CN103160532A - Universal type ribonucleic acid (RNA) interference vector and construction method and application thereof - Google Patents
Universal type ribonucleic acid (RNA) interference vector and construction method and application thereof Download PDFInfo
- Publication number
- CN103160532A CN103160532A CN201310051787XA CN201310051787A CN103160532A CN 103160532 A CN103160532 A CN 103160532A CN 201310051787X A CN201310051787X A CN 201310051787XA CN 201310051787 A CN201310051787 A CN 201310051787A CN 103160532 A CN103160532 A CN 103160532A
- Authority
- CN
- China
- Prior art keywords
- carrier
- gene
- pcmv
- puc57
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a universal type ribonucleic acid (RNA) interference vector and a construction method and an application thereof, and belongs to the field of biotechnologies. The interference vector comprises the following ingredients in sequence: green fluorescent protein, a human U6 promoter sequence, polyclone enzyme cutting sites, a human U6 terminator sequence, neomycin resistant genes containing PCMV promoters, replication origin site genes, ampicillin resistance screening genes and restriction enzyme cutting sites for linearizing carriers. All the ingredients are connected with one another. According to the interference vector, under different operation conditions, instant suppression and stable suppression on cytogene expression are realized, when a stable expression cell line is built up, integration efficiency of the carriers is improved, meanwhile, through improvement of the h U6 promoters, two restriction enzyme cutting sites are introduced, the linearization carriers can be connected with any target oligon DNA which contains two extra nucleotides (namely, not used for expressing shRNA), and experiment cost is saved.
Description
Technical field
The present invention relates to a kind of rna interference vector and construction process thereof and application, particularly a kind of universal rna interference vector and construction process and application, belong to biological technical field.
Background technology
RNA disturbs (RNAinterference, RNAi) to refer to the phenomenon of the efficient specificity degraded of high conservative, that brought out by double-stranded RNA (double-stranded RNA, dsRNA), homologous mRNA during evolution.Owing to using the RNAi technology can specific depletion or close the expression of specific gene, so this technology has been widely used in exploring the field of gene of gene function and communicable disease and malignant tumour.
In animal, RNAi can start expression shRNA by U6 to be realized.Present U6 carrier can be expressed in zooblast by 2 kinds of modes and be expressed: transient expression and stably express.ShRNA is the special microRNA with loop-stem structure that is produced by the single chain molecule that length is 50～70 Nucleotide.Its constructional feature is: the ring of 5～10 Nucleotide connects the complementary long-chain RNA fragment of two 19～29 Nucleotide, and this two bar segment forms loop-stem structure by base pairing.ShRNA can synthesize in external generation by chemosynthesis and in-vitro transcription, but most typical mode is to express in vivo generation by the promotor of PolIII.Connect 5～6 T as the transcription terminator of RNA polymerase after following 19～29nt target gene reverse complementary sequence closely.
Summary of the invention
The present invention is the novel universal type RNAi carrier that disturbs (RNAi) technology to invent in conjunction with Subcloned technology and RNA.Convenient for the use that makes the hU6 promotor, and improve the joint efficiency of oligoDNA.The present invention by transformation hU6 promotor 3 ' nucleotide sequence of end produces available restriction enzyme site sticky end.And design can be used as the restriction enzyme site sequence that the part transcription terminator can be used base on carrier.This Success in Experiment transformation hU6 promoter sequence, expressed shRNA successfully suppresses the expression of target gene without unnecessary ribonucleotide; Improved U6 promotor makes the use of U6 promotor convenient, has saved the time in conjunction with Subcloned technology, transcription terminator, has reduced cost, can improve the RNA perturbation technique in the popularization and application of common laboratory.
The present invention has adopted following technique means in order to achieve the above object:
A kind of universal rna interference vector of the present invention, since 5 ' end, comprise the each several part that next coming in order are connected: contain green fluorescent protein, human U_6 promoter sequence, polyclone restriction enzyme site, people U6 terminator sequence, the neomycin resistance gene that contains the PCMV promotor, replication origin gene, the amicillin resistance screening-gene of PCMV promotor and be used for the linearizing restriction enzyme site of carrier.
Wherein the polyclone restriction enzyme site is used for linearization plasmid, exposes the sticky end that is used for connecting oligoDNA; Human U_6 promoter and terminator are used for expressing purpose shRNA; Green fluorescent protein is used for observation plasmid transfection efficient; PCMV-NEO: be used for screening and have the monoclonal cell of stablizing the RNAi effect; Replication origin (Origin) provides the Copy Info of carrier in intestinal bacteria; AmP Promoter-AmP is used for a large amount of propagation of screening positive clone or thalline.
In the present invention, preferred, described U6 promoter sequence is take plasmid i α v-PENTR/U6 as template, obtains by using following primer amplification:
F：5’-ACCGGTACTGGATCCGGTACCAAGGTC-3’
R：5’-CATCGATGTTTCGTCCTTTCCAC-3’；
Described polyclone restriction enzyme site and terminator sequence are the synthetic nucleotide sequences of designed, designed, and nucleotide sequence is as shown in SEQ ID NO.1.
In the present invention, preferred, the nucleotide sequence of described carrier is as shown in SEQ ID NO.1.
Further, the present invention also provides a kind of method that builds the described rna interference vector of above any one, it is characterized in that comprising the following steps:
(1) structure of mutant human U_6 promoter
Take the carrier that contains human U_6 promoter as template, use the primer PCR amplification after point mutation to obtain the mutant human U_6 promoter, the fragment that the clone is obtained is connected on the PMD20-T carrier, builds to obtain PMD20-T-U6.Amplimer is:
F：5’-ACCGGTACTGGATCCGGTACCAAGGTC-3’
R：5’-CATCGATGTTTCGTCCTTTCCAC-3’；
(2) structure of green fluorescent protein (GFP)
Take contain can expressed intact green fluorescent protein element carrier as template, amplification obtains containing the Expression element of PCMV, GFP, SV40POLY (A), the fragment that the clone is obtained is connected on the PMD20-T carrier, builds to obtain PMD20-T-GFP.Amplimer is:
F：5’-TAGTTATTAATAGTAATCAATTACG-3’
R：5’-TAAGATACATTGATGAGTTTGG-3’；
(3) structure of positive screening-gene
Neomycin resistance gene NEO and PCMV promotor are carried out gram and are fallen take carrier PGT-V1 as template, the amplimer of NEO is:
F：5’-ACACGATGATAAGCTTGCCAC-3’
R：5’-TTAGCTAGCGAACCTCTTCGAGGGACCTAATAACTTC-3’；
The amplimer of PCMV promotor is:
F：5’-ACGGGATCCATATACGCGTTGACATTGATTATTGAC-3’
R：5’-GTTCCCGGGAGAGCTCTGCTTATATAGACCTCCC?AC-3’；
(4) structure of skeleton carrier
Synthetic multiple clone site, and it is subcloned on the PUC57 carrier, build skeleton carrier PUC57-MCS, multiple clone site sequence such as SEQ ID NO.2 or shown in Figure 2;
(5) element assembling
1. utilize AgeI on PUC57-MCS and AgeI and the ClaI on two restriction enzyme sites of ClaI and carrier PMD20-T-hU6, the hU6 subclone is configured to carrier PUC57-hU6 to PUC57-MCS;
2. the assembling of PCMV and NEO gene: after the PCMV and the recovery of NEO gene glue that are cloned into, utilize the XmaI restriction enzyme site on gene that two gene splicings are become PCMV-NEO, utilize BamHI, NheI on PCMV-NEO and the BglII on PUC57-hU6, SpeI is cloned into PCMV-NEO on carrier PUC57-hU6, is configured to carrier PUC57-UN;
3. utilize AgeI on PMD57-UN and the XmaI on SalI and PMD20-T-GFP and SalI site, GFP is cloned on PUC57-UN, be configured to purpose carrier PGN-hU6.
In the present invention, preferred, build the sequence of the fragment that contains human U_6 promoter, polyclone restriction enzyme site, people U6 terminator that obtains in step (1) as shown in SEQ ID NO.3.
Further, the present invention also provides the application of the described rna interference vector of above any one in building pig source cell RNAi expression vector.
When using vector construction pig source cell RNAi expression vector of the present invention, comprise the following steps:
1, double digestion carrier, the U6 promotor on exposure PGN-hU6 and the sticky end between termination signal.
2, syntheticly transcribe the required DNA sequence dna of shRNA, meet the ds-oligo (DNA) of this carrier as shown in Figure 4;
3, synthetic fragment is connected with PGN-hU6 after enzyme is cut, conversion connection product, picking positive colony sequence verification, sequencing primer is: 5 '-G GACTATCATATGCTTACCG-3 '.
4, obtain in a large number positive bacteria liquid, large upgrading grain.
6, liposome transfection cell, the observation carrier is for the suppression efficiency of target protein.
Interference carrier of the present invention has been realized in the different operating situation, to instantaneous inhibition or stable inhibition of cellular gene expression, when setting up stable expression cell line, improved and turned the then integration efficiency of carrier. simultaneously by the hU6 promotor is transformed, introduced 2 restriction enzyme sites, linearized vector can connect target oligoDNA arbitrarily, and this oligoDNA only contains 2 extra Nucleotide (namely, be not used in the Nucleotide of expressing shRNA), saved experimentation cost.
Description of drawings
Fig. 1 is the carrier collection of illustrative plates of recombinant vectors PGN-U6;
Fig. 2 is the carrier collection of illustrative plates of recombinant vectors PUC57-MCS;
Fig. 3 is the junction fragment of PCMV and NEO;
Fig. 4 is ds-oligo (DNA) schematic diagram that meets this carrier;
Fig. 5 is that different time detects the green fluorescence signal graph;
Fig. 6 is that the mRNA level of α v in transfection positive plasmid cell and idle running transfect cell compares;
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.
The construction process of 1 one kinds of universal rna interference vectors of embodiment
1, experiment material
I α v-PENTR/U6 carrier: this laboratory reference literature " Lentviral-mediated RNAi to inhibit target gene expression of the porcine integrin av subunit, the FMDV receptor, and against FMDV infection in PK-15cells " build;
PcDNA3.1/CT-GFP carrier: available from invitrogene company;
PGT-V1: this laboratory reference literature " structure of two selection markers targeting vectors and Function Identification thereof " builds;
The polyclone restriction enzyme site is used relevant primer: synthetic by Shanghai biotechnology company limited in experiment;
The all ingredients box of using in test is available from precious biotechnology (Dalian) company limited, and another restriction enzyme is available from NEB company (be applied to restriction endonuclease that the carrier enzyme cuts available from precious biological).
2, method
2.1 the formation of carrier
The formation of carrier is as shown in PGN-U6 structure iron spectrogram 1, and its function introduction is as follows:
ClaI, SfiI: be used for enzyme and cut the sticky end that exposes between U6 promotor and termination signal, be convenient to insert purpose ds oligo:
HU6 promotor, terminator: be used for expressing purpose shRNA;
PCMV-GFP: be used for observation plasmid transfection efficient;
PCMV-NEO: be used for screening and have the monoclonal cell of stablizing the RNAi effect;
PUC Origin: the Copy Info of carrier in intestinal bacteria;
AmP Promoter-amP: a large amount of propagation that are used for screening positive clone or thalline;
NruI, SrfI: before being used for transfection, linearized vector;
2.2 the clone of vector gene original paper
2.2.1 the structure of mutant human U_6 promoter (hU6)
Take i α v-PENTR/U6 carrier as template amplification mutant human U_6 promoter, the amplimer that uses is:
F：5’-ACCGGTACTGGATCCGGTACCAAGGTC-3’
R：5’-CATCGATGTTTCGTCCTTTCCAC-3’。
Amplification length is 289bP, and amplification program is: 94 ℃ of 1min, 55 ℃ of 50s, 72 ℃ of 3min (30cycles); 72 ℃ of 3min (over).The fragment that the clone is obtained is connected to and obtains carrier PMD20-T-hU6 on carrier PMD20-T, carries out sequence verification, and the clone obtains mutant human U6 promoter fragment, and sequence is as shown in SEQ ID NO.3.Produce by above-mentioned primer pair and can be cut by ClaI restriction enzyme site enzyme the mutant human U_6 promoter of rear generation sticky end.The base of transforming is ATATATCTTGTGGAAAGGACGAAACA
CIn CG
CPoint mutation is T.
2.2.2 the structure of green fluorescent protein (GFP)
Take plasmid pcDNA3.1/CT-GFP as template amplification GFP Expression element, the primer that uses is:
F：5’-TAGTTATTAATAGTAATCAATTACG-3’
R：5’-TAAGATACATTGATGAGTTTGG-3’；
Amplification length is 1600bP, and amplification program is: 94 ℃ of 1min, 53 ℃ of 50s, 72C2min (30cycles); 72 ℃ of 5min (over).The fragment that the clone is obtained is connected on the PMD20-T carrier, carries out sequence verification, and the clone obtains the GFP Expression element, and sequence builds and obtains PMD20-T-GFP as shown in SEQ ID NO.4.
2.2.3 the structure of positive screening-gene
Positive screening-gene (neomycin resistance gene NEO) and PCMV promotor are cloned take carrier PGT-V1 as template.The amplimer of NEO is:
F：5’-ACACGATGATAAGCTTGCCAC-3’
R：5’-TTAGCTAGCGAACCTCTTCGAGGGACCTAATAACTTC-3’；
Its amplification program is 94 ℃ of 1min, 59 ℃ of 50s, 72 ℃ of 1min30s (30cycles); 72 ℃ of 8min (over); Length is 1226bP.
The amplimer of PCMV is:
F：5’-ACGGGATCCATATACGCGTTGACATTGATTATTGAC-3’
R：5’-GTTCCCGGGAGAGCTCTGCTTATATAGACCTCCCAC-3’；
Its amplification program is 94 ℃ of 1min, 57 ℃ of 50s, 72 ℃ of 1min (30cycles); 72 ℃ of 8min (over); Length is 615bP, and the junction fragment of PCMV and NEO as shown in Figure 3.
2.2.4 the structure of skeleton carrier
The gene order of resulting each gene original paper of this experimental basis, design is not present in the multiple clone site of the restriction enzyme site on these genes, multiple clone site is served Hai Shenggong synthetic, and it is subcloned on the PUC57 carrier altogether by Shanghai is living, build skeleton carrier PUC57-MCS, multiple clone site sequence such as SEQ ID NO.2, PUC57-MCS carrier collection of illustrative plates as shown in Figure 2.
2.3 element assembling
The subclone that carries out as follows gene is assembled into each gene original paper on skeleton carrier PUC57-MCS.
(1) utilize AgeI on PUC57-MCS and AgeI and the ClaI on two restriction enzyme sites of ClaI and carrier PMD20-T-hU6, the hU6 subclone is configured to carrier PUC57-hU6 to PUC57-MCS;
(2) assembling of PCMV and NEO gene: after the PCMV and the recovery of NEO gene glue that are cloned into, utilize the XmaI restriction enzyme site on gene that two gene splicings are become PCMV-NEO, utilize BamHI, NheI on PCMV-NEO and the BglII on PUC57-hU6, SpeI is cloned into PCMV-NEO on carrier PUC57-hU6, is configured to carrier PUC57-UN;
(3) utilize AgeI on PUC57-UN and the XmaI on SalI and PMD20-T-GFP and SalI site, GFP is cloned on PUC57-UN, is configured to purpose carrier PGN-hU6, and carry out sequence verification, the carrier collection of illustrative plates as shown in Figure 1, the sequence of carrier is as shown in SEQ ID NO.1.Restriction enzyme and reaction conditions that in each subclone step, each carrier uses are as shown in table 1.
Restriction enzyme and reaction conditions that in each subclone step of table 1, each carrier uses
Annotate: two restriction endonucleases that connected by "/" represent to carry out simultaneously double digestion; By ", " two restriction endonucleases connecting represent that two enzyme distribution enzymes cut.In each step subclone, top recovery fragment is carrier, and following recovery fragment is Insert Fragment.
Enzyme uses the T4-DNA ligase enzyme after cutting the product recovery, and then 16 degrees centigrade of connections of spending the night transform DH5 α, the picking positive colony.
The application of embodiment 2 carrier of the present invention in building the reticent expression vector of pig source cell
1, build the shRNA that is used for suppressing egfp expression, and with carrier transfection PK-15 cell
(1) use ClaI and SfiI double digestion carrier, the U6 promotor on exposure PSN-U6 and the sticky end between termination signal.Reaction conditions is the 1*M damping fluid, adds simultaneously 2 kinds of enzymes, 30 ℃ of 1.5h, then temperature is adjusted to 50 ℃ of 1.5h, reclaims enzyme and cuts product.
(2) syntheticly transcribe the required DNA sequence dna of shRNA, meet the ds-oligo (DNA) of this carrier as shown in Figure 4; The oligoDNA sequence is;
5’-C
GGACGGAACAAAGACTGTTGACGA
ATCAACAGTC?TTTGTTCCGTCCTTTTT-3’
5’-
CTGCCTTGTTTCTGACAACTGCT
TAGTTGTCAGAAACAAGGCAGGAA-3’
(3) synthetic fragment is connected with PGN-hU6 after enzyme is cut, conversion connection product, picking positive colony sequence verification, sequencing primer is:
5’-GGACTATCATATGCTTACCG-3’。
(4) obtain a large amount of positive bacteria liquid, large upgrading grain.
(5) use the suitable flat end restriction enzyme site that carries on carrier, enzyme is cut carrier, makes it linearizing.
(6) utilize LiPofetamine2000, to specifications empty carrier PGN-hU6 and PGN-hU6-shRNA are changed over to respectively in six orifice plates different holes.
2, detect suppression efficiency by fluorescent signal
Turn then minute different time sections, detect the empty carrier contrast and with the fluorescent signal of interference fragment, judge suppression efficiency.12h, 24h, 36h, 48h, 60h, 72h gather fluorescent signal turning then respectively in this experiment.As shown in Figure 5: experimental group begins to weaken after 24h, and the 72h fluorescent signal is almost nil, reaches maximum after control group fluorescent signal 48h, and then signal keeps maximum, and no signal weakens appearance.The carrier that transformation is described is working properly, and interference effect is good.
3, mRNA level detection interference effect
Use GAPDH as reference gene, the mRNA level of GFP is carried out relative quantification, the primer that uses is as shown in table 2 below
Table 2
Use Trizol to extract total RNA of empty carrier contrast and interference group, use NanoDroP2000 (Thermo) to carry out concentration determination to extraction RNA, use ThermoScript II M-MLV (Takara) to carry out reverse transcription to total RNA, be totally 15 microlitres, each concentration of component is the 1.5 total RNA of μ g, 0.5mM dNTP each, 5 μ M oligo-dT primers, 11 μ l5 * M-MLV buffer, 300U M-MLV.Use SYBR Premix Ex Taq (Takara) test kit, it is quantitative that Mx3005P QPCR system (Stratagene) carries out relative fluorescence to goal gene, and response procedures is: 95 ℃ of 30s; 95 ℃ of 5s, 60 ℃ of 30s (40cycles); 95 ℃ of 15s, 60 ℃ of 60s, 95 ℃ of 15s.Use 2-Δ Δ Ct method that the acceptor gene α v relative expression level of engineering cell is measured.Comparison result is as shown in Figure 6: the mRNA level of experimental group GFP be GFP in the empty carrier control cells the mRNA level 0.12.
Above description of test the ability of improved U6 promoter expression shRNA unaffected.Can connect the different oligoDNA that is used for expressing shRNA after linearizing, the silence that is used for all target genes is expressed.Reticent expression efficiency is higher.
Should be understood that, for those of ordinary skills, can be improved according to the above description or conversion, and all these improve and conversion all should belong to the protection domain of claims of the present invention.
Claims (4)
1. universal rna interference vector, it is characterized in that, described interference carrier comprises following connected each several part successively: contain green fluorescent protein, human U_6 promoter sequence, polyclone restriction enzyme site, people U6 terminator sequence, the neomycin resistance gene that contains the PCMV promotor, replication origin gene, the amicillin resistance screening-gene of PCMV promotor and be used for the linearizing restriction enzyme site of carrier; The nucleotide sequence of described universal rna interference vector is as shown in SEQ ID NO.1.
2. build the method for universal rna interference vector claimed in claim 1, it is characterized in that, comprise the following steps:
(1) structure of mutant human U_6 promoter
Take the carrier that contains human U_6 promoter as template, use the primer PCR amplification after point mutation to obtain the mutant human U_6 promoter, the fragment that the clone is obtained is connected on the PMD20-T carrier, builds to obtain PMD20-T-hU6; Amplimer is:
F：5’-ACCGGTACTGGATCCGGTACCAAGGTC-3’
R：5’-CATCGATGTTTCGTCCTTTCCAC-3’；
(2) structure of green fluorescent protein (GFP)
Take contain can expressed intact green fluorescent protein element carrier pcDNA3.1/CT-GFP as template, amplification obtains containing the Expression element of PCMV, GFP, SV40POLY (A), the fragment that the clone is obtained is connected on the PMD20-T carrier, builds to obtain PMD20-T-GFP; Amplimer is:
F：5’-TAGTTATTAATAGTAATCAATTACG-3’
R：5’-TAAGATACATTGATGAGTTTGG-3’；
(3) structure of positive screening-gene
Neomycin resistance gene NEO and PCMV promotor are cloned take carrier PGT-V1 as template, and the amplimer of NEO is:
F：5’-ACACGATGATAAGCTTGCCAC-3’
R：5’-TTAGCTAGCGAACCTCTTCGAGGGACCTAATAACTTC-3’；
The amplimer of PCMV promotor is:
F：5’-ACGGGATCCATATACGCGTTGACATTGATTATTGAC-3’
R：5’-GTT?CCCGGGAGAGCTCTGCTTATATAGACCTCCCAC-3’；
(4) structure of skeleton carrier
Synthetic multiple clone site, and it is subcloned on the PUC57 carrier, building skeleton carrier PUC57-MCS, the multiple clone site sequence is as shown in SEQ ID NO.2;
(5) element assembling
1. utilize SalI on PUC57-MCS and SalI and the ClaI on two restriction enzyme sites of ClaI and carrier PMD20-T-hU6, the hU6 subclone is configured to carrier PUC57-hU6 to PUC57-MCS;
2. the assembling of PCMV and NEO gene: after the PCMV and the recovery of NEO gene glue that are cloned into, utilize the XmaI restriction enzyme site on gene that two gene splicings are become PCMV-NEO, PCMV-NEO is cloned on carrier PUC57-hU6, is configured to carrier PUC57-UN;
3. utilize AgeI on PMD57-UN and the XmaI on SalI and PMD20-T-GFP and SalI site, GFP is cloned on PUC57-UN, be configured to purpose carrier PGN-hU6.
3. method as claimed in claim 2, is characterized in that, step (5) builds the sequence of the fragment that contains human U_6 promoter, polyclone restriction enzyme site, people U6 terminator obtain as shown in SEQ ID NO.3 in 1..
4. the application of the universal rna interference vector of the arbitrary described method structure of claim 2-3 in building pig source cell RNAi expression vector.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310051787XA CN103160532A (en) | 2013-02-02 | 2013-02-02 | Universal type ribonucleic acid (RNA) interference vector and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310051787XA CN103160532A (en) | 2013-02-02 | 2013-02-02 | Universal type ribonucleic acid (RNA) interference vector and construction method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103160532A true CN103160532A (en) | 2013-06-19 |
Family
ID=48584066
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310051787XA Pending CN103160532A (en) | 2013-02-02 | 2013-02-02 | Universal type ribonucleic acid (RNA) interference vector and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103160532A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755049A (en) * | 2016-11-14 | 2017-05-31 | 西北农林科技大学 | Visual cells remediation efficiency reporting system and its method for building up based on artificial nuclease |
| CN108753675A (en) * | 2018-06-26 | 2018-11-06 | 青岛农业大学 | A kind of construction method of sRNA interference systems in methyl bacterium |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1539979A (en) * | 2003-10-24 | 2004-10-27 | 中国人民解放军第二军医大学 | PGO of RNA1 carrier possessing labelling of green fluorescence protein and screening tag of resistance |
| CN101591657A (en) * | 2009-07-06 | 2009-12-02 | 北京大学第三医院 | Suppress extrasin beta 4The RNA of genetic expression and application thereof |
| CN102533765A (en) * | 2011-12-30 | 2012-07-04 | 辽宁师范大学 | ERalpha36 knock-down PC12 cell strain and establishing method thereof |
-
2013
- 2013-02-02 CN CN201310051787XA patent/CN103160532A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1539979A (en) * | 2003-10-24 | 2004-10-27 | 中国人民解放军第二军医大学 | PGO of RNA1 carrier possessing labelling of green fluorescence protein and screening tag of resistance |
| CN101591657A (en) * | 2009-07-06 | 2009-12-02 | 北京大学第三医院 | Suppress extrasin beta 4The RNA of genetic expression and application thereof |
| CN102533765A (en) * | 2011-12-30 | 2012-07-04 | 辽宁师范大学 | ERalpha36 knock-down PC12 cell strain and establishing method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 朱晨芳 等: "构建RNA干扰真核表达载体抑制肝癌细胞IGF1R表达的研究", 《上海交通大学学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755049A (en) * | 2016-11-14 | 2017-05-31 | 西北农林科技大学 | Visual cells remediation efficiency reporting system and its method for building up based on artificial nuclease |
| CN106755049B (en) * | 2016-11-14 | 2020-04-21 | 西北农林科技大学 | Visual cell repair efficiency report system based on artificial nuclease and establishment method thereof |
| CN108753675A (en) * | 2018-06-26 | 2018-11-06 | 青岛农业大学 | A kind of construction method of sRNA interference systems in methyl bacterium |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108753836B (en) | Gene regulation or editing system utilizing RNA interference mechanism | |
| Cheunsuchon et al. | Silencing of the imprinted DLK1-MEG3 locus in human clinically nonfunctioning pituitary adenomas | |
| EP2198025B1 (en) | Generation of human embryonic stem-like cells using intronic rna | |
| CN105255937A (en) | Method for expression of CRISPR sgRNA by eukaryotic cell III-type promoter and use thereof | |
| CN101821390A (en) | Oligonucleotides for modulation of target RNA activity | |
| CN105543223A (en) | Method for transcribing sgRNA (small guide Ribonucleic Acid) based on miRNA/shRNA (micro Ribonucleic Acid/short hairpin Ribonucleic Acid) transcription processing mechanism | |
| CN101126176A (en) | Preparation method for PCR high flux construction siRNA whole site molecule library | |
| Klanert et al. | Endogenous microRNA clusters outperform chimeric sequence clusters in Chinese hamster ovary cells | |
| CN101935670A (en) | Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers | |
| CN103160532A (en) | Universal type ribonucleic acid (RNA) interference vector and construction method and application thereof | |
| WO2004085623A2 (en) | A compact synthetic expression vector comprising double-stranded dna molecules and methods of use thereof | |
| CN102533831B (en) | Tissue-specific double gene silencing RNAi expression vector having self-splicing locus | |
| CN102433352B (en) | MicroRNA structure-based construction method and function verification of hepatic cell selective multi-target interfering plasmid vector | |
| CN102628057A (en) | Vector for non-background directed cloning of PCR products, preparation method thereof and application thereof | |
| Kashyap et al. | Transcripts for combined synthetic microRNA and gene delivery | |
| CN102517313B (en) | Vector for expressing miRNA and/or protein and application of vector | |
| CN102168133B (en) | Kit for identifying miRNA (micro-ribonucleic acid) target genes and applications thereof | |
| CN102533742B (en) | Double-stranded nucleotide sequence, recombinant plasmid containing the same and construction method thereof | |
| CN104404070A (en) | Method for inhibiting mouse MSTN (myostatin) expression and corresponding MSTN shRNA (short hairpin Ribose Nucleic Acid) segment | |
| CN103131723B (en) | Ribonucleic acid (RNA) interference vector for bovine genome locus specificity recombination, vector construction method and application | |
| CN101892236B (en) | Construction and application of RNA interference expression vector of targeted ZNF268 gene | |
| CN101993894A (en) | Construction method of siRNA adenovirus carrier for restraining rat IL-1beta gene expression | |
| CN111334507B (en) | Sheep Lrh-1 short hairpin RNA and interference vector thereof | |
| CN101906431A (en) | Expression vector of introne small interfering RNA, construction method and application thereof | |
| CN101565717A (en) | Gene expression down-regulated vector of cell specificity ndrg2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130619 |