CN103045744B - Method for synchronously identifying transgenic mannose gene, glucanase gene, xylanase gene and galactosidase gene plants - Google Patents
Method for synchronously identifying transgenic mannose gene, glucanase gene, xylanase gene and galactosidase gene plants Download PDFInfo
- Publication number
- CN103045744B CN103045744B CN201210591031.XA CN201210591031A CN103045744B CN 103045744 B CN103045744 B CN 103045744B CN 201210591031 A CN201210591031 A CN 201210591031A CN 103045744 B CN103045744 B CN 103045744B
- Authority
- CN
- China
- Prior art keywords
- gene
- primer
- seq
- glucanase
- xylanase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of transgenic plant detection, and in particular to a method for synchronously identifying transgenic mannose gene, glucanase gene, xylanase gene and galactosidase gene plants. A primer, designed according to the invention, of exogenous genes of transgenic galactosidase, glucanase, mannose and xylanase can be used for synchronously identifying the four exogenous genes in a transgenic corn feed, so that a method for rapidly identifying and detecting ingredients of a transgenic corn material for feeds is provided.
Description
Technical field
The present invention relates to transgenic plant detection field, be specifically related to identify the method that turns mannase gene, glucanase gene, xylanase gene and galactosidase gene plant simultaneously.
Background technology
Except the pest-resistant disease-resistant transgenic strain of routine, development along with genetic engineering technique, for feeding functional genetically modified crops rearing new variety, become study hotspot, as obtained the phytase gene corn that turns of safety certification, in green feed is produced, had a good application prospect.Turning mannase gene, turning glucanase gene, turn xylanase gene and transgalactosidation enzyme gene corn is for reducing antinutritional factor in feed, improve the novel feeding use functional transgenic corns kind of feeding animals nutritional properties exploitation, due to target enzyme can be in corn kernel specifically expressing, while therefore carrying out fodder production as raw material, can reduce the adding procedure of microorganism fermentation source zymin, thereby save in a large number the use cost of zymin.
The prerequisite that genetically modified organism and product thereof are used is to guarantee its security, current domestic genetically modified crops are in a large number for fodder production, the food chain terminal of the livestock and poultry that these feeds are fed and product is people, so genetically modified crops composition detection is an important ring in whole transgenosis safe appraisement system.Round pcr can detect fast and effectively the target component of minute quantity sample as conventional classical Protocols in Molecular Biology on molecular level.
Multiplex PCR (multiplex PCR), claims again Multiplex PCR or composite PCR, and it is to add more than two pairs primer in same PCR reaction system, amplifies the PCR reaction of a plurality of nucleic acid fragments simultaneously.Although multiplex PCR has more advantage, it also has many shortcomings that can not be ignored, and comprises the interaction between multipair primer, low amplification efficiency, and the impact of different templates on primer.These shortcomings have suppressed the application of multiplex PCR.Research shows, for successfully carrying out the particularly important factor of multiplex PCR, is: for the heterogeneic different primers that increases to balance between concentration, elongating temperature, extension time, annealing time, annealing temperature, PCR cycle number, magnesium chloride and the dNTP concentration of design, relative concentration between primer pair, PCR damping fluid etc.Wherein most important primer reasonable in design, makes it in multi-PRC reaction, efficiently amplifying target genes fragment.
Along with the fast development of genetically modified crops, the method that increasing research has utilized multiplex PCR fast, carry out quickly and easily the screening of genetically modified crops.At present, method (Forte, V.T., et al., Food Control, l6,535-539,2005 that utilize multiple PCR method to detect genetically engineered soybean and corn have been developed; Germini, A., et al., Journal of Agricultural and Food Chemistry, 52,3275 – 3280,2004).Transgenic plant are as feed, utilizing multi-PRC reaction can carry out several genes in feed synchronously identifies, from feed, amplify object band simultaneously, by reducing reaction times, saved the time, manpower and material resources (Mafra, I., et al., European Food Research and Technology, 227,649 – 665,2008).
The present invention is with mannase gene, glucanase gene, xylanase gene and galactosidase gene sequences Design special primer optimize PCR system and condition, can be from mixutre genome template effective amplifying target genes fragment, be the identification and detection supplying method of feeding enzyme transgenic corns material composition from now on.
Summary of the invention
The present inventor proposes and has completed the present invention in order to overcome the problems referred to above.
Therefore, the object of this invention is to provide the method that turns mannase gene, glucanase gene, xylanase gene and galactosidase gene plant of simultaneously identifying.
A further object of the present invention is to provide identifies the test kit that turns mannase gene, glucanase gene, xylanase gene and galactosidase gene plant simultaneously.
Another object of the present invention is to provide can identify the combination of primers that turns mannase gene, glucanase gene, xylanase gene and galactosidase gene plant simultaneously.
According to of the present invention, identify that the method that turns mannase gene, glucanase gene, xylanase gene and galactosidase gene plant comprises that the following primer of use carries out the step of pcr amplification simultaneously:
| Primer title | Primer sequence (5 ' → 3 ') | Length (bp) |
| A-F | TCAATCTTAAGAGAGTTTCG | 20 |
| A-R | GTCTCGAAGACATGGTACAG | 20 |
| G-F | GACTCCGTGACCCTGCGCCAGT | 22 |
| G-R | CCAGATGCTGAAGATCAGGACCATGCC | 27 |
| M-F | GTCAAGATCGTCCTGAACTT | 20 |
| M-R | AGCTTGGTGTCCTTCAACAC | 27 |
| X-F | GGACCTACACGTGCTCATGGGACG | 24 |
| X-R | GCCTCGACCGCCATAACCTGGAAG | 24 |
According to of the present invention, identify that the test kit that turns mannase gene, glucanase gene, xylanase gene and galactosidase gene plant comprises above-mentioned combination of primers simultaneously.
The method according to this invention, wherein said galactosidase gene is alpha-galactosidase gene agaF75m, the aga-F75(GenBank FJ392036 obtaining from Gibberellasp.F75) through codon optimized and obtain, its nucleotides sequence is classified as shown in SEQ ID NO.1:
ggatccgcggagtccagcgacccaatccacgtcgatggcacctccttcgccctcaacggcgacaatgtcagctacaggttccacgttgataataccactggcgaccttatcaacgatcattacggaggaccagtggctgaggacggaattactgctgagatcggccctattcagggctgggtgaacctcatcggaagggtcaggcgcgagttcccagaccacggaagaggagatttccggattccggcgttccaactgcagcaagcctcgggcacaacggtcaccgacttcaggtacaagtcccatgaggtggtcgagggaaagccaggactgccaggactcccttctactttcggcgaggccgacgatgtttcaacactggttgtgcgcatgtacgacaactactcttcaatcgcggtggatctctcttactcaattttccccaagtacgacgccgtcgttaggtctgtgaacatcacgaatcgcggcaacgctaccgtcaatcttaagagagtttcgtcctggtccgtggatctgcagcaagacaaccttgatctgatcgagattagaggagactgggctagggagggaatgagagttagacggaaggtggatttcggcactcagggcttccaaagctctacaggctactcatcgcacctccataacccgttcctcgctcttgtggcgagcaccactacagagacgcagggagaggcttggggattctcgctggtctacaccggctccttcgctgtcgacgttgagaagtccagccaaggcctcactagggccatccttggcgtcaattctctggatttctcatggcccctcaagccgggccagacattcacgacccccgaggtggtctcagttttctcgaacaagggcgtgggcggcatgtctaggcaattccacaggctctaccgcaagcatcttatgaagtctaagtacgctgaggagacgcgcccggtgctgctcaattcatgggagggcctcggcttcgagatcaacgagaccgcgatcgagaagattgccaagcagtccgctgaccttggcattaagctgttcgtgatggacgatggctggttcggcaataagtacccgagggtcaacgacagcgctggcctgggcgattggcagccgaataaggagaggttcccagacggccttacgcctctggttgagaatatcaccgagctgcgcattgccaacgcttccgacgatctcaagttcggcatctggttcgagcccgagatggtgaacccgaagtcggacctgtacgataagcacccagactgggccattcatgctggcagctaccctagaactgagacacggaatcagctggtgctcaacgtcgcccttccagaggttcaagagttcatcattgattcggtgtccaagatcctgcgggagtcccctattagctacgtgaagtgggacaacaataggggcatccacgagacgcctgatcccaccctcaactacaagtacatgcttggcctgtaccatgtcttcgagacgctcaccagccgcttcccagacgttctttgggagggatgcgcttctggaggaggaagattcgatccaggcgtcctgcagtggttccctcaaatctggactagcgacgatacagacgcggttgagaggatcgccattcagttcggcaccagcctcgcttacccgccatctgcgatgggcgcccacctttcacatgtccctaacggcaatacgcaaagaattacctcggtcaagttccgggctcacgttgcgatgatgggcggctcattcggcgttgagctggacccatcggatctcgagcctgaggagagagagcagatccccggcctcattgagctttctgagaagatcaatccgatcgtgattactggcgacttctaccgcctcgctcttcccgaggagacaaactacccggcgggccagttcatctccgaggatggcaagaaggttgtgctcttcgctttccaaactagggcgacaattaacaattcctggccttggttcagactgcagggactcgacgctagcgccaagtacagagtggataacaatcagactgtcagcggctctacacttatgaacatgggcatccaactgaccttcgagggcgactacgattcccatgtgctgatgattgagaagcagtgacctagg
The method according to this invention, glucanase gene bgl7Am comes (GenBank FJ695140) through codon optimized for the bgl7A that obtains from Bispora sp.MEY-1, and its nucleotides sequence is classified as shown in SEQ ID NO.2:
cagcagatcggccgcatcccggaggtccaccccaggctcaccacccagacgtgcaccaagcacggctgcacgacccagcagacctccctggtcctcgacgccctgtcgcacccgatcgacgacatccataccaacgagtcctgcgagacgtccagcggcggggtgaacaccacgatctgccccacggtggaggtctgcgccgagaactgcgcgctcgagggcgtcaactacgcctcccacggcgtgtacacgaacggcgactccgtgaccctgcgccagtacctcaacatcgacgggaccgaggaggaggtgtcgccgcgcgtctacctgctcgaccccagcggcagggactacgagatcctgaagctgctcaaccaggagatcagcttcacggtcgacgtctccaacctgccgtgcggcatgaacggcgctctgtacctcacgtccatggacgcctcgggcggccgcagccagctcaacccggccggggcgacctacggcaccggctactgcgacgcgcaatgcaacgcccccgcctggatcaacggcgtggccaacctgaagggccttggggcatgctgcagcgagatggacctctgggaggccaactcggaggcgacccagctcaccccccacgcctgcaacgtcacgggcttctacgagtgctccggggcggcctgcggcagcaacggcgtgtgcgacaaggacggctgcggcttcaacccgtacggcctgggcgaccactccttctacggcccgagcgtcaccgacacgatcgacacgaagaagcccttcaccgtcgtcacccagttcctgacctcggacggcacgtccacgggcaccctcagccagatccgccggctgtacctccagaacggcaaggtcatccagaacgcgaaggtcgacttcgacaactcgacgctggacagcatcaccccggcctactgcgaggccacggcggccaccttcgaggccgagggcgggttcccccagatgggcaaggccctcgagatgggcatggtcctgatcttcagcatctggaacgaccccagcgccttcatgaactggctggacagcggcacggcgggaccgtgcaacagcacccagggcaacccggcgctcatcgaggccgagaaccccggcaccagcgtgaccttctccaacatcaagtggggcgacatcggcacgacctactccggctcgggctccggcgggtggaac
The method according to this invention, wherein, mannase gene man5As is the man5A(EU919724 obtaining from Bispora sp.MEY-1) through N end brachymemma and codon optimized and obtain, its nucleotides sequence is classified as shown in SEQ IDNO.3:
ccggcgtaccccatctgcacctcgcgcgcgccgttcgcgagcatcgacgacgtgcacccccggctcttcaactacaacggcaccggcgccaagtacttcgccggcaccaacgcctggtggacgagctacctgatgatcgactccgacgtgaacctcgtgttctccgagatcaagaacacccagctgcaggtggtcaggatctgggggttcggcagcgtcaacacggaccccgggccggggacggtcttcttccagctcctgaactcgaccggcagctacatcaactacgcggcgaacggcatcccccgcctcgacgcggtggtctcctacgccgagaggaacggcgtcaagatcgtcctgaacttcgtgaacaactggagcgccctcggcgggatcgcctcctacaacgccgccttcggcgggaacgcgacctcctggtacaccgacgccgagagccagaaggtgtacaaggactacatcaagctgctggtgaaccggtacaagtgctcccccgccatcttcgcgtgggagctggcgaacgagccgcgctgccaggggtgcgacaccagcgtgatctacaactgggccacggaggtctcccagtacatcaagagcctcgacccccggcacatggtggccctcggggacgaaggctggttcgcccccgccgacggcatcggcgacgggtcgtacgcgtacagcggcgaccagggcgtcgacttcgtcaagaacctaggcatcaagaccctggactacgggaccttccacctctacccgtcctcctggggctacaacgagtcctggggctcgacgtggatcctgcagcacaacgaggtgggggccgcccacaacaaggcggtcgtcctcgaggagtacggcggcccgcccacgccgaacaaccacacggcggtcgaggagccctggcaggcgacggtgttgaaggacaccaagctggccatggaccagttctggcagttcggcaccgtcctgagcaccggcctctccgactacgacaacttcacgatctggtacaactcccaggagtacgtccccctggcgcgcgaccacgccgcggccatgctggagaagccggtg
The method according to this invention, xylanase gene xyl11As be the xyl11A that obtains from Bispora sp.MEY-1 through codon optimized (GenBank HM003044.1), its nucleotides sequence is classified as shown in SEQ ID NO.4:
ggatccatcccgactattgagaagcgcaacccagggggcattaactacgtccagaactacaacggcgatgtggctgatttccagtacaacgagggcgctgggacctacacgtgctcatgggacggctccactgatttcgtggtcggcctcgggtggtctacgggcgctgcgcgggacatcacgtactcggctacatacaacgccggcgggtccggcagctacctggctgtctacgggtgggttaattccccgcaggctgagtactacattgttgagagctacggcgactacaacccatgcagcgatgctgagtcgctcggcaccctggagtcggacgggtctacatacactgtgtgcaccgatacgcgcacaaatgagccgagcatcactggcacctcgacgttcacacagtactggtctgtccgccagtcagagaggacctccggcactgttaccgtggggaaccacttcaattactgggcgcagcatggcttcggggattcctacaacttccaggttatggcggtcgaggcgttcagcggcagcggctcagcgtccgtgtcggtgtcccccggg
For effective amplifying target genes fragment from mixutre genome template, the present invention designed for the transgenic corns of tilactase, dextranase, mannase and zytase in the primer pair of foreign gene.Should guarantee that the interaction between primer is less, and multiplex PCR amplification system and amplification condition are groped, obtain a good amplification system and amplification condition.The present invention also detects the specificity of primer the specificity impact of primer and primer mixture from each primer specificity detection, template mixture.Detected result shows, the specificity of four pairs of primers of design is better, and in multiple template and multi-primers, its specificity is not had to considerable influence.In addition, in four kinds of transgenic corns genomic templates and four pairs of simultaneous mixtures of primer, detected the amplification efficiency of primer in the present invention.Result shows that the amplification efficiency of these four pairs of primers in multi-PRC reaction is better.
This shows, the primer of the foreign gene for the tilactase proceeding to, dextranase, mannase and zytase designing in the present invention can be identified these the four kinds of foreign genes in transgenic corns feed simultaneously, and the method that provides is provided this Rapid identification that is feeding enzyme transgenic corns material composition from now on.
Accompanying drawing explanation
Tetra-kinds of feeding enzyme transgenic corns genome gel detection of Fig. 1.
Tetra-kinds of feeding enzyme gene primer specific detection of Fig. 2.A:aga, G:glu, M:man, X:xyl; 1: tilactase transgenic corns genome is template, 2: dextranase transgenic corns genome is template, 3: mannase transgenic corns genome is template, 4: zytase transgenic corns genome is template, 5: non-transgenic corn Zheng 58 genomes are template, 6: sterilized water is template.
Tetra-kinds of transgenic corns genome mixtures of Fig. 3 are the impact of template on primer specificity.
Fig. 4 tetra-is the impact on each primer specificity on primer mixture.
Fig. 5 multiplex PCR system detection efficiency.
Embodiment
1, experiment material: four kinds of corns that turn feeding enzyme, are respectively alpha-galactosidase, dextranase, mannase, zytase.Wherein alpha-galactosidase gene agaF75m is the aga-F75(GenBank FJ392036 obtaining from Gibberella sp.F75) through codon optimized and obtain, its nucleotides sequence is classified as shown in SEQ ID NO.1; Glucanase gene bgl7Am comes (GenBank FJ695140) through codon optimized for the bgl7A that obtains from Bispora sp.MEY-1, and its nucleotides sequence is classified as shown in SEQ ID NO.2; Mannase gene man5As is the man5A(EU919724 obtaining from Bispora sp.MEY-1) through N end brachymemma and codon optimized and obtain, its nucleotides sequence is classified as shown in SEQ ID NO.3; Xylanase gene xyl11As be the xyl11A that obtains from Bispora sp.MEY-1 through codon optimized (GenBank HM003044.1), its nucleotides sequence is classified as shown in SEQ ID NO.4.
2, chemical reagent: CTAB and RNaseA come from Ameresco company, chloroform and dehydrated alcohol come from Beijing Chemical Plant, primary isoamyl alcohol and Virahol come from Shantou Xilong Chemical Factory Co., Ltd, and the saturated phenol of Tris-is provided by the rich remarkable bio tech ltd of Beijing gold; Taq polysaccharase comes from Genstar company.
3, experimental installation: whizzer is purchased from Sigma company, PCR instrument is purchased from Eppendorf company.
4, in the present invention involved primer and sequence thereof in Table 1:
Table 1
| Primer title | Primer sequence (5 ' → 3 ') | Length (bp) |
| A-F | TCAATCTTAAGAGAGTTTCG | 20 |
| A-R | GTCTCGAAGACATGGTACAG | 20 |
| G-F | GACTCCGTGACCCTGCGCCAGT | 22 |
| G-R | CCAGATGCTGAAGATCAGGACCATGCC | 27 |
| M-F | GTCAAGATCGTCCTGAACTT | 20 |
| M-R | AGCTTGGTGTCCTTCAACAC | 27 |
| X-F | GGACCTACACGTGCTCATGGGACG | 24 |
| X-R | GCCTCGACCGCCATAACCTGGAAG | 24 |
1 four kinds of feeding enzyme transgenic corns genomes of embodiment extract
1, four kinds of methods that transgenic corns obtains
The codon optimized goal gene obtaining is connected to plant expression vector pHP20754 upper, utilizes the method for particle gun to proceed in maize calli.Utilize the callus of selecting the Screening of Media positive, the callus regeneration screening is obtained to T0 for carrier, rear and non-transformed corn is that Zheng 58 is hybridized the corn after i.e. acquisition transforms.Plant expression vector pHP20754, callus and Zheng's 58 corns all derive from the biological Chen Rumei researcher of institute of the Chinese Academy of Agricultural Sciences.
2, the extraction of Maize genome
1) CTAB preparation
| Composition | Ultimate density |
| CTAB | 2% |
| NaCl | 1.4mol/L |
| EDTA-Na2(pH8.0) | 20mmo?l/L |
| Tris-HCl(pH8.0) | 100mmol/L |
| Beta-mercaptoethanol | 0.2% |
2) get 50-100mg fresh corn blade, liquid nitrogen grinding.The CTAB that adds 0.6ml preheating, fully mixes, 65 ° of C cracking 1h, during every 10min softly put upside down mixing once.
3) add equal-volume chloroform: primary isoamyl alcohol, softly mix 2min, the centrifugal 5min of 12,000rpm, draws supernatant liquor and is placed in new 1.5ml Eppendorf pipe.
4) add equal-volume Virahol, softly put upside down and mix, standing 5min in room temperature, then 12, the centrifugal 5min of 000rpm, abandons supernatant.
5) add 70% ethanol of 0.5ml, softly rotation, washing and precipitating surface, the centrifugal 5min of 8,000rpm, abandons supernatant.
6) precipitation is dried rear (natural air drying, oven for drying), adds the distilled water dissolution precipitation of 50 μ l.
7) every pipe adds 5ul RNaseA, and 37 ° of C process 1h.
8) get 5ul in 0.8% gel detection DNA quality.The results are shown in Figure 5
It is better that experimental result shows that genome extracts quality, can carry out next step experiment
The primer specificity of 2 four kinds of feeding enzyme genes of embodiment detects
Utilize tilactase aga primer A-F/R, dextranase glu primer G-F/R, mannase man primer M-F/R, zytase xyl primer X-F/R, take respectively aga, glu, man and xyl transgenic corns genome is template, detects the specificity of four pairs of primers.Take non-transgenic Zheng 58 Maize genomes and ddH2O is template, does negative control.
Primer concentration: 20 μ mol/L; Genome is quantitative: 1 μ g/ μ l
Reaction system:
PCR reaction parameter: 95 ° of C5min, 95 ° of C30sec, 60 ° of C30sec, 72 ° of C60sec, 30 circulations, 72 ° of C10min.
As shown in Figure 1, while testing with primer A-F/R, the tilactase transgenic corns of only take has 1028bp specific band during as template to experimental result; While testing with primer G-F/R, the dextranase transgenic corns of only take has 783bp specific band during as template; While testing with primer M-F/R, the mannase transgenic corns of only take has 607bp specific band during as template; While testing with primer X-F/R, the zytase transgenic corns of only take has 433bp specific band during as template.This experimental result shows, the primer A-F/R, the G-F/R that are directed to agaF75m, bgl7Am, man5As and xyl11As, M-F/R and the X-F/R specificity that in the present invention, design are better.
The specificity impact of the multiple genomic templates of embodiment 3 on each specific primer
The four kinds of feeding enzyme transgenic corns genomes of take are template, utilize respectively four couples of primer tilactase aga primer A-F/R, dextranase glu primer G-F/R, mannase man primer M-F/R, zytase xyl primer X-F/R to carry out pcr amplification, in order to detect template mixture specific impact on primer on four.
Primer concentration: 20 μ mol/L;
Genome is quantitative: 1 μ g/ μ l
Reaction system:
PCR reaction parameter: 95 ° of C5min, 95 ° of C30sec, 60 ° of C30sec, 72 ° of C60sec, 30 circulations, 72 ° of C10min.
Experimental result as shown in Figure 2, take four kinds of feeding enzyme tilactases, dextranase, mannase and zytase transgenic corns genome is template, while utilizing respectively primer A-F/R, G-F/R, M-F/R and X-F/R to increase, can and can only amplify corresponding single specific band, size is respectively 1028bp, 783bp, 607bp and 433bp.This experimental result shows, in the present invention, hybrid template is on the not impact of the specificity of each primer.
Primer specificity in embodiment 4 multi-primerses detects
Take respectively tilactase, dextranase, mannase and zytase transgenic corns genome is template, utilize four pairs of primers, the mixture that is A-F/R, G-F/R, M-F/R and X-F/R increases, and detects the specificity of each primer in mix primer.
Primer concentration: 20 μ mol/L; Genome is quantitative: 1 μ g/ μ l
Reaction system:
PCR reaction parameter: 95 ° of C5min, 95 ° of C30sec, 60 ° of C30sec, 72 ° of C60sec, 30 circulations, 72 ° of C10min.
Experimental result as shown in Figure 3, utilize four pairs of primers, be that the mixture of A-F/R, G-F/R, M-F/R and X-F/R is when increase to four kinds of feeding enzyme transgenic corns genomes, take respectively tilactase, dextranase, mannase and zytase transgenic corns genome is template, can and can only amplify single specific band, size is respectively 1028bp, 783bp, 607bp and 433bp.This result shows, in the present invention, mix primer is on the not impact of the specificity of primer self.
The feasibility of embodiment 5 multiplex PCR systems detects
The four kinds of genomic mixtures of feeding enzyme transgenic corns of take are template, add four couples of primer A-F/R, G-F/R, M-F/R and X-F/R to increase simultaneously, to detect the efficiency of these four pairs of primers in multi-PRC reaction and the feasibility of this multiplex PCR system.
Primer concentration: 20 μ mol/L;
Genome is quantitative: 1 μ g/ μ l
Reaction system:
PCR reaction parameter: 95 ° of C5min, 95 ° of C30sec, 60 ° of C30sec, 72 ° of C60sec, 30 circulations, 72 ° of C10min.
Experimental result as shown in Figure 5, the four kinds of transgenic corns genome mixtures of take are template, while utilizing four pairs of Auele Specific Primers to carry out multiplex PCR amplification, can amplify special object band, size is respectively 1028bp, 783bp, 607bp and 433bp simultaneously simultaneously.This experimental result shows, Auele Specific Primer A-F/R, G-F/R, M-F/R and X-F/R that four couple who designs in the present invention is directed to tilactase, dextranase, mannase and zytase transgenic corns are applicable to multiplex PCR detection, and this multiplex PCR detection system detection efficiency is better.
Claims (3)
1. identify the method that turns mannase gene, glucanase gene, xylanase gene and galactosidase gene plant simultaneously, it is characterized in that, described method comprises uses following primer to carry out the step of pcr amplification:
The nucleotide sequence of described galactosidase gene is as shown in SEQ ID NO.1; The nucleotide sequence of described glucanase gene is as shown in SEQ ID NO.2; The nucleotide sequence of described mannase gene is as shown in SEQ ID NO.3; The nucleotide sequence of described xylanase gene is as shown in SEQ ID NO.4.
2. identify the test kit that turns mannase gene, glucanase gene, xylanase gene and galactosidase gene plant simultaneously, it is characterized in that, described test kit comprises following combination of primers:
Wherein, the nucleotide sequence of described galactosidase gene is as shown in SEQ ID NO.1; The nucleotide sequence of described glucanase gene is as shown in SEQ ID NO.2; The nucleotide sequence of described mannase gene is as shown in SEQ ID NO.3; The nucleotide sequence of described xylanase gene is as shown in SEQ ID NO.4.
3. for identify simultaneously, it is characterized in that the combination of primers that turns mannase gene, glucanase gene, xylanase gene and galactosidase gene plant, described combination of primers comprises following primer:
Wherein, the nucleotide sequence of described galactosidase gene is as shown in SEQ ID NO.1; The nucleotide sequence of described glucanase gene is as shown in SEQ ID NO.2; The nucleotide sequence of described mannase gene is as shown in SEQ ID NO.3; The nucleotide sequence of described xylanase gene is as shown in SEQ ID NO.4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210591031.XA CN103045744B (en) | 2012-12-29 | 2012-12-29 | Method for synchronously identifying transgenic mannose gene, glucanase gene, xylanase gene and galactosidase gene plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210591031.XA CN103045744B (en) | 2012-12-29 | 2012-12-29 | Method for synchronously identifying transgenic mannose gene, glucanase gene, xylanase gene and galactosidase gene plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103045744A CN103045744A (en) | 2013-04-17 |
| CN103045744B true CN103045744B (en) | 2014-04-30 |
Family
ID=48058604
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210591031.XA Active CN103045744B (en) | 2012-12-29 | 2012-12-29 | Method for synchronously identifying transgenic mannose gene, glucanase gene, xylanase gene and galactosidase gene plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103045744B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805101B (en) * | 2015-03-06 | 2017-12-08 | 中国农业科学院饲料研究所 | Suitable for the optimization α galactosidase gene aga F75 expressed in corn and its application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101864416B (en) * | 2009-04-17 | 2012-01-04 | 长江大学 | Promoter of efficient expression Zmzf gene for water flooding of corn root |
-
2012
- 2012-12-29 CN CN201210591031.XA patent/CN103045744B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103045744A (en) | 2013-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103740815B (en) | Primer for multi-PCR (Polymerase Chain Reaction) detection aiming at fusaria and application of primer | |
| CN104513859B (en) | Function marker of rice grain length gene GS3 and application of function marker | |
| CN103276054B (en) | Primer for auxiliary detection of soybean hundred-grain weight, and detection method thereof | |
| Heide et al. | Determination of eight genetically modified maize events by quantitative, multiplex PCR and fluorescence capillary gel electrophoresis | |
| CN110129474A (en) | A method of three kinds of potato disease opportunistic pathogens are detected using multiple PCR technique | |
| CN103382506A (en) | RT-LAMP technology for rapidly detecting sorghum mosaic virus | |
| CN103045744B (en) | Method for synchronously identifying transgenic mannose gene, glucanase gene, xylanase gene and galactosidase gene plants | |
| CN103667476A (en) | Detection method for trans-Cry1Ab insect-resistant gene rice line mfb-MH3301 | |
| CN102586451A (en) | Method for matching and breeding jian carps | |
| CN102399853B (en) | Padlock probe used for detecting transgenic soybean and detection method thereof | |
| CN107227380A (en) | The primer sequence and method of a kind of synchronous detection PCV2 and PRV infection | |
| CN103614471B (en) | A kind of transgenic sugarcane goal gene element multiplex PCR quick screening method | |
| KR20140048548A (en) | Species-specific oligonucleotides for detecting fusarium proliferatum by pcr and the kit comprising the same | |
| CN112941223A (en) | Golden needle mushroom 6168 strain and identification method and construction method and application of SSR marker fingerprint spectrum thereof | |
| Ren et al. | Molecular identification of wheat leaf rust resistance genes in sixty Chinese wheat cultivars | |
| Li et al. | The genetic diversity of gaozhou wild rice analyzed by SSR | |
| KR20200063566A (en) | Primer set, composition and kit for detecting genetically modified crops introduced EPSPS gene, and methods using the same | |
| CN104342378A (en) | Method for verifying influence of Mbp1 genes of saccharomyces cerevisiae on cellular morphology | |
| CN104694627B (en) | For differentiating two repetitive dna sequences and FISH discrimination methods of sweet potato chromosome | |
| CN102206711A (en) | Method for detecting resistance to mosaic disease of tobacco germplasm by specific primer | |
| CN104131106B (en) | The primer that the special quantitative PCR of transgenic corns 98140 structure precisely detects and probe and method | |
| CN109628607B (en) | SNP marker related to digestibility of Suhuai pig neutral detergent fiber and application thereof | |
| CN102433335A (en) | Primers for amplifying Rrspgl, core fragment of gene and application of core fragment | |
| CN110669862B (en) | Molecular marker related to peanut crown rot resistance and application thereof | |
| CN110438203B (en) | Method for improving loop-mediated isothermal amplification reaction efficiency and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200828 Address after: 100193 Beijing Old Summer Palace West Road, Haidian District, No. 2 Patentee after: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences Address before: 100086 No. 12 South Main Street, Haidian District, Beijing, Zhongguancun Patentee before: FEED Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |