CN1242063C

CN1242063C - PGO of RNA1 carrier possessing labelling of green fluorescence protein and screening tag of resistance

Info

Publication number: CN1242063C
Application number: CN 200310108141
Authority: CN
Inventors: 王红阳; 鄢和新; 张瑞; 陈磊; 吴孟超
Original assignee: Second Military Medical University SMMU
Current assignee: Second Military Medical University SMMU
Priority date: 2003-10-24
Filing date: 2003-10-24
Publication date: 2006-02-15
Anticipated expiration: 2023-10-24
Also published as: CN1539979A

Abstract

The present invention relates to an RNA interference (RNAi) carrier pGO with the tracing of green fluorescent protein and resistant sieving marks of eukaryotic cells, which belongs to the technical filed of medical molecular biology and can be used for the specific inhibition of target gene expression. The RNAi carrier pGO of the present invention is a reformation of a pEGFP-C2 carrier, the original polycloning sites of the pEGFP-C2 carrier are removed, and U6 promoters with corresponding polycloning sites are inserted between SV40 polyA and an f1 procaryon replication origin to form the RNAi carrier pGO. As long as an siRNA mould plate aiming at a target gene is inserted into the proper site in the polycloning sites at the down stream of the U6 promoter, the expression of the gene can be specifically and efficiently inhibited after cell transfection. Therefore, the RNAi carrier pGO of the present invention can be used for the preparation of reagents for researching gene functions or the research and the development of antitumor medicine.

Description

RNAi carrier pGO with green fluorescent protein spike and resistance screening mark

Technical field

The present invention relates to medical technical field of molecular biology, is a kind of RNA interference (RNAi) carrier pGO with green fluorescent protein spike and resistance screening mark that specificity suppresses expression of target gene that can be used for.

Background technology

The mRNA molecule that RNA disturbs (RNAi) to be meant that double-stranded RNA (dsRNA) brings out specifically with its homologous sequence is degraded, and causes corresponding gene to express repressed phenomenon, is a kind of special posttranscriptional gene expression silencing phenomenon.It is to be found first in nematode by Fire etc. and reported in 1998 that RNA disturbs (RNAi) phenomenon.They observe can be at the post-transcriptional level specific inhibition of gene expression at nematode double center chain RNA (dsRNA).Many subsequently scholars have carried out big quantity research to nematode, fruit bat, plant and animal cell, confirm that RNAi is quite conservative biological pattern.Research to fruit bat is illustrated RNAi mechanism substantially: when the dsRNA of long-chain enters cell, hydrolase nucleic acid by a kind of Dicer of being referred to as is discerned, and be sheared into the siRNA of 21-23 Nucleotide (nt), double-stranded siRNA is unwind by the RNA desmolase, combine formation RNA combined enzyme agent with another nuclease with single stranded form, RNA chain in the complex body guides combined enzyme agent recognition sequence complementary mRNA with it as guide, and with this mRNA hydrolysis, thereby suppressor gene accurate translation specifically.Calendar year 2001, Tuchl etc. at first find the siRNA of Synthetic 2 1bp can be in mammalian cell special and effective inhibition of gene expression (Elbashir S.M.et al.Nature 411,494-498; 2001).Soon, use the expression vector that contains the 19-29bp inverted repeats in mammalian cell, to be transcribed into hair clip sample RNA and also successfully realized RNAi (Brummelkamp T.R.et al.Science 296,550-553; 2002).The RNAi technology is applied to antiviral, antitumor and in the research of gene function and obtained a large amount of challenging results very soon subsequently.

So-called RNAi technology is meant that the inhibition specific gene of developing based on the RNAi phenomenon is expressed or the Protocols in Molecular Biology of the specific RNA molecule of degrading, it is according to the ultimate principle of RNAi, can be at the dna nucleotide sequence of Disease-causing gene, select wherein one section with the lower sequence of other dna homolog as target sequence, form complementary oligonucleotide short chain (siRNA) by transcribing in the external synthetic or body with 21-29 base, in cell, combine with the mRNA specificity of target gene, the mechanism of activating cells self makes its degraded, thereby specificity suppresses the expression of this Disease-causing gene.Equally, also available RNAi studies the function of gene.External synthesizing is according to the synthetic a pair of complementary oligonucleotide short chain (siRNA) of target sequence direct chemical; And transcribe in the body is that the siRNA template is cloned in the carrier that has rna plymerase iii class promotor (U6 or H1), forms in transit cell record to have the siRNA of hair clip spline structure and play a role.

Though carrier mediated RNAi technology is born less than one-year age, yet, become the strong instrument that research makes Disease-causing gene inactivation and research gene function because it is convenient, characteristics efficiently and cheaply.The laboratory is normally used at present is the RNAi carrier of early development, as pSUPER, pSilencer, pSHAG and psiRNA etc.Their structure is simple relatively, usually only have protokaryon reproduction element and basic U6 or H1 promoter transcription unit, U6 or H1 promotor are rna plymerase iii family promotors, can mediate the synthetic of hair clip sample siRNA in vivo well, it is the indispensable element of RNAi carrier, but, therefore bring many inconvenience to research work because these carriers do not have spike and resistance screening mark.Such as the cells transfected amount being difficult to estimate when the transfectional cell, need a large amount of fluorescent protein report genes of cotransfection usually or adopt fluorescently-labeled transfection reagent to sub-elect transfected cell, thereby increased the difficulty and the cost of experiment.On the other hand, some can be integrated in the cellular genome behind the carrier transfectional cell, can duplicate along with duplicating of cell chromosome, just can select this part cell and increase, thereby in these cells, make target gene forever reticent by drug sieve if having resistant gene on the carrier.Yet because these carriers do not carry eukaryotic resistance screening mark, can't filter out the cell of stable integration RNAi carrier on genome, therefore can only observe the inhibition (5-7 days) of expression of target gene at short notice and can't make it forever reticent.

Summary of the invention

The invention provides the RNAi carrier pGO of a kind of energy spike transfectional cell and energy long term inhibition expression of target gene, it carries green fluorescence protein gene and neomycin resistance gene.Existing green fluorescent protein carrier pEGFP-C2 eukaryotic expression vector (Clontech company product) is to carry the carrier that is more suitable for the enhancing green fluorescence protein gene (EGFP) of mammalian cell expression through improvement, being generally used for merging with goal gene and showing expression and the location situation of this gene in cell, is the spike instrument of using always.This carrier also has neomycin gene, and its expression product Xin Meisu can be resisted the toxic action of medicine G418, therefore, the effect by G418 can filter out on the genome stable integration cell of carrier, thus make the goal gene continuous expression.The present invention has utilized these two characteristics of this carrier just, and the element of transcribing of pEGFP-C2 being made will to have after the appropriate reconstruction U6 promotor inserts and constitutes the RNAi carrier with green fluorescent protein spike and resistance screening mark in this carrier.If in this carrier, insert siRNA template, just can in cell, suppress the expression of this goal gene at goal gene.Therefore the carrier of the present invention reagent that can be used for preparing the medicine for the treatment of tumour or be used for the preparation research gene function.RNAi carrier of the present invention is done following transformation to the pEGFP-C2 carrier:

1, removes multiple clone site

PEGFP-C2 carrier primary member (see figure 2) comprises pUC replication orgin (pUC ori), CMV promotor (CMV promoter), strengthen green fluorescence protein gene (EGFP), multiple clone site (MCS), SV40 PolyA, f1 replication orgin (f1 ori), bacterium promotor (P), SV40 early promoter (SV40epromoter), kantlex/neomycin resistance gene (Kan/Neo), HSV-TK PolyA etc., wherein multiple clone site is between green fluorescent protein and the SV40 PolyA, have a plurality of restriction enzyme sites commonly used, as BglII, XholI, HindIII, EcoRI, SalI, BamHI etc. formerly are used to clone goal gene and green fluorescence protein gene and merge.And EGFP only is used for the spike purpose among the present invention, and original cloning site is unsuitable for cloning the siRNA template, so with its excision.Because of isocaudarner BglII and BamHI are positioned at the two ends of multiple clone site just, so only need to excise original multiple clone site from connecting again by these two kinds of enzyme double digestions.

2, preparation template

Extract human embryonic kidney cell line HEK293 cell genomic dna, as the template of the RNAIII class polysaccharase U6 promotor in amplification people source.

3, synthetic primer

At people source U6 promotor and have the nucleotide sequence of special restriction enzyme site, design and synthesize following primer:

Upstream primer:

5 ' CCG

AAGGTCGGGCAGGAAGAG 3 '; Its 5 ' end is introduced

The restriction enzyme site ACGCGT of Mlu I and the restriction enzyme site AGATCT of Bgl II;

Downstream primer:

5 ' CCG AAAAA

CACGGTGTTTCGTCCTTTC 3 '; Its 5 ' end is introduced restriction enzyme site ACGCGT, the restriction enzyme site CTCGAG of Xho I, the restriction enzyme site GAATTC of EcoR I, the restriction enzyme site GGATCC of BamH I, the restriction enzyme site GTCGAC of Sal I and the restriction enzyme site GAAGAC of Bbs I of Mlu I successively.

4, pcr amplification people source U6 promotor

With the HEK293 cell genomic dna is template, with above-mentioned synthetic upstream and downstream primer, adopts the pfu enzymatic amplification of high-fidelity, obtains having the people source U6 promotor of multiple clone site.

5, insert the U6 promotor, make up the RNAi carrier

After the pEGFP-C2 carrier is removed original multiple clone site, also has a Mlu I restriction enzyme site, because it is positioned between complete EGFP transcription unit (comprising CMV promotor and SV40 polyA) and the f1 protokaryon replication orgin, therefore external source is inserted the function that fragment can not change original structure on the carrier, structure on the carrier also can not influence the function of U6 promoter transcription element simultaneously, so the U6 promotor just inserts in (referring to accompanying drawing 1,2) in this site.Carrier called after pGO after so reconstructing.

What pGO had overcome RNAi carrier commonly used can't spike and deficiency that can not stable integration.During use at first at the nucleotide sequence of target gene the preceding paragraph length 21-29nt, design and synthesize a pair of complementary deoxy-oligonucleotide chain with inverted repeats, the template of transcribing as siRNA, wherein antisense sequences is placed before the just sequence, with nucleotide sequence GAAGCTTG at interval, after annealing, insert the pGO carrier between the two.Behind this carrier transfectional cell, it is template that the U6 promotor on the carrier is inserted fragment with its downstream, instructs synthetic siRNA with hair clip spline structure, thereby causes goal gene silence (referring to accompanying drawing 3).

Description of drawings

Fig. 1 is the structural representation of RNAi carrier pGO of the present invention.

Fig. 2 makes up schema for RNAi carrier pGO of the present invention.

Fig. 3 is that the carrier mediated hair clip sample siRNA of RNAi makes up schema.

Fig. 4 is at the tumor-related gene β-catenin RNA interferential immunity marking (Western Blot) figure.

Fig. 5 is at luciferase reporter gene (Luciferase) RNA interferential green fluorescence photo (A) and uciferase activity synoptic diagram (B).

Embodiment

Embodiment 1: the structure with RNAi carrier of green fluorescent protein spike and resistance screening mark;

One, the clone of people source small nuclear rna (U6) promotor

1. prepare 293 cell genomic dnas

Routinely 293 cells (available from ATCC company) are incubated at (available from Gibico company) in the DMEM substratum that contains 10% foetal calf serum, centrifugal collection 1 * 10 ⁷Individual cell is used Proteinase K and phenol isolation of genomic DNA (the molecular cloning experiment guide is seen in concrete operations) from cell.

2. design synthetic primer

Upstream primer 5 '-CCGACGCGTAGATCTAAGGTCGGGCAGGAAGAG-3 ', downstream primer 5 '-CCGACGCGTCTCGAGGAATTCGGATCCGTCGACAAAAAGAAGACCACGGTGTTTCG TCCTTTC-3 ' (2OD, the energy lottery industry of Shen, Shanghai is synthetic), introduce MluI and BglII restriction enzyme site in the upstream primer successively, introduce MluI, XholI, EcoRI in the downstream primer successively, BamHI, SalI and BbsI restriction enzyme site.With pure water primer is adjusted to 20 μ M concentration.

3.PCR amplification U6 promotor

With 293 cell genomic dnas is template, carries out the PCR reaction with above-mentioned primer.Reaction system: template 1 μ l (100ng/ μ l), each 1 μ l of upstream and downstream primer, dNTP (10mM) 2 μ l, PCR damping fluid 5 μ l, pfu enzyme 0.5 μ l (10U/ μ l), pure water 39.5 μ l; Reaction conditions: 96 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 1 minute, 35 circulations, the PCR instrument is available from BioRad, the PCR reaction all can betting office available from the Shen, Shanghai with reagent.The PCR product reclaims, and glue reclaims reagent and reclaims post available from Shen, Shanghai energy betting office, and concrete operations see that Shen, Shanghai energy lottery industry glue reclaims the reagent operation instruction.Obtain to reclaim product 20 μ l (100ng/ μ l) altogether.Reclaim product MluI (available from MBI) single endonuclease digestion, reaction system: PCR reclaims product 25 μ l (2.5 μ g), MluI (5U/ μ l) 2 μ l, and Y damping fluid 3 μ l, 37 ℃ were reacted 3 hours, carried out glue again and reclaimed, and operation is the same.

Two, the structure of RNAi carrier pGO of the present invention

PEGFP-C2 (available from CLONTECH company) BglII and BamHI double digestion, reaction system: PEGFP-C2 carrier 4 μ l (1 μ g/ μ l), each 1 μ l (5U/ μ l) of BglII and BamHI, Y damping fluid 6 μ l, pure water 18 μ l, 37 ℃ 3 hours, enzyme is cut product and is reclaimed the same.Enzyme is cut the product isocaudarner from connecting reaction system: enzyme cuts back to close product 8 μ l (50ng/ μ l), connects damping fluid 1 μ l, T4 ligase enzyme (the T4 ligase enzyme is available from Shen, Shanghai energy betting office, down together) 1 μ l, and 16 ℃ are spent the night, and connect product transformed competence colibacillus DH5 α bacterium.In 5ml kalamycin resistance LB nutrient solution, shake bacterium and spend the night choosing single bacterium colony on the flat board of kantlex.Extract plasmid (concrete operation method is seen the molecular cloning experiment guide) in a small amount, the BglII single endonuclease digestion is identified, reaction system: plasmid 2 μ l (0.5 μ g/ μ l), connect damping fluid 1 μ l, BglII (10U/ μ l) 1 μ l, 37 ℃ 3 hours, 1% agarose gel electrophoresis, as seen voltage 90V, shortwave ultraviolet lamp are not cut into the positive clone of cyclic plasmid of linearization down.The plasmid of this positive colony MluI single endonuclease digestion, reaction system is the same, and glue reclaims, and operation is the same.The pEGFP-C2 enzyme tangent line shape product that U6 promotor PCR enzyme is cut product and transformation is connected and transforms, and method is the same.

Three, the evaluation of RNAi carrier pGO of the present invention

1. enzyme is cut evaluation

Because of the U6 promotor is to insert from the pEGFP-C2 MluI single endonuclease digestion site of transforming, must cuts with enzyme and identify the promotor direction of insertion.Be positioned at 3 ' direction of MluI restriction enzyme site because of the EcoRI restriction enzyme site, the AgeI restriction enzyme site is positioned at U6 promotor upstream, do evaluation with AgeI and EcoRI double digestion recombinant vectors, do reference with AgeI and MluI double digestion pEGFP-C2 initial carrier simultaneously, as the recombinant vectors endonuclease bamhi when big than the initial carrier endonuclease bamhi of reference, illustrate that U6 promotor direction of insertion is a forward, as the recombinant vectors endonuclease bamhi than the initial carrier endonuclease bamhi of reference hour.Illustrate that then U6 promotor direction of insertion is reverse.

2. order-checking

Get the recombinant vectors that forward inserts the U6 promotor, use BglII and XhoI double digestion reaction system: plasmid 4 μ l (1 μ g/ μ l), BglII (5U/ μ l) 1 μ l, XhoI (5U/ μ l) 1 μ l, R damping fluid 3 μ l, pure water 21 μ l, 37 ℃ were reacted 3 hours, carried out glue and reclaimed, and operation is the same.Reclaim product and be connected into carrier PbluescriptSK (-) (available from Stratagen company) (carrier enzyme cut and reclaimer operation the same), linked system: purpose fragment 9 μ l (50ng/ μ l), carrier 3.5 μ l (50ng/ μ l), damping fluid 1.5 μ l, T4 ligase enzyme 1 μ l, 16 ℃ are spent the night.Connect product transformed competence colibacillus DH5 α bacterium (the molecular cloning experiment guide is seen in the preparation of competence bacterium), serving extra large Shen the mono-clonal bacterium that obtains on the penbritin flat board after preliminary enzyme is cut evaluation can betting office check order, sequencing primer is T3, sequencing result is correct, U6 promotor total length is 265 Nucleotide, and the confirmation recombinant vectors is pGO.

Embodiment 2: the RNA at tumor-related gene β-catenin disturbs

One, the RNA interference fragment chooses

β-catenin is the effector molecule of Wnt approach, and the abnormal activation of this path and the generation of many tumours are closely related.The experience that we provide according to document from Http:// www.ambion.com/techlib/misc/sirna_fi Nder.html, having designed the siRNA fragment according to beta-catenin gene, nucleotide sequence is as follows:

5’-

TCCTGTATGAGTGGGAACG

GGTTCCCACTCATACAGGACTTTTTT-3’

3 '-AGGACATACTCACCCTTGC

CCAAGGGTGAGTATGTCCTGAAAAAA

-5 ' wherein antisense sequences preceding, justice sequence after, two ends have the sticky end of BbsI (ACCG) and BamHI (GATC) restriction enzyme site respectively, connect in the ring texture of two sequences and include a HindIII restriction enzyme site (AAGCTT), so that use when identifying.

Two, the external method for annealing of RNA interference fragment

The siRNA interference fragment by the Shen, Shanghai can betting office synthetic (2OD), be dissolved in the 50 μ l pure water, complementary two strands is respectively got 10 μ l mixings, puts into 100 ℃ of boiling water 5 minutes, and is allowed to condition at and slowly cools to 20 ℃ in the water-bath naturally, puts-20 ℃ of preservations.

Three, RNA interference fragment and carrier is connected and evaluation

Carrier is with BbsI and BamHI double digestion, reaction system: carrier 4 μ l (1 μ g/ μ l), each 1 μ l (10U/ μ l) of BbsI and BamHI, Y damping fluid 6 μ l, pure water 18 μ l, 37 ℃ 3 hours.Enzyme is cut product and is reclaimed the same.The above-mentioned carrier that enzyme is cut back to close is connected conversion with annealed RNA interference fragment, and concrete operation method is the same.Plasmid after the conversion is identified with the HindIII single endonuclease digestion, can be cut into linearity as plasmid, illustrates that the RNA interference fragment is connected into carrier, and the HindIII restriction enzyme site is from the restriction enzyme site on the RNA interference fragment ring texture.Correct interference carrier called after pGO-β will be identified.Referring to Fig. 1,2,3.

Four, the eukaryotic expression vector and interference carrier cotransfection 293 cells that have the catenin gene

With 2 * 10 ⁵The density in/hole is carried out the transfection operation at 24 orifice plate upper berths, 293 cells after 24 hours.Eukaryotic expression vector pcDNA3.1-β-catenin and each 200ng cotransfection 293 cell of interference carrier pGO-β that will have the beta-catenin gene sequence, transfection reagent uses Lipotamine (available from Invitrogen), with empty interference carrier pGO in contrast, the concrete operations step is seen Invitrogen company liposome transfection operation instruction.After the transfection 48 hours with 1 * SDS sample-loading buffer lysing cell (1 * SDS sample-loading buffer prescription is seen the molecular cloning experiment guide), cell pyrolysis liquid runs 8% SDS-PAGE, 100V, 2 hours 30 minutes, with half-dried commentaries on classics film instrument (available from BioRad) albumen on the gel is transferred on the nitrocellulose filter, change the film condition: 100mA, 2 hours 30 minutes.5% skim-milk sealing 1 hour, one anti-is β-catenin monoclonal antibody (available from Santa Cruze company), two resist for having the sheep anti-mouse antibody (available from Hua Shun company) of HRP mark, and ECL photographic developer (available from Santa Cruze company) develops, and developed film is available from AFGA company.The result is referring to Fig. 4.As shown in the figure, β-the catenin that can see higher level behind pcDNA3.1-β-catenin and empty interference carrier pGO cotransfection 293 cells expresses, and behind pcDNA3.1-β-catenin and the interference carrier pGO-β cotransfection, β-catenin expression level significantly reduces, but the β-actin expression as internal reference is unaffected, and the expression of the inhibition beta-catenin gene that pGO-β can be effectively also special is described.The identical transfection consumption unanimity that pGO and pGO-β then are described of expression amount that shows EGFP on the figure, and it is expressed and the RNA interference effect is independent of each other.

Embodiment 3: the RNA at luciferase reporter gene (Luciferase) disturbs

One, the RNA interference fragment chooses

Known effective fragment of using according to document at the interference target sequence of luciferase reporter gene designs (Genes﹠amp; Development 16,948-958; 2002):

5‘-

GATTCCAATTCAGCGGGAGCCACCTGATG

GATCGGGTGGCTCTCGCTGAGTTGGAATCCTTTTTT-3’

3 '-CTAAGGTTAAGTCGCCCTCGGTGGACTAC

CTAGCCCACCGAGAGCGACTCAACCTTAGGAAAAAA

-5 ' antisense sequences is preceding, just sequence after, two ends have the sticky end of BbsI (ACCG) and BamHI (GATC) restriction enzyme site respectively, connect in the ring texture of two sequences and include a HindIII restriction enzyme site (AAGCTT), so that use when identifying.

Two, the external method for annealing (concrete operations are the same) of RNA interference fragment

Carrier is with BbsI and BamHI double digestion and reclaim, and the external annealing of RNA interference fragment is connected with carrier and identifies (concrete operations are the same), interference carrier called after pGO-FF.

Three, luciferase gene and interference carrier cotransfection HepG2 cell

With 1 * 10 ⁵The density in/hole is carried out the transfection operation at 24 orifice plate upper berth HepG2 cells after 24 hours.Interference carrier pGO-FF and empty carrier pGO (in contrast) 600ng, with luciferase gene carrier pGL3-SV40 (200ng) and pRL-TK (20ng) (the luciferase gene carrier is available from Promega) cotransfection HepG2 cell, the transfection concrete operations are the same respectively.Observed the expression of EGFP after the transfection in 24 hours; Detected RNA disturbed condition with two luciferase reporting system's reagent (available from Promega) in 48 hours at luciferase, the two fluorescence report systems of Promega reagent operation instruction is seen in concrete operations, it is about 80% that the detection of luciferase reporter gene is shown that cotransfection pGO-FF descends reporter gene activity, referring to Fig. 5.Find out from Fig. 5 A, after the transfection after 24 hours the expression according to EGFP can tell transfected cell easily, and the transfection consumption unanimity of explanation pGO and pGO-FF; About 80% from uciferase activity is descended, prompting pGO-FF can significantly suppress the expression of luciferase reporter gene.This shows that RNAi carrier pGO of the present invention has green fluorescent protein spike and eukaryotic resistance screening mark, and can effectively suppress destination gene expression, so the reagent that can be used for preparing the medicine for the treatment of tumour or be used for the preparation research gene function.

Claims

1, a kind of RNAi carrier pGO, the preparation method is as follows:

(1) the pEGFP-C2 carrier is excised a plurality of restriction enzyme site BglII commonly used, XholI, HindIII, EcoRI, SalI, BamHI between EGFP and the SV40polyA with isocaudarner BglII and BamHI double digestion, keep restriction enzyme site MluI and primary member pUC replication orgin pUC ori, f1 replication orgin fl ori, bacterium promotor P, kanamycin gene/neomycin resistance gene Kan/Neo, HSV-TK PolyA, CMV promotor, strengthen green fluorescence protein gene EGFP, SV40PolyA, SV40 early promoter;

(2) be template with the HEK293 cell genomic dna, with upstream primer 5 '-CCGACGCGTAGATCTAAGGTCGGGCAGGAAGAG-3 ' and downstream primer 5 '-CCGACGCGTCTCGAGGAATTCGGATCCGTCGACAAAAAGAAGACCACGGTGTTTCG TCCTTTC-3 ' amplification people source U6 promotor, wherein in the upstream and downstream primer, introduce the MluI restriction enzyme site respectively, in downstream primer, introduce multiple clone site XhoI, EcoRI, BamHI, SalI and BbsI;

(3) people source U6 promotor is inserted the restriction enzyme site MluI that above-mentioned (1) transforms back pEGFP-C2 after the MluI enzyme is cut, promptly got pGO.

2, the application of the described RNAi carrier of claim 1 pGO in preparation genetic expression inhibition reagent and antitumor drug.