CN111334507B

CN111334507B - Sheep Lrh-1 short hairpin RNA and interference vector thereof

Info

Publication number: CN111334507B
Application number: CN201911345087.5A
Authority: CN
Inventors: 王利红; 张伟
Original assignee: Jiangsu Agri Animal Husbandry Vocational College
Current assignee: Jiangsu Agri Animal Husbandry Vocational College
Priority date: 2019-12-24
Filing date: 2019-12-24
Publication date: 2024-01-30
Anticipated expiration: 2039-12-24
Also published as: CN111334507A

Abstract

The invention relates to the field of bioengineering, in particular to sheep Lrh-1 short hairpin RNA and an interference vector thereof. The invention screens out target sequence according to cDNA sequence and design principle of sheep Lrh-1 gene, designs single-stranded oligonucleotide with short hairpin RNA structure according to target sequence, inserts into pENTR/U6 carrier fused with green fluorescence into double-stranded oligonucleotide by denaturation annealing, constructs pENTR/U6-shRNA-GFP interference carrier. The method is characterized in that the gene is transfected into the Hu sheep ovary granular cells, and the real-time fluorescent quantitative PCR method is utilized to detect the mRNA level, so that the Lrh-1-shRNA interference vector can be proved to be capable of effectively inhibiting the expression of the Lrh-1 gene in sheep somatic cells.

Description

Sheep Lrh-1 short hairpin RNA and interference vector thereof

Technical Field

The invention relates to the field of bioengineering, in particular to sheep Lrh-1 short hairpin RNA and an interference vector thereof.

Background

Liver receptor homolog-1 (Liver receptor homolog-1, lrh-1) is a mammalian important nuclear receptor and belongs to the 2 nd member of the NR5A subfamily of the superfamily of nuclear receptors, also known as NR5A2, expressed in various tissues of the heart, stomach, lung, brain, gall bladder, exocrine pancreas, salivary gland, intestine, ovary, fat, bladder, testis, adrenal gland, placenta, etc. of animals. Lrh-1 mainly uses a transcription regulating factor to execute its function, and can regulate and control the expression of several proteins in different tissues in different periods so as to affect the development and physiological and biochemical functions of these tissues, and has important functions in the processes of animal embryo development, differentiation, cholesterol metabolism, dynamic balance of bile acid, steroid hormone production, cell transfer and invasion of breast cancer and tissue inflammation reaction, etc.

RNA interference (RNAi) phenomenon is an evolutionarily conserved defense mechanism against transgenic or foreign virus attacks. After double strand RNA (dsRNA) having a sequence homologous to the mRNA of the transcription product of the target gene is introduced into a cell, the mRNA can be specifically degraded, thereby generating a corresponding functional phenotype deletion. The advent of RNA interference technology has made it possible to specifically silence target genes in a specific manner and has become a powerful tool for the treatment of diseases and the study of gene function. At present, RNAi technology opens up a new research field of life sciences, and becomes a research hotspot and leading edge of international life sciences in the 21 st century.

In order to reversely and deeply study the functions of the Lrh-1 gene in sheep cells, interference, silencing, knocking-down or knocking-out of the Lrh-1 gene is required, but no report of knocking-out or knocking-down of the Lrh-1 gene is currently seen.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide sheep Lrh-1 short hairpin RNA and its interference vector, which can produce good knockdown effect on target gene Lrh-1.

The sheep Lrh-1 short hairpin RNA provided by the invention has sense strand 5 '. Fwdarw.3' comprising sequence A, stem-loop sequence 1 and sequence B which are connected in sequence; wherein, the sequence A is reversely complementary with the sequence B; the sequence A is shown in any one of SEQ ID NO 1-3.

The sheep Lrh-1 short hairpin RNA provided by the invention has an antisense strand 5 '. Fwdarw.3' comprising a sequence A, a stem-loop sequence 2 and a sequence B which are sequentially connected; the stem-loop sequence 2 is reverse complementary to the stem-loop sequence 1.

In the sheep Lrh-1 short hairpin RNA provided by the invention, the sequence A in the antisense strand and the sequence B in the sense strand are identical.

In some embodiments, the sequence A is GCACGGACTTACACCTATTGT (SEQ ID NO: 1) and the sequence B is ACAATAGGTGTAAGTCCGTGC (SEQ ID NO: 10);

in some embodiments, the sequence A is GGAATAAGTTCGGGCCCATGT (SEQ ID NO: 2) and the sequence B is ACATGGGCCCGAACTTATTCC (SEQ ID NO: 11);

in some embodiments, the sequence A is GCACAGGAATTGGTGGCAAAG (SEQ ID NO: 3) and the sequence B is CTTTGCCACCAATTCCTGTGC (SEQ ID NO: 12);

the 5' ends of the sense strand and the antisense strand of sheep Lrh-1 short hairpin RNA provided by the invention are connected with connectors, and the connector sequence of the sense strand is CACC; the linker sequence of the antisense strand is AAAA.

In the sheep Lrh-1 short hairpin RNA provided by the invention, the nucleic acid sequence of the stem-loop sequence 1 is CGAA. The nucleic acid sequence of the stem-loop sequence 2 is TTCG.

In some embodiments, the sheep Lrh-1 short hairpin RNA sense strand has a nucleic acid sequence shown in SEQ ID NO. 4 and the antisense strand has a nucleic acid sequence shown in SEQ ID NO. 5;

or the nucleic acid sequence of the sense strand is shown as SEQ ID NO. 6, and the nucleic acid sequence of the antisense strand is shown as SEQ ID NO. 7;

or the nucleic acid sequence of the sense strand is shown as SEQ ID NO. 8, and the nucleic acid sequence of the antisense strand is shown as SEQ ID NO. 9.

The invention also provides ds Oligo synthesized by annealing the sense strand and the antisense strand of the invention.

Specifically, the invention provides ds Oligo formed by annealing the sense strand shown in SEQ ID NO. 4 and the antisense strand shown in SEQ ID NO. 5.

Or dsOligo formed by annealing the sense strand shown in SEQ ID NO. 6 and the antisense strand shown in SEQ ID NO. 7.

Or dsOligo formed by annealing the sense strand shown in SEQ ID NO. 8 and the antisense strand shown in SEQ ID NO. 9.

The invention also provides an interference vector of sheep Lrh-1 gene, which comprises a framework vector and the ds Oligo.

In the embodiment of the invention, the skeleton carrier is pENTR/U6-shRNA-GFP.

In some embodiments, the ds Oligo is inserted into the backbone vector at BamHI and EcoRI sites.

The invention also provides a method for knocking down sheep Lrh-1 gene, which uses the interference vector to transfect a receptor. The transfection adopts a liposome transfection method. The receptor is an animal cell or sheep ovary granulosa cell. In particular 293T cells or Hu sheep ovary granulosa cells.

The invention also provides a cell line with the Lrh-1 gene knocked down, which is obtained by transfecting cells with the interference vector.

A kit for knocking down sheep Lrh-1 gene comprising said short hairpin RNA, said ds Oligo or said interfering vector.

The kit also comprises a transfection reagent.

The invention constructs Lrh-1 short hairpin RNA and constructs an interference vector of Lrh-1 gene, specifically, the invention screens out a target sequence according to cDNA sequence and design principle of sheep Lrh-1 gene, designs single-stranded oligonucleotide with a short hairpin RNA structure according to the target sequence, inserts the single-stranded oligonucleotide into pENTR/U6 vector fused with green fluorescence after denaturation annealing to form pENTR/U6-shRNA-GFP interference vector. The method is characterized in that the gene is transfected into the Hu sheep ovary granular cells, and the real-time fluorescent quantitative PCR method is utilized to detect the mRNA level, so that the Lrh-1-shRNA interference vector can be proved to be capable of effectively inhibiting the expression of the Lrh-1 gene in sheep somatic cells. The interference vector realizes accurate targeting of sheep somatic cell genome, and provides effective experimental research technological basis for further researching the relationship between Lrh-1 gene and other gene functions in sheep somatic cells.

The invention has at least one of the following advantages and effects:

(1) RNA (Lrh-1-shRNA) short hairpin interference vector can be directly used for transfecting sheep cells, specifically inhibiting Lrh-1 gene expression and carrying out RNAi experiments.

(2) The RNA (Lrh-1-shRNA) interference vector is fused with a GFP tag, so that the transfection efficiency can be intuitively monitored under a fluorescence microscope.

(3) The construction of RNA (Lrh-1-shRNA) interference vector provides convenience for the in-depth research of sheep Lrh-1 gene function.

Drawings

FIG. 1 shows shRNA designed according to the present invention;

FIG. 2 shows an interference vector pattern of the present invention;

FIG. 3 shows cell transfection pictures;

FIG. 4 shows the amplification curve (a) and the dissolution curve (b) of GAPDH gene;

FIG. 5 shows the amplification curve (a) and the dissolution curve (b) of the Lrh-1 gene.

Detailed Description

The invention provides sheep Lrh-1 short hairpin RNA and an interference vector thereof, and a person skilled in the art can properly improve the technological parameters by referring to the content of the text. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that the invention can be practiced and practiced with modification and alteration and combination of the methods and applications herein without departing from the spirit and scope of the invention.

The instrument adopted by the invention is a common commercial product and can be purchased in the market.

The invention is further illustrated by the following examples:

EXAMPLE 1Lrh-1 high expression vector construction

1. Materials: pMD18-T vector, oligo DNA, competent cells DH 5. Alpha., playinum PfxDNAnolymerase, platinumTaqDNAPolymerase High Fidelity, quick cut restriction endonuclease: bamH I and EcoR I, T4 DNA ligase.

2. Method of

1) The gene sequence (JN 662490.1) of sheep Lrh-1 in GenBank was analyzed to examine the presence or absence of particularly complex secondary structure and repetitive sequence linkage in the gene.

2) The single-strand oligo was designed and synthesized based on the results of the gene sequence analysis.

3) The synthesized oligo was spliced into a complete gene sequence by PCR.

4) The synthesized sequence is loaded into a pMD18-T vector and transformed into competent cells DH5 alpha.

5) Sequencing to verify if the inserted sequence in the recombinant clone is consistent with the requirement.

6) The mutation points in the gene sequence were repaired by overlap PCR.

7) The constructed pMD18T-Lrh-1 was digested with BamH I and EcoR I to recover an about 1.5kb fragment. The cleavage system is shown in Table 1:

TABLE 1 enzyme digestion system

Plasmid pMD18T-Lrh-1 (150 ng/. Mu.l)	10μl
		BamH I	1μl
EcoR I	1μl
		10×Q.cut Buffer	5μl
ddH ₂ O	33μl

8) pcDNA3.1 (+) was digested with BamHI and EcoRI and recovered. The cleavage system is shown in Table 2:

TABLE 2 enzyme digestion system

pcDNA3.1 (+) (about 150 ng/. Mu.l)	6μl
		BamH I	1μl
EcoR I	1μl
		10×Q.cut Buffer	5μl
ddH ₂ O	37μl

9) The digested vector pcDNA3.1 (+) and the fragment Lrh-1 are connected by T4 DNA ligase, competent cells DH5 alpha are transformed, a plurality of clones are selected, a plasmid is prepared by small-scale extraction, and sequencing verification is carried out.

The connection system is shown in Table 3:

table 3 connection system

10×Ligation buffer	1μl
		Restriction enzyme digestion of DNA fragments	3.0μl
Enzyme cutting carrier	1.0μl
		T4 DNA Ligase(10U/μl)	0.5μl
ddH ₂ O	4.5μl

EXAMPLE 2 interference vector construction

1. Materials: shRNA oligos, linearization vector: pENTR/U6-shRNA-GFP, 10 Xannealing reaction buffer, T4 DNA Ligase, competent cell DH 5. Alpha

2. The method comprises the following steps:

1) Short hairpin 3 shrna oligos were designed based on sheep Lrh-1 gene sequence in GenBank (JN 662490.1) (fig. 1).

2) The CGAA sequence in the middle of the Oligo sense strand and the TTCG sequence in the middle of the antisense strand are short hairpin RNA stem loop structures. The 5 'end of the sense strand template, CACC, and the 5' end of the antisense strand template, AAAA, are designed for the adaptor when ligated to the shuttle plasmid.

3) The synthesized oligos were annealed to form a double strand, and the system was as follows:

TABLE 4 annealing System

Top strand DNA oligo(200μM)	5μl
		Bottomstrand DNA oligo(200μM)	5μl
10×Oligo Annealing Buffer	2μl
		DNase/RNase-Free Water	8μl
Total volume	20μl

4) Reacting for 4min at 95 ℃, and then standing for 5-10 min at room temperature;

5) Diluting the reaction product with deionized water by 100 times to make the final concentration of the double-chain oligo mixture be 500nM;

6) 500nM ds oligo mixture was diluted to a final concentration of 10nM with Oligo Annealing Buffer.

7) The system of the ligation vector and ds Oligo is as follows:

table 5 connection system

8) After 2h connection at 16 ℃, the mixture is transformed into competent cells DH5 alpha;

9) The vector (map is shown in FIG. 2): (1) prokaryotic resistance: kan (2) eukaryotic screening resistance: zeocin (3) expressed GFP fluorescent protein (4) ds oligo was inserted at BamH I and EcoR I cleavage sites. (5) The plasmid vector containing the ds oligo shown in the No.1 group was SR51, the plasmid vector containing the ds oligo shown in the No.2 group was SR362, and the plasmid vector containing the ds oligo shown in the No.3 group was SR1159.

10 Sequencing to verify if the interfering vector is correct.

Example 3 evaluation of interference vector knockdown Effect

1. Materials: high expression plasmid: pcDNA3.1 (+) -Lrh-1, shRNA interfering plasmid: SR51, SR362, SR1159 and negative controls, 293T cells, DMEM high sugar medium, fetal bovine serum FBS, transfection reagents: lipofectamine2000, endotoxin removal large extraction kit, reverse transcription kit and SYBR qPCR Mix

2. Method of

1) And preparing the reduction plasmid to be transfected by large extraction (refer to the operation of the endotoxin removal large extraction kit instruction manual).

2) 293T cells were cultured and 6 well plates were spread to achieve a cell density of about 90% the next day.

3) Transfection: the high expression plasmid and the interfering plasmid were co-transfected with lipofectamine2000 and were grouped as follows:

TABLE 6 transfection grouping

Grouping	High-level watchDali plasmid Lrh-1	Interference carrier	Lipofectamine2000
				SR51 group	1μg Lrh-1	3μg SR51	10μl
SR362 group	1μg Lrh-1	3μg SR362	10μl
				SR1159 group	1μg Lrh-1	3μg SR1159	10μl
NC group	1μg Lrh-1	3μg SR-NC	10μl
				Blank group	0	0	0

4) After 48h, the cells were collected, RNA was extracted, reverse transcribed to cDNA, and qPCR was performed to detect the level of expression of the gene of interest Lrh-1. (detailed procedures of reverse transcription and qPCR refer to kit procedure)

TABLE 7 primer information for qPCR

Primer name	Sequence (5'>3’)
		Lrh-F	CTCAAGGTGGATGACCAAATGA(SEQ ID NO:13)
Lrh-R	TTGCCCAGTAACCAGGAAGAT(SEQ ID NO:14)
		GAPDH-F	AGAAGGCTGGGGCTCATTTG(SEQ ID NO:15)
GAPDH-R	AGGGGGCCATCCACAGTCTTC(SEQ ID NO:16)

3. Results

(1) Cell transfection pictures are shown in FIG. 3

(2) qPCR screening results: the amplification and dissolution curves of GAPDH gene are shown in FIG. 4 and Lrh-1 gene in FIG. 5

(3) qPCR data and calculation results are shown in table 8:

table 8qPCR data and calculation results

Sample name	2 ^-ΔΔct	Interference efficiency
			SR51 group	0.641967223	35.80％
SR362 group	2.110930312	Without any means for
			SR1159 group	0.234590083	76.54％
NC group	1	0

As can be seen from the above table, SR51 and SR1159 have certain knockdown effect on the target gene Lrh-1, wherein the knockdown efficiency is best SR1159 and is 76.54%, so that the interference plasmid can be selected for downstream experiments.

Example 4 verification of knockdown Effect of interfering vectors in sheep somatic cells

4.1 collecting ovary granulosa cells of sheep (Hu sheep)

Preparing physiological saline at 37-38 ℃, adding gentamicin and green streptomycin, and placing into a thermos bottle for standby. Fresh and complete ovaries of Hu sheep are taken and placed in a vacuum flask and sent to a laboratory within 3 hours.

4.2 collecting and culturing ovary granulosa cells

1) Washing ovary with physiological saline for 5-8 times in ultra clean bench, removing blood and impurities, and stripping ovary membrane. 1mL of DPBS solution containing 1% serum was aspirated first with a 10mL syringe, followed by aspiration of follicular fluid from healthy follicles of 2-5 mm diameter.

2) Centrifuge at 500 Xg for 5min at room temperature, discard supernatant and wash the pellet with PBS 2 times.

3) The supernatant was discarded, and 500. Mu.L of 0.3% hyaluronidase was added to the pellet to digest it for 2min, and the pellet was dispersed by pipetting.

4) Centrifuge at 500 Xg for 3min at room temperature, discard supernatant and wash the pellet 2 times with PBS.

5) The cells were resuspended in a T75 cell culture flask at 37℃in a 5% carbon dioxide incubator by centrifugation at 500 Xg at room temperature for 3min, the supernatant was discarded, and the cells were incubated in a pre-warmed 10mL cell culture medium.

4.3 transfection of the interference vector Lrh-1-shRNA into granulosa cells

Plasmid SR1159 with relatively optimal transfection effect is selected for transfection of Hu sheep granulosa cells, and the experimental operation method is the same as that of example 3, and the experiment is repeated three times and is respectively marked as Lrh-1 knockout 1, lrh-1 knockout 2 and Lrh-1 knockout 3.

4.4 detection of Lrh-1mRNA expression in granulosa cells

And (3) taking the Lrh-1 knockout 1-3 cells prepared in the step (4.3) as a sample to be detected, and repeatedly detecting each group of cells. The detection was performed using GAPDH as a control. Control cells were arranged in three groups, each of which was tested in triplicate.

4.4.1 RNA extraction from granulosa cells

Pressing the buttonPlus RNA Purification Kit (Invitrogen cat# 12183-555) the kit requires handling and then storage at-80℃for use.

4.4.2 reverse transcription experiments

(1) Reagent: superScript ^TM III First-Strand Synthesis SuperMix for qRT-PCR

(Invitrogen cat# 11752-050)

(2) Instrument: constant temperature metal bath (domestic)

(3) Operating procedure

Table 9:1st-Strand cDNA Synthesis reaction System and conditions

4.4.3real-Time PCR detection

(1) Reagent: powerGreen PCRMaster Mix (Roche goods number 4913914001)

(2) Instrument: quantum multiple real-time fluorescent quantitative PCR instrument (American life technologies company)

(3) Experimental procedure

(1) Fluorescent quantitative PCR primer design and synthesis

Quantitative PCR Primer design was performed using Primer Premier 6.0 and Beacon designer 7.8 software, and then synthesis was performed with the following Primer sequences:

table 10: real-Time PCR Primers and Conditions

(2) Real-Time PCR amplification system and reaction conditions

Table 11: quantitative PCR reaction system and conditions

(3) Real-Time PCR gene expression difference statistical analysis

Each sample was repeated three times, and the relative expression level of each gene was expressed at 2 (Ct ^{Reference gene} -Ct ^{Target gene} ) Statistical analysis was performed.

4.4.4Lrh-1 quantitative results

TABLE 12 quantitative results

Experimental results show that the constructed Lrh-1-shRNA interference vector can effectively knock down the expression of the Lrh-1 gene in the Hu sheep somatic cells.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> Jiangsu agricultural and grazing science and technology academy of professions

<120> sheep Lrh-1 short hairpin RNA and interference vector thereof

<130> MP1934713

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gcacggactt acacctattg t 21

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ggaataagtt cgggcccatg t 21

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gcacaggaat tggtggcaaa g 21

<210> 4

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

caccgcacgg acttacacct attgtcgaaa caataggtgt aagtccgtgc 50

<210> 5

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

aaaagcacgg acttacacct attgtttcga caataggtgt aagtccgtgc 50

<210> 6

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

caccggaata agttcgggcc catgtcgaaa catgggcccg aacttattcc 50

<210> 7

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

aaaaggaata agttcgggcc catgtttcga catgggcccg aacttattcc 50

<210> 8

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

caccgcacag gaattggtgg caaagcgaac tttgccacca attcctgtgc 50

<210> 9

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

aaaagcacag gaattggtgg caaagttcgc tttgccacca attcctgtgc 50

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

acaataggtg taagtccgtg c 21

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

acatgggccc gaacttattc c 21

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

ctttgccacc aattcctgtg c 21

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

ctcaaggtgg atgaccaaat ga 22

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

ttgcccagta accaggaaga t 21

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

agaaggctgg ggctcatttg 20

<210> 16

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

agggggccat ccacagtctt c 21

Claims

1. Sheep Lrh-1 short hairpin RNA,

the nucleic acid sequence of the sense strand is shown as SEQ ID NO. 8,

the nucleic acid sequence of the antisense strand is shown in SEQ ID NO. 9.

2. A ds Oligo synthesized by annealing the sense strand and the antisense strand of the short hairpin RNA of claim 1.

3. An interfering vector of sheep Lrh-1 gene, comprising a backbone vector and the ds Oligo of claim 2.

4. The interfering vector of claim 3, wherein the backbone vector is pENTR/U6-shRNA-GFP.

5. A method of knocking down sheep Lrh-1 gene, wherein the interfering vector of claim 3 or 4 is used to transfect a receptor.

6. A kit for knocking down sheep Lrh-1 gene comprising the short hairpin RNA of claim 1, the ds Oligo of claim 2, or the interfering vector of claim 3 or 4.