CN1548525A - Recombinant yeast strain and IFN alpha-la interferon purifying process - Google Patents

Abstract

The present invention relates to the key technology and result of constructing engineering yeast strain IFN alpha-1a/pGAPZ alpha-A/GS115 secreting alpha-1a interferon and the purification process of produced interferon. The present invention adopts yeast secretion expressing system, rather than traditional colibacillus inclusion body expression system, and the target protein alpha-1a interferon has no needs of renaturation, biological specific activity of 1.0E9 unit/mg protein and low toxic side effect. The purification process can obtain target protein alpha-1a interferon of 95 % purity without needing expensive monoclonal antibody column for lowering production cost.

Description

The purification process of Yeast Recombinates One and Ifn α-1a Interferon, rabbit

[technical field]

The present invention relates to the engineering strain of secreting, expressing α-1a Interferon, rabbit and utilize it to produce the purification process of α-1a Interferon, rabbit.

[background technology]

At present, the α of domestic production-1a Interferon, rabbit mostly is e. coli expression product, and the main technique defective is: colibacillary expression system needs renaturation for comprising build in the production process, renaturation yield is low, is up to 40%, thereby specific activity is low, has only 1.0 * 10 ⁸There is bigger side effect in unit/milligram albumen; And, will be in the separation and purification with being worth expensive monoclonal antibody post, purity just can reach more than 95%; And no matter present home-made monoclonal antibody post in output and qualitatively, all can not satisfy producer's needs, need spend a large amount of funds imports, and production cost is very high.

[summary of the invention]

In order to overcome above-mentioned defective, the present invention adopts the yeast secreted expression system to replace the inclusion bodies of colibacillus expression system, and target protein α-1a Interferon, rabbit does not need renaturation, and its biological specific activity can reach 6.0 * 10 ⁸Unit/milligram albumen, toxic side effect is low; In purge process, the monoclonal antibody post of value on demand costliness not can extract from fermented liquid and obtains purity and reach target protein α-1a Interferon, rabbit more than 95%, has reduced production cost.

The construction process of α-1a Interferon, rabbit Yeast recombinant strain is: the GAP promotor/α-site, factor signal peptide downstream that will clone the α-1a interferon gene insertion pGAPZ α-A that modifies, Ste13 site (Glu-Ala-Glu-Ala) and atg start codon ATG after deletion Kex2 (Lys-Arg) site are built into α-1a interferon gene secreted expression carrier; Utilize the method for the Pichia EasyComp Transformation Kit of Australian Invitrogen company to make improvements, with the bacterial strain GS115 of α-1a interferon gene secreted expression carrier conversion pichia (Pichia pastoris), be built into Yeast engineering bacterium strain--the IFN α-1a/pGAPZ α-A/GS115 of secretion type expression α-1a Interferon, rabbit; Analyze and biological specific activity mensuration by antibiotic-screening, SDS-PAGE, obtain the target Yeast recombinant strain.

The expression amount of above-mentioned Yeast recombinant strain target protein α-1a Interferon, rabbit is the 50-60% that target protein accounts for the secretion total protein, and specific activity is 1.08 * 10 ⁹Unit/milligram albumen; The immunogenicity that target protein α-1a Interferon, rabbit has with natural α-the 1a Interferon, rabbit is identical.It is to be integrated in the genome form that this engineering strain is accepted foreign gene, this and intestinal bacteria, the outer plasmid expression system of the independent genome of yeast saccharomyces cerevisiae has marked difference, so this engineering strain is than intestinal bacteria, yeast saccharomyces cerevisiae is stable, be difficult for taking place foreign gene and lose phenomenon, in case with engineering bacteria as the sample template, pass through PCR, the positive strain that technical evaluation such as molecular hybridization choose must be true and reliable, and the direct expression-secretion of its objective expression product α-1a is in nutrient solution, therefore the biological activity that detects its expressing quantity and target product is very simple and easy, and this needs renaturation-much superior than coli expression system-expression product; In addition, yeast is a kind of simple eukaryote, so it expresses the post-treatment mode class like higher eucaryote, so the gene product of expressing with it not only has the identical biological activity of natural product, and low toxic side effect, the product tooling cost is low, and suitability is wider.

The purification process of α-1a Interferon, rabbit is: utilize the high product expression amount, the active Yeast recombinant strain of high product that obtain to ferment, centrifugal collection supernatant liquor is regulated pH with acetic acid, cross positively charged ion chromatography post, collect the target elution peak, add ammonium sulfate to muddy slightly, the centrifuging and taking supernatant liquor, cross the hydrophobic chromatography post, collect the target elution peak, cross the anion chromatography post, collect the target elution peak, cross the Sephacryl molecular sieve chromatography, collect target peak, obtain α-1a Interferon, rabbit.

The purification process of α provided by the invention-1a Interferon, rabbit has shortened the purifying time, does not need expensive monoclonal antibody post just can obtain purity greater than α-1a Interferon, rabbit stoste of 95%, has reduced cost, uses good economic benefit in industrial production.

[description of drawings]

Accompanying drawing is α-1a interferon expression vector construction figure.

PGAPZ α-A/IFN α-1a expression vector molecular size is 3.6kb

PGAPZ α-A carrier structure is:

Phosphoglycerate dehydrogenase gene promoter region: 1-483bp

Phosphoglycerate dehydrogenase gene promoter primer sites: 455-476bp

α-mating factor secretion signal peptide sequence: 493-759bp

α-mating factor secreting signal peptide primer sites: 696-716bp

Carrier multiple clone site: 760-828bp

Myc antigenic determinant bag: 827-856bp

Poly Histidine bag: 872-889bp

3 '-alcohol oxidase, 1 gene primer site: 974-994bp

Alcohol oxidase 1 Transcription Termination zone: 893-1233bp

Transcriptional elongation factor 1 promoter region: 1234-1644bp

Synthetic prokaryotic promoter: 1645-1712bp

Streptomycete zeocin resistant gene is read frame: 1713-2087bp

Cytopigment synthetase 1 Transcription Termination zone: 2088-2405bp

Intestinal bacteria replicon 1 (deriving from the pUC carrier): 2416-3089bp

[embodiment]

Introduce the present invention in detail in the structure of α-1a Interferon, rabbit recombination yeast engineering strain and the concrete application in α-1a Interferon, rabbit purifying process below in conjunction with embodiment.

Embodiment 1

One, the structure of IFN α-1a Interferon, rabbit Yeast engineering bacteria

(1) material:

1.IFN α-1a gene

2.pGAPZ α-A, P.pastoris Strain GS115 (his4) available from

Australia Invitrogen company.

(2) method:

1. gene PCR amplification:

(1) design of primers: in 5 ' end primer, delete Kex2 (Lys-Arg) site

Afterwards Ste13 site (Glu-Ala-Glu-Ala) and atg start codon ATG.

P1-5 ' G CTCGAGAAAAGA ATGTGTGATCTGCCTCAAACC3 ' (" ATG " is deleted)

Xho I Lys-Arg (Kex2 site)

P2-5’G TCTAGATCATTCCTTACTTCTTAAACT3’

XbaI

(2) thermal cycling: 95 ℃, 5 '; 95 ℃, 30 " → 49 ℃, 30 " → 72 ℃, 60 " 72 ℃, 30 circulations of 10 ' amplification.

2.PCR amplified production reclaims and the clone:

(1) IFN α-1a gene obtains the DNA band of about 521bp behind the amplification electrophoresis;

(2) the PCR product high purity test kit of producing with German Bao Ling Man reclaims target fragment and carries out the T-Vector clone.

3. gene sequencing: the ABI 377A automatic dna sequencer that adopts U.S. PE company to produce carries out dna sequence analysis.

4. yeast secretion type expression vector construction: adopt gene clone technology with α-1a interferon gene by the Xho I/Xba I site that XhoI/XbaI inserts GAP promotor/α-factor signal peptide downstream of pGAPZ α-A, be built into the secretor type Yeast expression carrier that contains α-factor signal peptide; Expression vector transforms GS115 (his4): the method for PichiaEasyComp Transformation Kit (Cat.No.K1730-01) through making improvements slightly of utilizing Australian Invitrogen company to produce carried out.Concrete operations are as follows: the single bacterium colony of (1) picking pichia (Pichia pastoris) GS115, at 30 ℃, under 300 rev/mins of conditions with YPD+Zeocin100 mg/litre substratum shaking culture to OD600=1.3-1.5; Get in 0.1-0.5 milliliter bacterium liquid to the 50 milliliter same substratum shaking culture to OD600=6-8, under 5000 rev/mins, 4 ℃ conditions centrifugal 5 minutes, remove supernatant liquor, resuspended with 10 ml soln I, make competent cell; (2) get 100 microlitre competence, add the linearizing α of 5-10 microlitre-1a Interferon, rabbit recombinant expression vector, add 400 ml soln II again, cultivated 1 hour for 28 ℃ behind the mixing, add 1 milliliter of YPD, cultivated 1 hour for 30 ℃; (3) with culture under 5000 rev/mins, 4 ℃ conditions centrifugal 15 minutes, remove supernatant, resuspended with 200 ml soln III, coating YPD+Zeocin100 mg/litre flat board was cultivated 24-36 hour, and was produced single bacterium colony for 28-30 ℃.

5. the screening of high expression level Yeast engineering bacterium strain: behind Zeocin antibiotic-screening acquisition positive strain, extract the engineering bacteria genomic dna, the 520bp dna fragmentation of DiG Labelling and Detection Kit mark α-1a interferon gene of further making pcr analysis with primer P1/P2 and producing with German Bao Ling company is a probe, carry out technical evaluation such as Southern blotting and filter out positive strain, again with the IFN α-1a/pGAPZ α-A/GS115 engineering strain of SDS-PAGE screening high expression level target protein.

Embodiment 2

The purification process of α-1a Interferon, rabbit: make up α-1a Interferon, rabbit Yeast engineering bacteria and (behind the IFN α-1a/pGAPZ α-A/GS115), preserve bacterial classifications for-80 ℃.Before the fermentation, inoculation is dull and stereotyped, make actication of culture, in YPD+Zeocin100 mg/litre substratum, inoculate single bacterium colony fermentation 72 hours, centrifugal collection fermented supernatant fluid, regulate pH4.0-5.0 with acetic acid, cross CM Sepharose column chromatography, collect 0.4 mol sodium-chlor elution peak, add ammonium sulfate to 30%, the centrifuging and taking supernatant liquor, cross the PhenylSepharose column chromatography, collect 10% ammonium sulfate elution peak, cross DEAE Sepharose column chromatography, collect 0.1 mol sodium-chlor elution peak, cross Sephacryl S-200 column chromatography, collect protein peak, obtain purity greater than α-1a Interferon, rabbit stoste of 95%.

Claims (2)

1, a kind of Yeast recombinant strain, it is characterized in that α-1a interferon gene of clone's modification is inserted GAP promotor/α-site, factor signal peptide downstream of pGAPZ α-A, Ste13 site (Glu-Ala-Glu-Ala) and atg start codon ATG after deletion Kex2 (Lys-Arg) site, be built into α-1a interferon gene secreted expression carrier IFN α-1a/pGAPZ α-A, change the bacterial strain GS115 of pichia (Pichiapastoris) over to, be built into the Yeast recombinant strain IFN α-1a/pGAPZ α-A/GS115 of secretor type α-1a Interferon, rabbit.

2, the purification process of a kind of α-1a Interferon, rabbit, it is characterized in that directly from secretor type α-1a Interferon, rabbit Yeast engineering bacterium strain (separation and purification α-1a Interferon, rabbit the fermented liquid of IFN α-1a/pGAPZ α-A/GS115): centrifugal collection fermented supernatant fluid, regulate pH with acetic acid, cross the cation-exchange chromatography post, collect the target elution peak, add ammonium sulfate to muddy slightly, the centrifuging and taking supernatant liquor, cross the hydrophobic chromatography post, collect the target elution peak, cross the anion chromatography post, collect the target elution peak, cross the Sephacryl molecular sieve chromatography, collect target peak, obtain α-1a Interferon, rabbit.