CN1233816C - Recombinant yeast strain and IFN alpha-la interferon purifying process - Google Patents

Abstract

The present invention relates to a key technique for constituting a yeast engineering strain IFN alpha-1 a/pGAPZ alpha-A/GS115 for secreting and expressing alpha-1a interferon, a constitution result and a purification method for producing alpha-1a interferon by using the key technique. The key technique adopts a yeast secretion expression system to replace an expression system for a colibacillus inclusion body, target protein alpha-1a interferon does not need to be renatured, the biologic specific activity of the target protein can reach 1.0*10<9> units per milligram protein, and the target protein has low toxic and side effect. In the process of purification, expensive monoclonal antibody columns are not needed, target protein alpha-1a interferon with the purity of more than 95% can be extracted and obtained from fermentation liquid, and the production cost is lowered.

Description

The purification process of Yeast Recombinates One and Ifn α-1a Interferon, rabbit

[technical field]

The present invention relates to the engineering strain of secreting, expressing people α-1a Interferon, rabbit and utilize it to produce the purification process of people α-1a Interferon, rabbit.

[background technology]

At present, the α of domestic production-1a Interferon, rabbit mostly is e. coli expression product, and the main technique defective is: colibacillary expression system needs renaturation for forgiving build in the production process, renaturation yield is low, is up to 40%, thereby specific activity is low, has only 1.0 * 10 ⁸There is bigger side effect in unit/milligram albumen; And, will be in the separation and purification with being worth expensive monoclonal antibody post, purity just can reach more than 95%; And no matter present home-made monoclonal antibody post in output and qualitatively, all can not satisfy producer's needs, need spend a large amount of funds imports, and production cost is very high.

[summary of the invention]

In order to overcome above-mentioned defective, the present invention adopts the yeast secreted expression system to replace the inclusion bodies of colibacillus expression system, and target protein α-1a Interferon, rabbit does not need renaturation, and its biological specific activity can reach 6.0 * 10 ⁸Unit/milligram albumen, toxic side effect is low; In purge process, the monoclonal antibody post of value on demand costliness not can extract from fermented liquid and obtains purity and reach target protein α-1a Interferon, rabbit more than 95%, has reduced production cost.

The construction process of people α-1a Interferon, rabbit yeast group strain is: the GAP promotor/α-xhoI/xbaI site, factor signal peptide downstream that will remove people α-1a interferon gene rhIFN α-1a insertion pGAPZ α-A of atg start codon ATG, delete carrier Kex2 site four amino acid GIu-Ala-Glu-Ala afterwards simultaneously, be the Ste13 site, make up adult's α-1a Interferon, rabbit secreted expression carrier; Utilize the method for the Pichia EasyComp TransformationKit of Australian Invitrogen company to make improvements, people α-1a interferon gene secreted expression carrier is transformed pichia (Pichia Pastoris) bacterial strain GS115, be built into the yeast recombinant bacterial strain of secreting, expressing people α-1a Interferon, rabbit, i.e. rhIFN α-1a/pGAPZ α-A/GS115; Analyze and biological specific activity mensuration by antibiotic-screening, SDS-PAGE, obtain the target Yeast recombinant strain.

The expression amount of above-mentioned Yeast recombinant strain target protein people α-1a Interferon, rabbit is the 50-60% that target protein accounts for the secretion total protein, and specific activity is 1.08 * 10 ⁹Unit/milligram albumen, the immunogenicity that target protein people α-1a Interferon, rabbit has with natural α-the 1a Interferon, rabbit is identical.It is to be integrated in the genome form that this recombinant bacterial strain is accepted foreign gene, this and intestinal bacteria, the outer plasmid expression system of the independent genome of yeast saccharomyces cerevisiae has marked difference, so this recombinant bacterial strain is than intestinal bacteria, yeast saccharomyces cerevisiae is stable, be difficult for taking place foreign gene and lose phenomenon, in case with this reorganization bacterium as the sample template, pass through PCR, the positive strain that technical evaluation such as molecular hybridization choose must be true and reliable, and the direct expression-secretion of its objective expression product people α-1a is in nutrient solution, therefore the biological activity that detects its expressing quantity and target product is very simple and easy, and this needs renaturation-much superior than coli expression system-expression product; In addition, yeast is a kind of simple eukaryote, so it expresses the post-treatment mode class like higher eucaryote, so the gene product of expressing with it not only has the identical biological activity of natural product, and low toxic side effect, the product tooling cost is low, and suitability is wider.

The purification process of people α-1a Interferon, rabbit is: utilize the high product expression amount, the active Yeast recombinant strain of high product that obtain to ferment, centrifugal collection supernatant liquor, regulate pH with acetic acid, cross positively charged ion chromatography post, collect the target elution peak, add ammonium sulfate to 30%, this moment, solution just began to become turbid, and the centrifuging and taking supernatant liquor is crossed the hydrophobic chromatography post, collect the target elution peak, cross the anion chromatography post, collect the target elution peak, cross the Sephacryl molecular sieve chromatography, collect target peak, obtain people α-1a Interferon, rabbit.

The purification process of people α provided by the invention-1a Interferon, rabbit, shortened the purifying time, do not need expensive monoclonal antibody post just can obtain purity, reduced cost, in industrial production, use good economic benefit greater than people α-1a Interferon, rabbit stoste of 95%.

[description of drawings]

Accompanying drawing behaviour α-1a interferon expression vector construction figure.

PGAPZ α-A/rhIFN α-1a expression vector molecular size is 3.6kb

PGAPZ α-A carrier structure is:

Phosphoglycerate dehydrogenase gene promoter region: 1-483bp

Phosphoglycerate dehydrogenase gene promoter primer sites: 455-476bp

α-mating factor secretion signal peptide sequence: 493-759bp

α-mating factor secreting signal peptide primer sites: 696-716bp

Carrier multiple clone site: 760-828bp

Myc antigenic determinant bag: 827-856bp

Poly Histidine bag: 827-889bp

3 '-alcohol oxidase, 1 gene primer site: 974-994bp

Alcohol oxidase 1 Transcription Termination zone: 893-1233bp

Transcriptional elongation factor 1 promoter region: 1234-1644bp

Synthetic prokaryotic promoter: 1645-1712bp

Streptomycete zeocin resistant gene is read frame: 1713-2087bp

Cytopigment synthetase 1 Transcription Termination zone: 2088-2405bp

Intestinal bacteria replicon 1 (deriving from the pUC carrier): 2416-3089bp

[embodiment]

Introduce the present invention in detail in the structure of people α-1a Interferon, rabbit yeast recombinant bacterial strain and the concrete application in people α-1a Interferon, rabbit purifying process below in conjunction with embodiment.

Embodiment 1

One, the structure of rhIFN α-1a Interferon, rabbit Yeast engineering bacteria

(1) material:

1, rhIFN α-1a gene

2, pGAZ α-A, P.pastoris Strain CS115 (his4) are available from Australian Invitrogen company.

(2) method:

1, gene PCR amplification:

(1) design of primers: by 5 ' end design of primers, Ste13 site (Glu-Ala-Glu-Ala) and rhIFN α-1a atg start codon ATG on the deletion carrier after Kex2 (Lys-Arg) site.

P1-5 ' G CTCGAGAAAAGA TGTGATCTGCCTCAAACT3 ' (" ATG " is deleted)

XhoI Lys-Arg (Kex2 site)

P2-5’G TCTAGATCATTCCTTACTTCTTAAACT3’

XbaI

(2) thermal cycling: 95 ℃, 5 '; 95 ℃, 30 " → 49 ℃, 30 " → 72 ℃, 60 ";

72 ℃, 10 '; 30 circulations of increasing.

2, pcr amplification product reclaims and the clone:

(1) rhINF α-1a gene obtains the DNA band of about 521bp behind the amplification electrophoresis;

(2) the PCR product high purity test kit of producing with German Bao Ling Man reclaims target fragment and carries out the T-vector clone.

3, gene sequencing: the ABI377ADNA automatic sequencer that adopts U.S. PE company to produce carries out dna sequence analysis.

4, yeast secretion type expression vector construction: adopt the XhoI/XbaI site of gene clone technology, be built into the secretor type Yeast expression carrier that contains α-factor signal peptide with GAP promotor/α-factor signal peptide downstream of people α-1a interferon gene insertion pGAPZ α-A; Expression vector transforms GS115 (his4), and the method for Pichia EasyCompTransformation Kit (Cat.No.K1730-01) through making improvements slightly of utilizing Australian Invitrogen company to produce carried out.Concrete operations are as follows: the single bacterium colony of (1) picking pichia (Pichia Pastoris) GS115, at 30 ℃, 300 rev/mins of conditions with YPD+Zeocin100 mg/litre substratum shaking culture to OD600=1.3-1.5; Get in 0.1-0.5 milliliter bacterium liquid to the 50 milliliter same substratum shaking culture to OD600=6-8, under 5000 rev/mins, 4 ℃ conditions centrifugal 5 minutes, remove supernatant liquor, resuspended with 10 ml soln I, make competent cell; (2) get 100 microlitre competent cells, add the linearizing people α of 5-10 microlitre-1a Interferon, rabbit recombinant expression vector, add 400 ml soln II again, cultivated 1 hour for 28 ℃ behind the mixing, add 1 milliliter of YPD, cultivated 1 hour for 30 ℃; (3) with culture at 5000 rev/mins, under 4 ℃ of conditions centrifugal 15 minutes, remove supernatant, resuspended with 200 ml soln III, coating YPD+Zeocin100 mg/litre flat board was cultivated 24-36 hour, and was produced single bacterium colony for 28-30 ℃.

5, the screening of high expression level yeast recombinant bacterial strain: behind Zeocin antibiotic-screening acquisition positive strain, extract the engineering bacteria genomic dna, the 520bp dna fragmentation of DiG Labelling and Detection Kit labelling human α-1a interferon gene of further making pcr analysis with primer P1/P2 and producing with German Bao Ling company is a probe, carry out technical evaluation such as Southern blotting and filter out positive strain, again with the rhIFN α-1a/pGAPZ α-A/GS115 recombinant bacterial strain of SDS-PAGE screening high expression level target protein.

Embodiment 2

The purification process of people α-1a Interferon, rabbit: make up people α-1a Interferon, rabbit Yeast engineering bacteria and (behind the rhIFN α-1a/pGAPZ α-A/GS115), preserve bacterial classifications for-80 ℃.Before the fermentation, inoculation is dull and stereotyped, make actication of culture, in YPD+Zeocin100 mg/litre substratum, inoculate single bacterium colony fermentation 72 hours, centrifugal collection fermented supernatant fluid, regulate pH4.0-5.0 with acetic acid, cross CM Sepharose column chromatography, collect 0.4 mol sodium-chlor elution peak, add ammonium sulfate to 30%, the centrifuging and taking supernatant liquor, cross the PhenylSepharose column chromatography, collect 10% ammonium sulfate elution peak, cross DEAE Sepharose column chromatography, collect 0.1 mol sodium-chlor elution peak, cross Sephacryl S-200 column chromatography, collect protein peak, obtain purity greater than people α-1a Interferon, rabbit stoste of 95%.

Claims (2)

1, a kind of Yeast recombinant strain, it is characterized in that the people α that will remove atg start codon ATG-1a interferon gene inserts GAP promotor/α-xhoI/xbaI site, factor signal peptide downstream of pGAPZ α-A, delete carrier Kex2 site four amino acid Glu-Ala-Glu-Ala afterwards simultaneously, make up adult α-1a interferon gene secreted expression carrier rhIFN α-1a/pGAPZ α-A, change the bacterium pearl GS115 of pichia Pichia pastoris over to, be built into the Yeast recombinant strain rhIFN α-1a/pGAPZ α-A/GS115 of secretor type people α-1a Interferon, rabbit.

2, the purification process of a kind of people α-1a Interferon, rabbit is characterized in that directly from secretor type people α-1a Interferon, rabbit yeast recombinant bacterial strain, i.e. separation and purification people α-1a Interferon, rabbit in the fermented supernatant fluid of rhIFN α-1a/pGAPZ α-A/GS115; Centrifugal collection fermented supernatant fluid is regulated pH with acetic acid, crosses the cation-exchange chromatography post, collect the target elution peak, add ammonium sulfate to 30%, the centrifuging and taking supernatant liquor is crossed the hydrophobic chromatography post, collect the target elution peak, cross the anion chromatography post, collect the target elution peak, cross the Sephacryl molecular sieve chromatography, collect target peak, obtain people α-1a Interferon, rabbit.