CN101974562B - Application of chromatin remodeled protein 4A (CHMP4A) in enhancing stability and transcriptional activity of hypoxia-inducible factor 1alpha (HIF-1alpha) - Google Patents
Application of chromatin remodeled protein 4A (CHMP4A) in enhancing stability and transcriptional activity of hypoxia-inducible factor 1alpha (HIF-1alpha) Download PDFInfo
- Publication number
- CN101974562B CN101974562B CN2010102951906A CN201010295190A CN101974562B CN 101974562 B CN101974562 B CN 101974562B CN 2010102951906 A CN2010102951906 A CN 2010102951906A CN 201010295190 A CN201010295190 A CN 201010295190A CN 101974562 B CN101974562 B CN 101974562B
- Authority
- CN
- China
- Prior art keywords
- hif
- chmp4a
- cell
- 1alpha
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an application of a chromatin remodeled protein 4A (CHMP4A) in promoting growth of tumour cells, in particular to an application of CHMP4A in enhancing the stability and transcriptional activity of a hypoxia- inducible factor 1alpha(HIF-1alpha) and an application thereof in screening a lead compound capable of inhibiting growth of tumour cells. In the invention, a cis-reporter gene screening system is adopted to find that CHMP4A can obviously enhance the stability and transcriptional activity of the hypoxia-inducible factor 1alpha in a Hela cell.
Description
Technical field
The present invention relates to Chromatin Remodeling albumen 4A (CHMP4A) application in promoting growth of tumour cell, particularly CHMP4A and strengthen the application in oxygen deficient induction factor 1 α (HIF-1 α) stability and the transcriptional activity; And the application of CHMP4A in screening the lead compound that can suppress growth of tumour cell.
Background technology
Tumor hypoxia is the solid tumor common phenomenon, and anoxic can trigger body and produce a series of acute protective reactions of answering, and makes tumour cell adapt to the anoxic microenvironment.Oxygen deficient induction factor 1 (hypoxia inducible factor 1; HIF-1) be to find the transcription factor the closest so far with the anoxic relation; Form heterodimer (for example referring to .The structrure such as Ye Hong, function, regulation and the relation to the hypoxia signal transduct ofhypoxia inducible factor 1.Progress Of Physiology science by α subunit and β subunit; 2001,32 (1): 62-64).In recent years, HIF-1 α is in the generation of tumour, and invasion and attack are survived, and the aborning crucial regulating and controlling effect of resistance receives people's attention day by day.The experiment proof has 13 kinds of high expression levels that HIF-1 α occurs in people's parenchyma of 19 types, especially in colorectal carcinoma, and lung cancer, in the prostate cancer, the high expression level of HIF-1 α accounts for more than 90%.In corresponding healthy tissues, then there is not expression.Its result shows high expression level and tumour pernicious of HIF-1 α; Clinical stages; Infiltration and transfer have tangible dependency (for example referring to Over-expression of hypoxia-inducible factor 1 α in common human cancers and their metastasis.Cancer Res such as Zhong H; 1999,8 (59): 5830-5839).Therefore, the monitoring of the expression level of HIF-1 α helps the early diagnosis of tumour, judge the grade malignancy of tumour and patient's prognosis, and HIF-1 α has become the important target of an oncotherapy.The micromolecular compound that external existing report utilizes the two luciferase reporter genes of HRE-LUC to screen to suppress the oxygen deficient induction factor 1 alpha active as new candidate's cancer therapy drug (for example referring to Giovanni Melillo.Identification of Small Molecule Inhibitors of Hypoxia-inducible Factor 1 Transcriptional Activation Pathway.Cancer Research.; 2002,4316-4324.; Identification of novel small molecule inhibitors of hypoxia-inducible factor-1 that differentially block hypoxia-inducible factor-1 activity and hypoxia-inducible factor-1alpha induction in response to hypoxic stress and growth factor.Cancer Research.2005 such as Chau NM, 65 (11): 4918-4928).But utilizing this system to screen the protein polypeptide that influences oxygen deficient induction factor 1 does not appear in the newspapers.
The inventor has made up the screening system that is used to screen the correlation function gene of participating in the tumor hypoxia reaction; When utilizing said screening system to carry out high flux screening, find that surprisingly Chromatin Remodeling albumen 4A can strengthen oxygen deficient induction factor 1 α (HIF-1 α) stability and transcriptional activity.
Human chromatin is reinvented albumen 4A and yeast Snf7p albumen homology, belongs to little cyclic coil (small coil-coiled) protein family.The research in early stage shows that this albumen is relevant with the formation of multivesicular body in the cell, and the degraded of participating in the cell endocytic membrane receptor is (for example referring to .Structure and function of human Vps20 and Snf7 proteins. such as Peck JW
Biochem J, 2004,377 (Pt 3): 693-700.; A systematic analysis of human CHMP protein interactions:additional MIT domain-containing proteins bind to multiple components of the human ESCRT III complex.Genomics.2006 such as Tsang HT, 88 (3): 333-346.).Still there is not the relation of itself and cell hypoxia and to the protein stability of oxygen deficient induction factor 1 α and the influence report of transcriptional activity.
Tumour cell is under the anoxybiotic situation; Hypoxia inducible increase protein stabilized because of 1 α and transcriptional activity can cause tumour cell tolerance anaerobic environment; Erosional competency strengthens; Therefore reinvent the next oxygen deficient induction factor 1 α that suppresses indirectly of activity of albumen 4A through suppressing human chromatin, can reach the purpose that suppresses growth of tumour cell.
Summary of the invention
It is the application of the Chromatin Remodeling albumen 4A shown in the SEQ ID NO:2 in promoting growth of tumour cell that one object of the present invention is to provide aminoacid sequence.
Preferably, said Chromatin Remodeling albumen 4A can strengthen stability and the transcriptional activity of oxygen deficient induction factor 1 α (HIF-1 α) in tumour cell.
Said tumour cell is the solid tumor of HIF-1 α high expression level, comprises myelomatosis, lymphoma, brain tumor, spinal cord knurl, kidney, lung cancer, colorectal carcinoma, bladder cancer, liver cancer, prostate cancer, mammary cancer, ovarian cancer and carcinoma of the pancreas.Said tumour cell is preferably the Hela cell.
It is the application of the Chromatin Remodeling albumen 4A shown in the SEQ ID NO:2 in screening the material that can suppress growth of tumour cell that another object of the present invention is to provide aminoacid sequence.
Thereby the said material that can suppress growth of tumour cell can be reinvented stability and the transcriptional activity that albumen 4A suppresses oxygen deficient induction factor 1 α (HIF-1 α) through suppressing human chromatin.
Can utilize Chromatin Remodeling albumen 4A of the present invention to screen the solid tumor of the tumour cell of growth of tumour cell suppressor factor, comprise myelomatosis, lymphoma, brain tumor, spinal cord knurl, kidney, lung cancer, colorectal carcinoma, bladder cancer, liver cancer, prostate cancer, mammary cancer, ovarian cancer and carcinoma of the pancreas for HIF-1 α high expression level.Said tumour cell is preferably the Hela cell.
Another object of the present invention provides a kind of screening system that is used to screen the material that influences oxygen deficient induction factor 1.Said screening system comprises plasmid pHRE-LUC, pRL-TK-LUC and pCDB-HIF-1 α.
Another object of the present invention provides a kind of protein polypeptide that above-mentioned screening system is screened can influence oxygen deficient induction factor 1 that utilizes.Said screening system comprises plasmid pHRE-LUC, pRL-TK-LUC and pCDB-HIF-1 α.
Description of drawings
The structure collection of illustrative plates of Fig. 1 HRE-LUC.
The structure collection of illustrative plates of Fig. 2 pCDB-HIF-1 α.
The enzyme of Fig. 3 HIF-1 α eukaryon expression plasmid is cut evaluation.
The active genes involved of Fig. 4 scale selection HRE-Luc.
Fig. 5 CHMP4A is to the activation of the relative luciferase activity of HRE-LUC.
Fig. 6 immunity marking (Western blot) detects the influence of CHMP4A to HIF-1 α stability.
Fig. 7 RT-PCR detects the influence of CHMP4A to Myokinase (AK3).
Embodiment
Screening system of the present invention
Participate in the correlation function gene of tumor hypoxia reaction for high flux screening; We to the MCS of luciferase reporter gene carrier, have made up the carrier pHRE-LUC (shown in accompanying drawing 2) that contains reporter gene HRE-LUC with cis response element HRE (Hypoxia-responsible element) sequence construct of HIF-1 α.With pHRE-LUC transfection Hela cell; Cotransfection confidential reference items plasmid pRL-TK-LUC (thymidine kinase romoter-Renilla luciferase) are so that normalization data simultaneously; The error that the survival of elimination cell and the transfection efficiency of cell cause experiment, the safety of increase data.Simultaneously, transfection pCDB-HIF-1 α is as positive control.Screening strengthens the active human functional gene of Hela cell HRE-LUC under normal oxygen concentratio, and screening suppresses the active human functional gene of Hela cell HRE-LUC under NSC 51149 chemical simulation anoxia condition.Utilize this screening system; The Human genome of this laboratory being cloned 409 unknown function that obtain has carried out the mass-producing cell screening under normal oxygen and the NSC 51149 chemical simulation anoxia condition, obtains a gene C HMP4A (embodiment 3) who obviously strengthens the relative luciferase activity of HRE-LUC.
Further protein immunization marking result shows that expressing excessively of CHMP4A can obviously increase HIF-1 α protein content (embodiment 5) in the cell, and RT-PCR presentation of results CHMP4A can obviously strengthen the transcriptional level (embodiment 6) of HIF-1 downstream target gene Myokinase 3.
Said HRE (Hypoxia Response Element; Weary oxygen response element) be one section promotor or enhancer sequence; Express with raising several genes after HIF-1 combines,, thereby strengthened picked-up and the glycolysis of tumour cell glucose like EPO, iNOS, VEGF etc.; Promote the vascularization and the cell proliferation of tumour, make tumour cell have more invasion and attack and the resistance ability of chemicotherapy.
Various plasmids among the present invention can prepare by known by one of ordinary skill in the art the whole bag of tricks.For example, PCR can amplify the purpose fragment, utilizes molecule clone technology that it is building up on the carrier.
Because screening system of the present invention can be screened protein stability and the influential gene of transcriptional activity to oxygen deficient induction factor 1 α, therefore growth and the mechanism of oxygen deficient induction factor 1 α in growth of tumour cell to the research tumour cell has meaning.
Chromatin Remodeling albumen 4A
In the present invention, CHMP4A comprises CHMP4A gene or CHMP4A albumen etc.Said CHMP4A albumen is the aminoacid sequence shown in SEQ ID NO:2, and it has 265 amino acid.Said CHMP4A gene is the polynucleotide sequence of coding SEQ ID NO:2 of the present invention; It can be amino acid whose encoding sequence shown in the SEQ ID NO:2; Perhaps except the encoding sequence of above-mentioned aminoacid sequence; Can also comprise non-coding sequence, for example intron, encoding sequence 5 ' or the non-coding sequence of 3 ' end etc.Said polynucleotide sequence can be DNA or RNA, and wherein DNA comprises cDNA, genomic dna and synthetic DNA.Wherein preferred gene is the polynucleotide shown in the SEQID NO:1, and 1505 Nucleotide of its sequence total length, encoding sequence are the 412nd~1209 Nucleotide.Perhaps, more preferably a kind of isolating nucleotide sequence, it comprises coding CHMP4A protein sequence, the for example encoding sequence shown in the SEQ ID NO:1: Nucleotide 412~1209.Those of ordinary skills are known, and the nucleotide sequence of CHMP4A of the present invention can be entirely identical to the encoding sequence shown in SEQ ID NO:1, also can not exclusively be equal to the encoding sequence of above-mentioned Nucleotide owing to the degeneracy of genetic code.
CHMP4A nucleotide sequence of the present invention can establishing criteria the pcr amplification technology with cDNA, mRNA or genomic dna as template, and choose suitable Oligonucleolide primers amplification and obtain.The polynucleotide that obtain like this can be cloned in the suitable carriers, and carry out sequence description with the DNA analysis technology.Also can obtain through the standard DNA synthetic technology.CHMP4A albumen of the present invention can obtain through ordinary method; For example through transformed host cell and after being grown into suitable cell density by transformed host cells; With appropriate means (inducing) evoked promoter, continue then to cultivate like temperature variation or chemical speciality.After cultivating completion, available centrifuging collecting cell, and with any known method, like freeze-thaw method, supersound process method, N,O-Diacetylmuramidase dissolution method or mechanical crushing method smudge cells.Can use various known methods from the host cell culture, to reclaim and purifying CHMP4A albumen of the present invention, these methods comprise ammonium sulfate or ethanol precipitation, acid extraction method, ultrafiltration process, ion exchange chromatography, phosphoric acid fiber chromatography, hydrophobic interaction chromatography method, gel filtration method, affinity chromatography and high pressure fluid column chromatography.
The application of CHMP4A of the present invention in screening tumor growth suppressor factor
Because CHMP4A of the present invention can strengthen the transcript and expression of oxygen deficient induction factor 1 α (HIF-1 α) in tumour cell; And promotion growth of tumour cell; Therefore can be with this Chromatin Remodeling albumen 4A as the novel targets that suppresses growth of tumour cell; The gene or the albumen that suppress CHMP4A of the present invention for example are provided, are used to treat tumour.The present invention reinvents the purpose that the next inhibition indirectly of the activity oxygen deficient induction factor 1 α of albumen 4A reaches the inhibition growth of tumour cell through suppressing human chromatin.
CHMP4A of the present invention can promote the growth of Hela cell; Embodiments of the invention prove that this promoter action is to realize through the transcript and expression that strengthens HIF-1 α; Thereby CHMP4A can promote the growth of the solid tumor of HIF-1 α high expression level, for example myelomatosis, lymphoma, brain tumor, spinal cord knurl, kidney, lung cancer, colorectal carcinoma, bladder cancer, liver cancer, prostate cancer, mammary cancer, ovarian cancer and carcinoma of the pancreas.
Because CHMP4A of the present invention can strengthen the transcript and expression of oxygen deficient induction factor 1 α (HIF-1 α) in tumour cell; And the promotion growth of tumour cell, therefore can utilize this Chromatin Remodeling albumen 4A to screen can be the material that target spot suppresses growth of tumour cell with Chromatin Remodeling albumen 4A.
Screening can be carried out through the downstream gene that detects CHMP4A, also can carry out through detecting CHMP4A albumen itself.
Can utilize downstream gene that any method known in the art detects CHMP4A of the present invention for example Myokinase (AK3) for example detect, for example reverse transcription PCR (RT-PCR) in the expression of nucleic acid level through being derived from PCR method.These analytical technologies comprise DNA or rna blot analysis and polymerase chain reaction.These analyze the situation that both can disclose CHMP4A expression amount aspect indirectly.Also can detect the oxygen deficient induction factor 1 alpha expression level that CHMP4A of the present invention influences at protein level.
The present invention also provides the primer that detects CHMP4A downstream AK3 genes, with and the expression of the oxygen deficient induction factor 1 α that influenced.Shown in said primer such as the embodiment 6.
Detection method also is known in the art; For example utilize the monoclonal antibody or the polyclonal antibody of oxygen deficient induction factor 1 α protein-specific of the present invention, utilize direct or indirect EUSA, immunofluorescence technique, the immune marking, immunohistochemistry etc. to detect.Immunoblotting is that existence is descended high-resolution polyacrylamide gel electrophoresis (PAGE) that antigen is varied in size according to its molecular weight and effectively is divided into many zone of protein by sodium lauryl sulphate (SDS); Protein band after separating is transferred on a kind of solid support such as nitrocellulose membrane or the pvdf membrane through different approaches; Be probe then with antibody; With the target protein epitope generation specific reaction that is attached to solid support, be incorporated into the antibody available enzyme target two anti-detections such as SA of solid support like SEAP or horseradish peroxidase.Immunoblotting can identify agnoprotein and molecular mass thereof in the mixture.Immunohistochemistry is the antigen antibody reaction of in tissue slice, carrying out, and can detect content and the location of antigen in tissue.
The gene of CHMP4A of the present invention or albumen can be used as the target that suppresses growth of tumour cell.Therefore, can utilize method or their combinations such as two report detection meanss, reverse transcription-polymerase chain reaction (RT-PCR), the immune marking, the expression of CHMP4A in the antimer indirectly.
Further illustrate the present invention below in conjunction with specific embodiment.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, according to the condition of normal condition described in " molecular cloning experiment guide " (third edition [U.S.A] Sa nurse Brookers in 2002 etc. work, Science Press), or the condition of advising according to manufacturer.Do not indicate the reagent and all commercially available acquisition of material in source among the embodiment.
The structure of embodiment 1 reporter gene plasmid (pHRE-LUC)
With erythropoietin (Erythropoietin; EPO), inducible nitric oxide synthase (inducible nitric oxide synthase; INOS), (Vascular endothelial growth factor, VEGF) 3 * HRE sequence of three gene promoter area HRE sequence compositions is synthetic by the living worker in Shanghai for vascular endothelial growth factor.Positive-sense strand (5 '-AGCTGCCCTA CGTGCTGTCT CATGCATACG TGGGCTCCAA CAGGTGACTACGTGCTGCCT AG-3 '; The sticking end sequence that contains HindIII) and antisense strand (5 '-TCGACTAGGCAGCACGTAGT CACCTGTTGG AGCCCACGTA TGCATGAGAC AGCACGTAGGGC-3 '; The sticking end sequence that contains Xho I) is annealed on the pLUC-MCS empty carrier that two strands is connected to HindIII and Xho I double digestion, thereby obtains reporter gene plasmid pHRE-LUC (as shown in Figure 1).
The structure of embodiment 2HIF-1 α eukaryon expression plasmid
Design according to HIF-1 α full length sequence (GenBank NM_001530); Upstream primer (5-GAAGACATCGCGGGGACC-3) and downstream primer (5-GGGGTACCGAAAAAGCTCAGTTAACTTGATC-3) be 2507 bases of pcr amplification total length from human normal tire liver cDNA library, and gel is connected to the T-easy carrier after reclaiming.Be connected on pcDNA3.1/myc-His (-) B (pCDB) that has with restriction enzyme site with Not I single endonuclease digestion then, thereby obtain HIF-1 α eukaryon expression plasmid pCDB-HIF-1 α (Fig. 2).This plasmid size meets calculated value (Fig. 3).
The detection of 3 pairs of luciferase reporting systems of embodiment
The Hela cell routine go down to posterity be incubated at contain 10% foetal calf serum (HyClone, DMEM substratum SH30084.03) (HyClone, SH30022.01B) in, 37 ℃, 5%CO
2Cultivate in the incubator.According to 1.1 * 10
6The density of cell/ml is inoculated in 96 orifice plates, and every hole 100 μ l place incubator to cultivate 18 hours~24 hours, make cell density reach 40%~60%, in order to transfection.To specifications, with 50ng pHRE-LUC, 5ng pRL-TK-LUC and 50ng wait to sieve gene or the control plasmid corotation is gone into the Hela cell to use VigoFect positively charged ion transfection reagent (prestige lattice Lars biotechnology (Beijing) ltd).The cell of transfection pcDNA3.1/myc-His (-) B empty carrier is as blank.The cell of transfection pCDB-HIF-1 α and ING4 gene (ING4 is connected in the PCDB carrier, and is as positive control, similar with the HIF-1a effect) is as activating the positive control that pHRE-LUC expresses, and the transfection empty carrier is as suppressing the negative control that pHRE-LUC expresses.Every kind of plasmid to be sieved is established 6 multiple holes.Normal oxygen is cultivated after 28 hours~34 hours and is detected luciferase activity.For suppressing the genescreen that HRE-LUC expresses, the NSC 51149 that adds 250uM in transfection after 18 hours~24 hours is induced conventional the cultivation 10 hours, detects luciferase activity.
(Promega behind specification sheets lysing cell E1960), utilizes multi-functional microwell plate detection system GENios Pro according to two luciferase reporting systems
TM(Tecan) detect luciferase intensity.Each gene to be sieved is provided with 6 multiple holes, and wherein 3 multiple holes are the anoxia condition screening.The relative fluorescent value of the cell of transfection empty carrier contrast pcDNA3.1/myc-His (-) B is made as 100%.The result gets the MV in 3 multiple holes.
The result has screened the influence of 409 relative luciferase activity of gene pairs HRE-LUC referring to Fig. 4 under normal oxygen situation, wherein, empty carrier control group transfection PCDB and pHRE-LUC plasmid, luciferase activity is 1 relatively; Positive controls transfection pCDB-HIF-1 α and pHRE-LUC, luciferase activity is 4 relatively; CHMP4A group transfection CHMP4A (as the nucleic acid that is building up on the PCDB carrier) and pHRE-LUC, luciferase activity is 2.2 relatively.
The relative luciferase activity of embodiment 4 NSC 51149 inductive HRE-LUC
For HRE-LUC and the HIF-1 α bonded specificity of verifying structure; Be contrast with pLUC-MCS empty carrier and positive control plasmid HIF-1 α (pCDB-HIF-1 α); Experiment is divided into following several groups: pHRE-LUC and pCDB corotation group are called for short the PCDB group; PHRE-LUC and HIF-1 α (pCDB-HIF-1 α) corotation group is called for short HIF-1 α group, and HRE-LUC and CHMP4A corotation group are called for short the CHMP4A group and use 250uM NSC 51149 (Sigma company, lot number c8661) to induce respectively 10 hours.
The result behind specification sheets (Promega) lysing cell according to two luciferase reporting systems, utilizes multi-functional microwell plate detection system Tecan GENios Pro referring to Fig. 5
TMDetect luciferase intensity.Each gene to be sieved is provided with 6 multiple holes, and wherein 3 multiple holes are the cell of anoxia condition screening transfection blank pcDNA3.1/myc-His (-) B relative fluorescent value is made as 100%.The result gets the MV in 3 multiple holes.The relative luciferase activity of PCDB group inductive HRE-LUC is than not raising 12.5 ± 0.49 times with the NSC 51149 inductive.The PCDB group does not use the luciferase activity of NSC 51149 inductive HRE-LUC as broad as long yet.And HIF-1 α group does not raise 4 ± 0.7 times with the NSC 51149 inductive than the PCDB group with the relative luciferase activity of NSC 51149 inductive HRE-LUC; The relative luciferase activity of CHMP4A group inductive HRE-LUC does not raise 40 ± 0.8 times with the NSC 51149 inductive than the HRE-LUC group and (adopts one-way analysis of variance; The result has significant difference, P<0.05).The height that how much reaches transcriptional activity of HIF-1 α amount in the reflection cell that HRE-LUC reporter gene plasmid can be special is described.
The proteic amount of HIF-1 α in the embodiment 5Hela cell
The immunity marking detects HIF-1 α expressing quantity in the Hela cell.Require respectively 6ug pCDB, pCDB-HIF-1 α, CHMP4A (being structured in the PCDB carrier) plasmid transfection to be gone in the hole Hela cell of 6 orifice plates according to cultivating separately, extract the nucleoprotein immunity marking after 24 hours and detect HIF-1 α protein level by the transfection reagent specification sheets.Respectively getting about 1,000,000 culturing cells uses 100 μ l cell pyrolysis liquids (1 * PBS, 1%NP40,0.5% Sodium desoxycholate, 0.1%SDS) lysing cell, centrifuging and taking supernatant is used for the immune marking and detects.Carry out electrophoresis, change operations such as film, sealing by the immune marking program of standard.The one anti-anti-people HIF-1 of the rabbit Alpha antibodies that uses above-mentioned purifying, the two anti-goat anti-rabbit antibodies (Santa Cruz) that use the HRP mark.Use the luminous detection test kit of Pierce company to detect.
The result is referring to shown in Figure 6, and each swimming lane is respectively among Fig. 6: 1 PCDB empty carrier, and 2HIF-1 α crosses expression, and 3CHMP4A crosses expression.The top picture is the detection of HIF-1 α, and the lower section picture is the detection of confidential reference items Beta-ACTIN.
Can see that by Fig. 6 CHMP4A obviously increases the proteic amount of HIF-1 α in the Hela cell, and the amount of HIF-1 β and β-actin does not change.
The detection of embodiment 6 Myokinases (AK3)
The Hela cell is laid on six orifice plates (NEST Biotecl with 300,000/hole; 703001) the conventional cultivation 18 hours in; Respectively with 3 μ g pCDB3.1 empty carriers; HIF-1 α, pCDB3.1-CHMP4A use VigoFect (Vigorous company) positively charged ion transfection reagent to change 1 μ g plasmid over to the Hela cell to specifications.Continue to cultivate and to carry RNA by Invitrogen rt test kit specification sheets in 24 hours, rt is cDNA, upstream primer 5-GCTGCTGCGA GCGGTGAT-3; Downstream primer 5-TATTCCAGGA CTGGCTTTGTTTG-3,94 ℃ of pcr amplification conditions, 5 minutes, 94 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 20s, 29 circulations (Fig. 7).The top picture is the detection of Myokinase (AK3), and the lower section picture is the detection of confidential reference items GAPDH.
Can find out that by Fig. 7 positive control HIF-1 α group and CHMP4A group obviously strengthen the AK3 gene transcription level, and the transcriptional level of confidential reference items GAPDH is uninfluenced.
Claims (3)
1. aminoacid sequence is the application of the non-diagnostic purpose of the Chromatin Remodeling albumen 4A shown in the SEQ ID NO:2 in promoting growth of tumour cell; Wherein said tumour cell is the solid tumor of HIF-1 α high expression level, and said solid tumor is myelomatosis, lymphoma, brain tumor, spinal cord knurl, kidney, colorectal carcinoma, bladder cancer, prostate cancer, mammary cancer, ovarian cancer and carcinoma of the pancreas.
2. application as claimed in claim 1, wherein said being applied as strengthens stability and the transcriptional activity of oxygen deficient induction factor 1 α in tumour cell.
3. according to claim 1 or claim 2 application, wherein said tumour cell is the HeLa cell.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010102951906A CN101974562B (en) | 2010-09-28 | 2010-09-28 | Application of chromatin remodeled protein 4A (CHMP4A) in enhancing stability and transcriptional activity of hypoxia-inducible factor 1alpha (HIF-1alpha) |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010102951906A CN101974562B (en) | 2010-09-28 | 2010-09-28 | Application of chromatin remodeled protein 4A (CHMP4A) in enhancing stability and transcriptional activity of hypoxia-inducible factor 1alpha (HIF-1alpha) |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101974562A CN101974562A (en) | 2011-02-16 |
CN101974562B true CN101974562B (en) | 2012-11-14 |
Family
ID=43574470
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2010102951906A Expired - Fee Related CN101974562B (en) | 2010-09-28 | 2010-09-28 | Application of chromatin remodeled protein 4A (CHMP4A) in enhancing stability and transcriptional activity of hypoxia-inducible factor 1alpha (HIF-1alpha) |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101974562B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103146801B (en) * | 2011-12-07 | 2015-04-22 | 上海市普陀区中心医院 | Method for screening anti-intestinal cancer drugs |
CN106520808B (en) * | 2014-09-01 | 2019-09-17 | 深圳市第二人民医院 | The molecular genetic device of special detection bladder cancer cell |
-
2010
- 2010-09-28 CN CN2010102951906A patent/CN101974562B/en not_active Expired - Fee Related
Non-Patent Citations (4)
Title |
---|
Brahimi-Horn M C 等.Harnessing the hypoxia-inducible factor in cancer and ischemic disease.《Biochemical Pharmacology》.2007,第73卷 * |
Luo F M 等.Hypoxia-inducible transcription factor-1α promotes hypoxia-induced A549 apoptosis via a mechanism that involves the glycolysis pathway.《BMC Cancer》.2006,第6卷(第26期), * |
Tsang H T.H. 等.A systematic analysis of human CHMP protein interactions:Additional MIT domain-containing proteins bind to multiple components of the human ESCRT III complex.《Genomics》.2006,第88卷 * |
Yu E Z 等.Antiapoptotic action of hypoxia-inducible factor-1α in human endothelial cells.《Laboratory Investigation》.2004,第84卷 * |
Also Published As
Publication number | Publication date |
---|---|
CN101974562A (en) | 2011-02-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Gleize et al. | C IC inactivating mutations identify aggressive subset of 1p19q codeleted gliomas | |
CN110117657B (en) | Application of circular RNA hsa _ circ _0004872 in gastric cancer diagnosis | |
CN107365785A (en) | The expression vector of NF kB activities and its regulation and control methods and applications in a kind of regulating cell | |
EP3933050A1 (en) | Application of circular rna in preparing drug for treating systemic lupus erythematosus | |
Liu et al. | miR‐340‐5p inhibits sheep adipocyte differentiation by targeting ATF7 | |
Xiong et al. | Cloning and characterization of the human USP22 gene promoter | |
CN112899238B (en) | Compound screening cell model based on RNA-m6A modification level and construction and application thereof | |
CN101974562B (en) | Application of chromatin remodeled protein 4A (CHMP4A) in enhancing stability and transcriptional activity of hypoxia-inducible factor 1alpha (HIF-1alpha) | |
Zhao et al. | Retracted: Tectonic 1 Is a Key Regulator of Cell Proliferation in Pancreatic Cancer | |
CN108841958A (en) | A kind of crRNA and its detection method of detection EGFR gene exon 2 1L858 mutation | |
JPH1084974A (en) | Enhancement of transcription of gene | |
Li et al. | Circular RNA circTIE1 drives proliferation, migration, and invasion of glioma cells through regulating miR-1286/TEAD1 axis | |
Siol et al. | The C-module DNA-binding factor mediates expression of the Dictyostelium aggregation-specific adenylyl cyclase ACA | |
JP6839707B2 (en) | Prevention, diagnosis and treatment of cancers that overexpress GPR160 | |
CN110117658A (en) | Circular rna hsa_circ_0004872 is used for the new application of curing gastric cancer | |
KR101541832B1 (en) | Recombinant vector for screening of anticancer agent comprising human Noxin promoter fragment and screening method of anticancer agent by using it | |
CN102887938A (en) | Method for excavating difference protein of eucaryotic gene transcriptional regulation group | |
CN115837031B (en) | Application of TRAF4 inhibitor in preparation of neuroblastoma treatment drug | |
US8309687B2 (en) | Biomarker specific for cancer | |
JP5103621B2 (en) | SiRNA specific for the ADAT1 gene | |
CN118291389A (en) | NK cell for knocking out Cbl-b gene and preparation method and application thereof | |
Hou et al. | YAF2 promotes tumor cell proliferation via targeting cyclin D1 expression | |
Wang et al. | Jun‐mediated lncRNA‐IMS promotes the meiosis of chicken spermatogonial stem cells via gga‐miR‐31‐5p/stra8 | |
CN117467758A (en) | Application of MEF2A as target spot, screening method of medicine and application of substance for inhibiting MEF2A in preparation of medicine | |
CN114854856A (en) | Related application and medicament of ARPC1B gene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121114 Termination date: 20200928 |