109735650B (en) | Four single nucleotide polymorphism-based molecular markers for resisting gummy stem blight of melon and application thereof | |
| Zhang et al. | An AFLP marker linked to the leaf rust resistance gene LrBi16 and test of allelism with Lr14a on chromosome arm 7BL | |
| Wang et al. | Development and application of EST-STS markers specific to chromosome 1RS of Secale cereale | |
| CN111394491A (en) | Mushroom mating type molecular marker and application thereof in identification of mushroom mating type | |
| CN114196781A (en) | Molecular marker for detecting wheat scab resistance and application thereof | |
| CN109355425B (en) | Molecular marker linked with wheat scab resistance QTL and application thereof | |
| Sanghvi et al. | Molecular markers in plant biotechnology | |
| JP4101493B2 (en) | Novel primer set for detecting nucleic acid markers derived from barley chromosomes in the background of wheat and use thereof | |
| Pourkhorshid et al. | Identification of wheat stripe rust resistance genes in Iranian wheat cultivars using molecular markers | |
| WO2018232563A1 (en) | Breeding method for fusarium head blight-resistant triticum aestivum-elytrigia elongata translocation line and molecular marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |