CN100357441C - Yeast expressing system of recombined human nerve growth factor and process for preparing recombined human nerve grouth factor - Google Patents
Yeast expressing system of recombined human nerve growth factor and process for preparing recombined human nerve grouth factor Download PDFInfo
- Publication number
- CN100357441C CN100357441C CNB2005101232242A CN200510123224A CN100357441C CN 100357441 C CN100357441 C CN 100357441C CN B2005101232242 A CNB2005101232242 A CN B2005101232242A CN 200510123224 A CN200510123224 A CN 200510123224A CN 100357441 C CN100357441 C CN 100357441C
- Authority
- CN
- China
- Prior art keywords
- plasmid
- growth factor
- human nerve
- expression
- yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a novel yeast expression system for expressing human nerve growth factors, which has the advantages of high expression yield, natural structure and biological activity of products, no need of denaturalization and renaturation, simple and cheap culture medium, few thermogenic substances, obviously high yield, greatly low production cost, etc. The present invention also provides a method for using the expression system for preparing human nerve growth factors.
Description
Technical field
The present invention relates to the recombinant vectors and the yeast expression host thereof of new expressing human nerve growth factor (hNGF).
The invention still further relates to the method for preparing recombinant human nerve growth factor of utilizing this yeast expression system.
Background technology
Growth factor of human nerve (human nerve growth factor, be called for short hNGF) be a kind of in the human body to the nutritious effect of normal neurocyte, injured nerve is repaired the biologically active factors that function has regulating effect, it can keep sympathetic nerve and sensorineural existence, promote the differentiation of neurocyte, the direction of extension of decision aixs cylinder.To the growth of promotion brain, neural growth, the regeneration and the functional rehabilitation of injured nerve have decisive role.
HNGF can be applicable to diabetic peripheral neuropathy, senile dementia, Parkinson's disease, facial neuritis, and nerve injury (comprises Spinal injury, high paraplegia, severed finger reunion, brain injury, the damage of maincenter such as peripheral nerve injury and nervus peripheralis system) etc. nervous system disorders is at present unique clinical neural system rho factor that can be applicable to.RhNGF content in human body is very little, and natural origin hardly may.Therefore, be unique selection with engineered method production recombinant human nerve growth factor (rhNGF).Utilizing genetic engineering technique, is carrier with the microorganism, produces foreign protein and has broad application prospects.Up to the present, developed the multiple protein expression system.Escherichia expression system be study the most clearly one the cover prokaryotic expression system, people to it genetic background and biochemical characteristic solve very thoroughly, and intestinal bacteria have easy operation because of it, growth rapidly, advantages such as nutritional needs is simple have obtained using widely.But itself also exists some defectives this system: modify and processing after 1. lacking Eukaryotic protein translation, as shearing, glycosylation, formation disulfide linkage etc.; 2. expressed proteins is many exists with the inclusion body form, needs could recover conformation and activity through complicated renaturation; 3. the background foreign protein is a lot, and purifying is trouble; 4. expression amount generally is not very high.In order to overcome the shortcoming of escherichia expression system, from twentieth century eighties, people have been developed the yeast cell to express system.
Yeast has prokaryotic organism and Eukaryotic some advantage concurrently as the simplest a kind of unicellular eukaryote.The advantage of yeast expression system: yeast is a kind of unicellular lower eukaryotes, and culture condition is common, and growth and breeding speed is rapid, can tolerate higher hydrostatic pressure, when being used for the expressing gene engineering product, can scale operation, effectively reduce production cost.The yeast expression foreign gene has certain translation post-treatment ability, the exogenous protein of results has to a certain extent folding processing and glycosylation modified, character is more stable than the protein of prokaryotic expression, is particularly suitable for the marking protein that stably express eukaryotic gene and preparation have function.Yeast expression system has the external secretion signal sequence, expressed exogenous protein can be secreted into the extracellular, therefore is easy to purifying.
Yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) is the yeast that is used to express foreign protein the earliest.It is fast that it has reproduction speed, can high density fermentation, can carry out the advantages such as modification, processing behind the protein translation.After usefulness yeast saccharomyces cerevisiae expressing human Interferon, rabbit such as Hitzemom in 1981 are succeedd (HitzemomR A, Hagie F E, et al, Nature, 1981,293:717～722), yeast saccharomyces cerevisiae has also been expressed multiple protokaryon and eukaryotic protein.But also there is its limitation in this system, as lacks strong promotor; Secernment efficiency is poor; Expression strain is stable inadequately; Expression plasmid is easy to lose; The degree of glycosylation height; There is α-1,3 glycosidic link in the core polysaccharide end, thereby makes albumen have the antigenicity of height, is not suitable for doing treatment preparation or the like.In order to address these problems, people have been developed the methanol yeast expression system.
Methanol yeast is a kind of methyl alcohol nutritional type yeast, when lacking inhibition carbon source such as glucose, glycerine, can utilize methyl alcohol as sole carbon source, and it is a kind of novel expressive host that grows up on the basis of yeast saccharomyces cerevisiae.Comprising Pichia, Hansenula, Torulopsis, Candida etc., is the heterologous gene expression system that the host sets up with Pichiapastoris (Pasteur's pichia yeast) wherein, is developed rapidly in recent years and widespread use.As eukaryotic expression system, methanol yeast has the advantage that many other protein expression systems do not have, as has strong alcohol oxidase gene (AOX1) promotor, expression that can strict regulation and control foreign protein; Processing and modification after can translating expressed proteins, i.e. the acidylate, protein phosphorylation of the formation of disulfide linkage, fat, folding, signal sequence processing, N-glycosylation, O-glycosylation, thus make the albumen biologically active that gives expression to; Though in the process that protein induce is expressed with methyl alcohol as unique carbon source, do not have the endogenous toxic material residue problem in bacteria-like, the animal cell culture; Nutritional requirement is low, and growth is fast, and the substratum cheapness is convenient to suitability for industrialized production; But high density fermentation is cultivated, the protein yield height; The expression amount height; Degree of glycosylation is low; Methanol yeast self excretory albumen is few, the more easily separated purifying of expression product.(Chinese Hamster Ovary Cell is to be used for eukaryotic gene to express comparatively successful host cell CHO) to Chinese hamster ovary cell.Compare with other expression system, it has many advantages: 1. post transcriptional modificaiton function accurately, the glycosylation pharmaceutical protein of expression aspect molecular structure, physicochemical property and biological function near the native protein molecule; 2. the expression product exocytosis is convenient to separation and purification; 3. the efficient amplification and the ability to express that have recombination; 4. adherent growth has higher tolerance shearing force and osmotic pressure ability, can carry out suspension culture or reach high-density in serum free medium, and volume of culture can reach more than the 1000L; 5. Chinese hamster ovary celI belongs to inoblast, seldom secretes intrinsic protein, is beneficial to the separation and purification of foreign protein.According to the characteristics of expressing cho cell system, existing increasing pharmaceutical protein has obtained to efficiently express therein, and the part medicine is put on market, as EPO, G-CSF etc.But, also exist many defectives when utilizing this expression system to carry out protein expression, low as the recombinaant CHO cell production efficiency that makes up, expression product concentration is low; Some glycosylation expression product instability is difficult for purifying; The recombinaant CHO cell upstream makes up with the downstream separation purifying and easily disconnects, and purifying is trouble; The expression cycle is long; Reconstitution cell cultivation fee costliness or the like.Therefore, utilize the technology of expressing cho cell foreign gene still can not satisfy the exploitation of biologics and the requirement of production at present.
Growth factor of human nerve, at home and abroad after deliberation for many years, domestic is directly to extract DNA from the human blood leukocyte basically, clones and expresses.In view of NGF has broad clinical application prospect, thereby be subjected to the attention of medical circle and business circles.In the expression of heterologous protein, intestinal bacteria have easy operation because of it, and growth rapidly, advantages such as nutritional needs is simple, successfully expressed multiple foreign protein, still, because the hNGF molecule comprises 3 pairs of disulfide linkage, if express (Bai Yanyan with intestinal bacteria, Yang Ji becomes, etc., University Of Suzhou's journal, 2004,24 (4): 466-468; Liu Donghai, Zhang Gengrong, etc., Chinese Journal of Pathophysiology, 2002,18 (5): 486-489), exist peptide bond can not effectively fold factors such as reaching the easy mispairing of disulfide linkage, and, need pass through sex change and renaturation step during purifying, renaturation yield is very low.Chinese patent application 00111220.1 discloses the novel method that a kind of recombinant human nerve growth factor (rhNGF) with disulfide bond isomerase PDI promotion sex change correctly folded and improved its renaturation yield.In the renaturation system of rhNGF, add a certain proportion of PDI, can make among the rhNGF wrong paired disulfide linkage open and form correct disulfide linkage, thereby improve renaturation yield, reduce isomer proportion, improve the rhNGF productive rate.Yet purifying is difficulty still, and cost is high, and its output and application are restricted.Though at present both at home and abroad to utilize the expressing cho cell growth factor of human nerve carried out studying (pay the tinkling of pieces of jade, in graceful, etc., institute of Military Medical Science Institute periodical, 2003,27 (4): 319-320; Bai Yanyan, Yang Ji becomes, etc., Chinese Journal of Immunology, 2003,19 (5): 343-346), but the many defectives that exist owing to the expressing cho cell system are restricted.Pasteur's pichia yeast expression system is owing to its unique advantages is subjected to using widely, many foreign proteins have been expressed, and, also there is document to report expression (the model Qiao of gene in P.pastoris of growth factor of human nerve β subunit, Liu Hongdi, etc., Science Bulletin, 1999,44 (6): 637-642).Although it has used methyl alcohol nutritional type yeast GS115 as host cell, but its employed plasmid expression vector is pHIL-S1, this carrier is the outer secretion type expression vector, the expression of alcohol oxidase AOX1 promoter regulation goal gene, Phosphoric acid esterase PHO1 signal peptide gene is positioned at the N end of goal gene, and contains PHO1 cleavage site (as shown in Figure 1).For making the reading frame unanimity, add that at hNGF encoding sequence N end two base AA insert the XhoI site of pHIL-S1, have made up expression vector pSNGF.The target protein that this expression vector is changed over to the yeast transformant expression of GS115 structure accounts for 14.4% of total protein of cell, but does not report the expression amount of concrete rhNGF.
Though studies have shown that NGF is a kind of glycoprotein, its function is relevant with its N end glycosyl, but its glycosyl only exists as identifying information, the subunit that many gene engineering product proofs do not contain glycosyl has higher activity, therefore improve the biologic activity of the target protein of expressing, and make screening method simple, easy to operate simultaneously, screening effect obviously is the primer sequence of design NGF and the important factor that expression vector need be considered.
Summary of the invention
The objective of the invention is to the invention provides the yeast expression system (being also referred to as expressive host) of new expression vector that contains recombinant human nerve growth factor and conversion thereof.
Another object of the present invention is to provide the method for utilizing expression system of the present invention to prepare recombinant human nerve growth factor.
According to an aspect of the present invention, the plasmid expression vector pPKLNGF that contains recombinant human nerve growth factor has structure as shown in Figure 1, is synthetic hNGF gene order to be inserted to make up in the pPIC9KL plasmid form.Wherein the pPIC9KL plasmid is to form after transforming by the plasmid pPIC9K that will be purchased, and it has single XhoI restriction enzyme site, after the insertion of hNGF gene, can give expression to highly active albumen.
According to a further aspect in the invention, the yeast expression that contains plasmid vector of the present invention host is provided, the expression vector pPKLNGF transformed yeast host of the present invention's structure can be obtained the yeast expression system of expression hNGF of the present invention, by the advantage of expressing in the yeast cell not only because can secrete hNGF, but also because it be actually be accurate folding form and have a high activity.Yeast host can be selected from pichia pastoris phaff (Pichia Pastoris), yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), saccharomyces hansenii (H.Polymorpha), candiyeast (Candida) and torulopsis (Torulopsi), schizosaccharomyces pombe (Schizosaccharomyces pombe) etc., most preferred yeast host is a pichia pastoris phaff, pichia spp host bacterium commonly used has: GS115, KM71, KM71H, SMD1168 and SMD1168H or the like, wherein preferred pichia spp GS115.
In accordance with a further aspect of the present invention, provide the method for preparing the recombinant human nerve cell growth factor, comprise the steps:
1) will the encode gene of growth factor of human nerve is operably connected to expression vector pPIC9KL, the recombinant expression vector of construction expression growth factor of human nerve;
2) with described recombinant expression vector transformed yeast host, the yeast expression system of construction expression growth factor of human nerve;
3) cultivate described yeast expression system, obtain recombinant human nerve growth factor.
Wherein, described step 1) comprises following step:
1.1) adopt the pPIC9KL plasmid construction to contain the plasmid pPIC9KL of single XhoI restriction enzyme site;
1.2) gene of the growth factor of human nerve of will encoding is operably connected to expression vector, makes up the recombinant expression vector pPKLNGF that contains hNGF.
In aforesaid method step 1.1) in, the step that makes up the plasmid that contains single XhoI restriction enzyme site comprises:
1.1.1) plasmid pPIC9K is cut with Xho I enzyme enzyme, after klenow enzyme benefit is flat, use T
4DNAligase connects, and changes bacillus coli DH 5 alpha over to;
1.1.2) cultivate and collect thalline, extract plasmid, order-checking selects the XhoI enzyme restriction enzyme site of non-polylinker 5 ' end to cut and mend flat plasmid, obtains the pPIC9KL plasmid.
In aforesaid method step 1.2) in, the preparation process that contains the recombinant expression vector pPKLNGF of hNGF comprises:
1.2.1) classify primer as with following synthetic nucleotides sequence:
Primer 1:5 ' CTCGAG AAA AGA TCT TCT TCT CAC CCA ATC 3 '
Primer 2: 3 ' CGCCGGCG AAT AGT AGA CTG TCG GAA AGA 5 '
With normal people's blood leukocytes genomic dna is template, carries out pcr amplification respectively;
1.2.2) from the PCR product that obtains, reclaim synthetic rhNGF dna segment, insert carrier pPIC9KL, obtain to contain the recombinant expression vector pPKLNGF of hNGF.
The plasmid expression vector that contains hNGF that the present invention makes up is by the transformation to existing plasmid, the plasmid pPIC9KL that obtains, it not only has alpha factor signal peptide, and the XhoI site of its AOXI 3 ' end (being polylinker5 ' end) just becomes the single endonuclease digestion site after transforming, make the rhNGF gene from then on insert plasmid vector in the site, guaranteed that reading frame is correct, first amino acid after the cutting of yeast alpha factor signal peptide is first amino acid ATG of rhNGF, thereby yeast expression excretory rhNGF is complete, and with the consistent proteinaceous product of natural hNGF N terminal amino acid sequence.
The present invention is directed to yeast expression system design construction expression vector, prepared the yeast expression system of expressing hNGF, in yeast expression system, not only can efficiently express the foreign gene on the expression plasmid of yeast and the foreign protein hNGF that expresses secreted in the substratum to cell walls, and expression product has native protein structure and natural radioactivity.Yeast culture system economy, easy, high density fermentation can get 100 grams per liter dry weight yeast, can improve productive rate, reduce production costs, and relatively are suitable for large-scale industrial production.
The methanol yeast expression system that the present invention selects for use is promotor with the alcohol oxidase, makes foreign gene stably be integrated in yeast chromosomal by the homology double exchange, has avoided foreign gene to lose effectively.Methanol yeast not only can make the expression product glycosylation, avoids the super glycosylation of yeast saccharomyces cerevisiae, the more important thing is that it can secrete expression product outside born of the same parents, and the secretion of oneself protein but seldom, is very beneficial for the purifier apparatus in downstream.Methanol yeast can a large amount of heterologous protein secretions.In methanol yeast, high-frequency integration also can take place in plasmid, can increase copy number with serial of methods, improves output.
The invention provides a kind of new expression system with yeast secreted expression tool native protein structure and bioactive rhNGF.It and other expression system, compare with the eukaryotic cell expression system as coli expression system and to have the following advantages:
1. express the productive rate height;
2. product tool natural structure and biological activity need not sex change and renaturation;
3. substratum is simple, inexpensive;
4. the thermal source material reduces;
5. productive rate significantly improves, and production cost reduces significantly.
Above-mentioned advantage makes the present invention have tangible technological innovation and technology advance, is more suitable in the suitability for industrialized production recombinant human nerve growth factor.Can prepare purity greater than 99% according to expression system of the present invention and method, biological specific activity is higher than 10
5The proteic reorganization of U/mg hNGF.
The contrast experiment shows that the rhNGF target protein that yeast expression system is expressed accounts for 28.7% of total protein of cell, and purity reaches more than 98%, and biologic activity is higher than 1 * 10
5U/mg, and the rhNGF that existing escherichia expression system is expressed, its purity can only reach 95%, and biologic activity has only 2 * 10
4U/mg.The yeast expression system of existing employing plasmid expression vector pHIL-S1 and GS115, the target protein of its expression accounts for 14.4% of total protein of cell.Therefore, expression system of the present invention can obviously provide the biologic activity of expression amount and the expressing protein of hNGF.
In order to understand essence of the present invention better,,, describe in detail but do not limit the present invention by description to better embodiment of the present invention below in conjunction with accompanying drawing.
Brief description of drawings
Fig. 1 is the structure iron of the expression plasmid pPKLNGF of the present invention's structure;
Fig. 2 is cDNA sequencing result and the corresponding amino acid sequence of the rhNGF of the present invention's acquisition;
Fig. 3 is the SDS-PAGE electrophorogram of the rhNGF of the present invention's acquisition, and wherein, Marker is a molecular weight marker, and swimming lane 1 is the yeast secretary supernatant, and swimming lane 2 is the rhNGF behind the purifying;
Fig. 4 is the rhNGF immunoblotting qualification result of the purifying of the present invention's acquisition, and wherein, swimming lane 1 is the rhNGF of purifying, and (the reorganization human is available from R﹠amp in swimming lane 2 positive contrasts; D).
The embodiment of invention
The used test materials of the present invention is commercially available purchase product if no special instructions, and the composition of all ingredients and substratum and compound method can be referring to the descriptions in the normal experiment handbook.
The construction and expression of [embodiment 1] recombinant human nerve growth factor pichia yeast expression system (pPKLNGF)
Pichia spp (Pichia pastoris) is a kind of methanol yeast, and system compares with animals and plants, and it has advantage simple to operate; Different with prokaryotic organism intestinal bacteria etc., pichia spp can be to wanting expressed protein carry out correctly folding thereby possessing natural bioactive; In addition, this methanol yeast can be realized high density fermentation, and its transformant can express exogenous protein highly stablely, more adapts to suitability for industrialized production.Therefore select the expressive host bacterium of pichia spp among the present invention as rhNGF.
1.hNGF the pcr amplification of gene
1.1 the extraction of human blood leukocyte's genomic dna
Method extracting method is routinely carried out: behind dextrorotation citric acid treatment fresh blood, and the centrifugation white corpuscle.White corpuscle is suspended in the extraction buffer 37 ℃ of insulation 1h.Add the Proteinase K protein hydrolysate, phenol extracting, ethanol sedimentation.The DNA that extracts is dissolved in TE (pH8.0) ,-20 ℃ of preservations.
1.2 design of primers is synthetic and the PCR reaction
In order to obtain the cDNA of hNGF, the inventor adopts full gene synthetic method to clone.The gene order of the hNGF of sequences Design reference report (Ullrich A, Gray A, Berman C.et al, Nature, 1983, Vol.303,821-825).5 of inventor's design ' contain restriction enzyme site Xho I and yeast alpha factor signal peptide cleavage site AAA AgA respectively with 3 ' terminal sequence, 3 ' terminal sequence contains restriction enzyme site Not I and termination codon TGA TAA, to adapt to Yeast expression carrier pPIC9KL, it is correct to reach the maintenance reading frame.
Design 5 ' and 3 ' terminal sequence is as follows respectively:
Primer 1:5 '
CTCGAGAAA AGA TCT TCT TCT CAC CCA ATC 3 '
Xho?I
Primer 2: 3 '
CGCCGGCGAAT AGT AGA CTG TCG GAA AGA 5 '
Not?I
Normal people's blood leukocytes genomic dna of getting said extracted is a template, carries out pcr amplification respectively with primer 1, primer 2, and amplification condition is: 94 ℃ of sex change 50sec, and 55 ℃ of annealing 60sec, 72 ℃ are extended 90sec, carry out 35 circulations altogether.The PCR product reclaims through 1.2% agarose gel electrophoresis.Reclaim synthetic rhNGFDNA segment, insert carrier pPIC9KL.
2. the structure of expression plasmid pPKLNGF
Expression plasmid of yeast is selected above-mentioned pPIC9KL for use.
PPIC9KL derives from plasmid pPIC9K sudden change.PPIC9K was Invitrogen company product (Cat.No.VI75-20) originally.The pPIC9K plasmid is former respectively to have an Xho I site at AOX1 3 ' end and 3 ' AOX1 gene place, can't insert with Xho I site.
Plasmid pPIC9K is cut with Xho I enzyme enzyme, through the klenow enzyme mend flat after, this site by
5′CTCGAG?3′ 5′-C--G-3′
3 ' GAGCTC 5 ' becomes 3 '-G--C-5 '
Use T
4DNA ligase connects, and changes bacillus coli DH 5 alpha over to.Cutting may obtain four kinds of products after mending and putting down like this: two identical Xho I cut simultaneously to mend and put down; Two identical Xho I do not have to cut simultaneously; Each only cuts two restriction enzyme sites one and mends flat.With the LB liquid nutrient medium that contains 100 μ g/mL AMP, shaking culture is to OD under 37 ℃ of conditions
600About 0.5, centrifugal collection thalline extracts plasmid, and order-checking is selected the Xho I enzyme restriction enzyme site of non-polylinker 5 ' end to cut and mend flat plasmid (the XhoI enzyme restriction enzyme site of polylinker 5 ' end does not cut) and is the pPIC9KL plasmid.The XhoI site of AOXI 3 ' end (being polylinker 5 ' end) just becomes the single endonuclease digestion site like this, make the rhNGF gene from then on insert plasmid vector in the site, guaranteed that reading frame is correct, first amino acid after the cutting of yeast alpha factor signal peptide is first amino acid ATG of rhNGF, thereby yeast expression excretory rhNGF is complete, and with the consistent proteinaceous product of natural hNGF N terminal amino acid sequence.We transform the plasmid that obtains behind the plasmid pPIC9K, have single Xho I restriction enzyme site, and we are with its called after pPIC9KL.
The plasmid structure iron is seen Fig. 1.
Used pichia pastoris phaff (Pichia pastoris) expression system, it is by wild-type oil yeast Y11430 sudden change, and 3 strain host bacterium commonly used are GS115, KM71 and MC100-23.GS115 and KM71 are group ammonia alcohol dehydrogenase gene (the histidinol dehydrogenase gene of Y11430, his4) deletion mutant, can not synthesize His4, therefore plasmid vector need carry his4, positive recombinant after the transfection can screen with his4 defective (his4) flat board, the promotor of GS115 is PAOX1, can grow fast in containing the substratum of methyl alcohol.Preferred pichia spp GS115 among the present invention.
The pichia pastoris phaff expression vector that builds is become wire by corresponding restriction endonuclease digestion, with electroporation linearized vector is transformed in the host bacterium.Linearizing position difference makes carrier that dual mode and host bacterium chromosomal integration be arranged.The dna fragmentation that produces when digested vector is during with 5 ' AOX1 and 3 ' AOX1 two ends homology, and linearized vector DNA can directly substitute genome AOX1, and the unit point displacement has promptly taken place, generation Mut
SThe positive recombinant bacterial strain of phenotype; In the time of in restriction enzyme site occurs in 5 of AOX1 ' end or HIS4 mark, linearized vector DNA will integrate at genomic homologous site, and the Mut phenotype is determined by the host bacterium.Pichia pastoris phaff has the posttranslational modification function, as signal peptide processing, protein folding, disulfide linkage formation and glycosylation etc., its glycosylation site is identical with other mammalian cells, be Asn-X-Ser/Thr, the sugar chain of generation is shorter, generally has only 8～14 mannose residues, no terminal α-1 on the core oligomerization sugar chain, 3 glycosidic links, antigenicity is lower, is particularly suitable for producing pharmaceutical recombinant protein.
3.cDNA sequencing
Use sequencing primer 5 ' AOXI Pichia and 3 ' the AOXI Pichia sequencingprimer (available from Invitrigen company) of pPIC9K to carry out forward and reverse order-checking respectively.Above-mentioned order-checking collection of illustrative plates is used tricks to calculate machine-readable preface and integrated forward and reverse sequencing result, obtain rhNGF cDNA sequence and translate into corresponding amino acid (Fig. 2).Sequencing result and bibliographical information (UllrichA, GrayA, Berman C, et al, Nature, 1983, Vol.303, cDNA base and the consensus amino acid sequence of rhNGF 821-825).Show that it is correct that the inventor clones the rhNGF cDNA that obtains.The total order of the expression plasmid pPKLNGF that makes up is classified as: rhNGF cDNA sequence+pPIC9KL plasmid sequence, the pPIC9KL plasmid sequence is compared with the pPIC9K plasmid sequence, except the Xho I enzyme restriction enzyme site of non-polylinker 5 ' end by 5 ' CTCGAG 3 ' (pPIC9K) become 5 '-C--G-3 ' (pPIC9KL), other sequence unanimity (seeing the products catalogue pPIC9K of Invitrogen company standard sequence).
4. yeast conversion
The preferred pichia spp GS115 of host bacterium.The genotype of GS115 (available from Invitrogen company) is: his4 mut
+
The making method of competent cell is as follows: (YeastExtract 1% with the single colony inoculation 5mL of GS115 YPD, Peptone 2%, and Dextrose 2%) liquid nutrient medium, 30 ℃ of incubated overnight, get 1mL and be transferred to continuation cultivation in the 200mLYPD substratum, as its OD6
00 reachesDuring to 1.5 left and right sides, stop to cultivate, centrifugal (5000rpm) collects thalline, use deionized water and 1mol/L Sorbitol Powder (D-Sorbitol then respectively, Sigma) respectively wash 2 times, the 1mol/L Sorbitol Powder that adds the 1mL precooling at last is distributed into standby pichia spp competent cell by every pipe 100 μ L, is stored in-70 ℃.
Yeast conversion adopts the method for electroporation.The electroporation working method is as follows: with Sal I digested plasmid pPKLNGF, change linearizing Yeast expression carrier plasmid over to the GS115 competent cell again.After getting linear DNA 0.3 μ g and 100 μ L competent cells mixing, inject the 0.2cm electric shock cup (Bio-Rad) of precooling, rap the electric shock cup, make mixture fall into electric shock cup bottom, going up setting voltage at electric shock instrument (Bio-Rad) is 1.5kV, electric capacity is 25 μ F, and resistance is 400 Ω, carries out the electroporation operation.Behind the electroporation, the 1mol/L Sorbitol Powder that adds the 0.9mL precooling immediately is in the electric shock cup, and sucking-off 200 μ L therefrom behind the mixing are coated with MDS immediately and transform substratum (1.34%YNB, (4 * 10
-5) %Biotin, 1%Dextrose 1mol/LD-Sorbitol), is inverted dull and stereotypedly in 30 ℃ then, cultivates that transformant begins appearance after 2 days.
5. the screening of yeast transformant
The fragment that contains AOX1-hNGF gene and His4 (histidine deaminase gene) sequence is inserted by homologous recombination or displacement is incorporated in the yeast genes group on the His4 gene.Because expression vector contains kalamycin resistance gene, it can make yeast cell that G418 is produced resistance.The G418 resistance level is depended on that substantially kalamycin resistance gene is incorporated into the number in the yeast genes group.Therefore the G418 by different concns screens and obtains the multiple copied transformant.On the transformant coated plate MD substratum, cultivate after 3 days for 30 ℃, the transformant of growing on the MD substratum is scraped with toothpick, be diluted to every milliliter 10 with sterilized water
5Individual cell is got the G418-MD flat board that 200 μ l coat different concns again, and G418 concentration is respectively 1.0,2.0,4.0mg/mL.Cultivate 48h and filter out the multiple copied transformant.The result screens 3 multiple copied transformants on the MD of 4mg/mL G418 flat board.
PCR checking and multiple copied number are estimated: picking multiple copied transformant list bacterium colony, the genomic dna of extraction transformant is that primer carries out pcr amplification with 5 ' AOXI Pichia and 3 ' AOXI Pichia sequencing primer respectively.The pcr amplification product agarose electrophoresis checks that 3 multiple copied transformants all produce the DNA band of 1.1kb, and are promptly all positive.Aforesaid operations carries out with reference to Invitrogen company multicopyexpression kit manual specification sheets.Above-mentioned transformant is expressed with shaking bottle, obtain the rhNGF Yeast engineering bacteria, called after PKLN-2.
6.rhNGF the calibrating and the expression of Yeast engineering bacteria (PKLN-2)
6.1 methyl alcohol utilizes phenotype analytical
Yeast engineering bacteria PKLN-2 clone is carried out methyl alcohol utilize phenotype analytical.Through MM and MD substratum growth fraction, determine that the methyl alcohol of Yeast engineering bacteria pPKLN-2 utilizes phenotype to be Mut
+
6.2 antibiotics resistance feature
Unconverted host bacterium GS115 grows on the YPD substratum, and (4mg/mL G418) do not grow on the G418-YPD substratum.
Engineering bacteria PKLN-2 after the conversion is at well-grown on the YPD substratum and on the G418-YPD substratum.
The above results shows that Yeast engineering bacteria PKLN-2 has the resistance of kantlex (G418).
6.3 the expression of engineering bacteria and expression product analysis
PKLN-2 colony inoculation 10ml yeast perfect medium (1.18%KH
2PO
4, 0.3%K
2HPO
43H
2O, 1% glycerine, 1.34%YNB, 4 * 10
-7Vitamin H), in 28 ℃ of shaking culture 8h, add the 90mL fresh culture then.Shaking culture 20h again.Adding methyl alcohol carries out 48h induces, and behind the medium centrifugal, gets supernatant and carries out the SDS-PAGE analysis, and detect the biological activity of NGF in the supernatant.The secreting, expressing amount of PKLN-2 is about every milliliter of culture supernatant secreting, expressing 160 μ g, and the hNGF that SDS-PAGE electrophoretic band scanning analysis is expressed accounts for 28.7% of total protein of cell amount.Its purity of purified back can reach more than 98%.Chick embryonic dorsal root ganglion with 8～9d age is measured its biologic activity, and the result shows that it has the effect of tangible promotion DRG enation, is higher than 1 * 10 by calculating its biologic activity
5U/mg.Electrophoresis and biological activity result show that all rhNGF is secreted in the nutrient solution by pichia spp, and have natural bioactive.
The SDS-PAGE electrophorogram is seen Fig. 3.
Through hydrophobic chromatography post and CM-Sepharose chromatography column purifying, promptly get the rhNGF of purifying, the rhNGF of purifying does immunoblotting and identifies that result and anti-ngf antibodies are positive, and the immunoblotting qualification result is seen Fig. 4.
Use Yeast engineering bacteria PKLN-2, under above-mentioned culture condition, the target protein purified product N terminal sequence of secreted expression is measured and is shown the N terminal amino acid sequence that meets designed rhNGF, i.e. signal peptide cutting is correct.
According to above verification result, show: engineering bacteria PKLN-2 is the yeast expression engineering bacteria of rhNGF, and the expression and purification technology of Jian Liing is feasible therefrom.
The construction and expression of [embodiment 2] recombinant human nerve growth factor pichia yeast expression systems (pPIC9K-NGF)
1.hNGF the pcr amplification of gene
1.1 the extraction of human blood leukocyte's genomic dna
The preparation method is with embodiment one.
1.2 design of primers is synthetic and the PCR reaction
Gene order (Ullrich A, Gray A, Berman C, the et al of the hNGF of reference report, Nature, 1983, Vol.303,821-825), a pair of primer has been synthesized in design, so that clonal expression has been introduced EcoR I and Not I restriction enzyme site respectively at its two ends, primer is as follows:
Primer 1:5 '
GAATTCTTA TCT CAC AGC CTT CC
EcoR?I
Primer 2: 3 '
CGCCGGCGAAT AGT AGA CTG TCG GAA AGA 5 '
Not?I
Normal people's blood leukocytes genomic dna of getting said extracted is a template, carries out pcr amplification respectively with primer 1, primer 2, and amplification condition is: 94 ℃ of sex change 50sec, and 55 ℃ of annealing 60sec, 72 ℃ are extended 90sec, carry out 35 circulations altogether.The PCR product reclaims through 1.2% agarose gel electrophoresis.
2. the structure of recombinant plasmid pPIC-NGF
Above-mentioned pcr amplified fragment is cloned into (Promega company, experimentation is pressed the Promega specification sheets) on the pGEM-T easy carrier, adopts Calcium Chloride Method to transform transformed into escherichia coli JM109, obtain recombinant plasmid, called after pT-NGF.After plasmid pT-NGF and expression plasmid of yeast pPIC9K cut with EcoR I and the two enzyme enzymes of Not I respectively, reclaim fragment, under the effect of T4 dna ligase, connect, obtain recombinant expression plasmid, called after pPIC-NGF.
3. pichia spp transforms
The preferred pichia spp GS115 of host bacterium (available from Invitrogen company) in the present embodiment.
The preparation of competent cell: the preparation method is with embodiment one.
The pichia spp electricity transforms: after expression plasmid of yeast pPIC-NGF cut with Sac I enzyme, electricity transformed pichia spp GS115, and electric method for transformation is with embodiment one.
4. the screening of yeast transformant
With the yeast transformant of above-mentioned structure, press the method screening positive transformant of embodiment one.The result screens 6 multiple copied transformants on the MD of 4mg/mL G418 flat board.
PCR checking and multiple copied number are estimated with embodiment one.Above-mentioned transformant is expressed with shaking bottle, choose No. 5 higher transformed bacterias of expression level as the rhNGF Yeast engineering bacteria, called after PPIC-5.
5.rhNGF the calibrating and the expression of Yeast engineering bacteria (PPIC-5)
5.1 methyl alcohol utilizes phenotype analytical
Experimental technique is with embodiment one, and the result shows that the methyl alcohol of Yeast engineering bacteria PPIC-5 utilizes phenotype to be Mut
+
5.2 antibiotics resistance feature
Experimental technique is with embodiment one, and the result shows that Yeast engineering bacteria PPIC-5 has the resistance of Kanamycine (G418).
5.3 the expression of engineering bacteria and expression product analysis
Experimental technique is with embodiment one.
Get the fermentation supernatant and carry out the SDS-PAGE analysis, can see an obvious expression band, molecular weight is 28kD, has an obvious band correspondence 14kD in the abduction delivering bacterial strain sample of depolymerization fully, and this is suitable with the monomeric molecular weight of NGF.Through the electrophoresis scanning analysis, hNGF accounts for the extracellular and secretes 12.6% of total protein concentration, and Western blotting detects and shows to have immunocompetence.Use the engineering bacteria PPIC-5 that makes up to express rhNGF, behind hydrophobic chromatography post and CM-Sepharose chromatography column purifying, promptly get the rhNGF of purifying, by analysis, the purity of rhNGF can reach 95%.The rhNGF of purifying does the biological activity analysis, and its activity is about 7 * 10
4U/mg.Electrophoresis and biological activity result show that all rhNGF is secreted in the nutrient solution by pichia spp, and have natural bioactive.
According to above verification result, show: engineering bacteria PPIC-5 is the yeast expression engineering bacteria of rhNGF, and the expression and purification technology of Jian Liing also is feasible therefrom.But, adopt plasmid pPIC9KL to compare with the rhNGF that pPIC9K expresses, plasmid pPIC9KL expresses has remarkable advantages: improved plasmid pPIC9KL has single Xho I restriction enzyme site, guaranteed that yeast expression excretory rhNGF is complete, and consistent with natural hNGF N terminal amino acid sequence; And the pPIC9K plasmid has two XhoI sites, inserts behind the hNGF cDNA yeast expression excretory rhNGF and has more than natural hNGF or reduce several amino acid, and excretory hNGF biological activity and purity are all low.(i.e. the aminoacid sequence of the hNGF that usefulness yeast expression system pPIC9K expression is handled and natural NGF sequence are inconsistent.) because embodiment one has introduced yeast alpha factor signal peptide cleavage site AAA AgA, therefore, have and more stablely, outer secrete expression.Adopt no terminal α-1,3 seminose on the expressed rhNGF core oligomerization sugar chain of carrier pPIC9KL, antigenicity is lower, and activity is not had negative impact substantially, is particularly suitable for medicine production and uses recombinant protein.Therefore, the engineering bacteria PKLN-2 that preferably makes up of the present invention comes the express recombinant growth factor of human nerve.
The fermentation of [embodiment 3] recombinant human nerve growth factor pichia spp (PKLN-2), purifying preparation
The Yeast engineering bacteria PKLN-2 that makes up in the present embodiment preferred embodiment one carries out the fermentation expression of rhNGF.
1, actication of culture
Get frozen glycerine bacterial strain, draw the YPD flat board, 28 ℃ of incubation activation 48h.
2, first order seed is cultivated
Get 50mL BMG shake-flask culture base, insert the dull and stereotyped activatory bacterium colony of YPD, 28 ℃, 250rpm shaking culture 24h are to bacterium liquid OD
600Be about 11.
3, secondary seed is cultivated
Get fresh BMG substratum (volume be last tank base material volume 10%), insert primary seed solution by 1～2% in secondary seed solution, add 10 * YNB and 500 * Biotin in the inoculation forward direction seed liquor, 28 ℃, 250rpm shaking culture 24h are to bacterium liquid OD
600Be about 20.
4, high density fermentation is expressed
In the fermenting process, temperature is set at 28 ℃, and dissolved oxygen content (DO) is controlled at more than 30%, and pH is set at 5.2 in the training period, and 2～3 h reduce pH to 5.0 gradually before preparation is induced, and the pH that induces in the process is maintained about 5.0.
The prerequisite of adding glycerine should be jar interior glycerine consumption (shows as DO and rise to 70～80% rapidly) fully, and control DO by regulating glycerine speed this moment, and it is maintained more than 30%.The Best Times of adding glycerine is generally fermentation culture 18～20h.
Finish when glycerine stream adds, jar internal carbon source consumption is complete, and the DO fast rise can begin abduction delivering.Earlier with manually adding small amount of methanol, treat that this part methyl alcohol is consumed to finish, yeast adapted to methyl alcohol as nutritious carbon sourc after, begin to add methyl alcohol from lower velocity stream.Induce the flow acceleration that passes through to regulate methyl alcohol in the process, keep DO more than 30%.Best induction time is 48～72h.
5, supernatant liquor separates
Fermentation ends, through 5, the centrifugal 30min of 000rpm gets supernatant, abandons the precipitation thalline under 4 ℃ of conditions, keeps supernatant liquor.
6, ultrafiltration and concentration
Fermented supernatant fluid after centrifugal to 1/5 of fermentating liquid volume, adds 3 times of volume pH and is 4.5 20mmol/L acetate buffer solution through 5,000 MWCO ultra-filtration membrane ultrafiltration and concentration, continues ultrafiltration and concentration, repeats aforesaid operations 3 times.Get then concentrated solution under 4 ℃ of conditions through 10,000rpm is centrifugal, and 20min removes precipitation, gets supernatant liquor, places 4 ℃ to preserve standby or be directly used in next step purifying.
7, hydrophobic chromatography
The condition of hydrophobic chromatography purifying is: filler is Sepharose C
4Envrionment temperature is 4 ℃; Damping fluid is concentration 1.0mol/L (NH
4)
2SO
4/ 20mmol/L acetate buffer solution (pH4.5); Elutriant is respectively 0.5～0.2M (NH
4)
2SO
4/ 20mmol/L acetate buffer solution (pH4.5), 20mmol/L acetate buffer solution (pH4.5).
8, ion-exchange
The condition of ion-exchange purification is: filler is CM Sepharose F.F.; Envrionment temperature is 4 ℃; Damping fluid is 20mmol/L acetate buffer solution (pH4.5); Elutriant is respectively 0.1～0.15mol/L NaCl/20mmol/L acetate buffer solution (pH4.5), 0.3～0.5mol/L NaCl/20mmol/L acetate buffer solution (pH4.5).
9, desalination
Collection of ions exchange purifying elution samples is a damping fluid with 20mmol/L acetic acid-sodium-acetate (pH4.5), crosses the G-25 gel, collects ultraviolet absorption peak, promptly obtains purity＞98%, and biological specific activity is higher than 10
5The pure product of the hNGF of U/mg.
Show that by experiment yeast expression system can be used for the express recombinant growth factor of human nerve.
The contrast experiment finds that the rhNGF that expresses with pichia yeast expression system pPIC9KL-NGF accounts for 28.7% of total protein of cell amount, and behind the purifying, its purity reaches more than 98%, and biologic activity is higher than 1 * 10
5U/mg, and the rhNGF that expresses with the pPIC9K-NGF expression system accounts for 12.6% of total protein of cell amount, behind the purifying, its purity can only reach 95%, and biologic activity also has only 7 * 10
4U/mg.Therefore, pichia yeast expression system pPIC9KL-NGF has obvious superiority.
Above embodiment all can correctly be efficiently expressed the engineering strain of rhNGF, obtains the rhNGF of high biologic activity.Pichia pastoris phaff (Pichia Pastoris), expression vector plasmid pPIC9KL, host bacterium GS115 are as optimal selection.
Above detailed description of the present invention does not limit the present invention, and those skilled in the art can make various changes and distortion according to the present invention, only otherwise break away from spirit of the present invention, all should belong to the defined scope of claims of the present invention.
Claims (10)
1, a kind of expression vector of expressing human nerve growth factor inserts the encode gene of growth factor of human nerve of synthetic expression plasmid pPIC9KL and makes up, and it has structure shown in Figure 1.
2, the described expression vector of claim 1 is characterized in that described expression plasmid pPIC9KL makes up by following method:
1) plasmid pPIC9K is cut with XhoI enzyme enzyme, after klenow enzyme benefit is flat, use T
4DNAligase connects, and changes bacillus coli DH 5 alpha over to;
2) cultivate and collect thalline, extract plasmid, order-checking selects the Xho I enzyme restriction enzyme site of non-polylinker5 ' end to cut and mend flat plasmid, obtains the pPIC9KL plasmid.
3, a kind of expression system of expressing human nerve growth factor, it contains by the described expression vector of claim 1.
4, the described expression system of claim 3 is characterized in that described expression system is formed by described expression vector transformed yeast host structure.
5, the described expression system of claim 4 is characterized in that described yeast host is pichia pastoris phaff (Pichia Pastoris).
6, the described expression vector of a kind of employing claim 1 prepares the recombinant human nerve growth factor method, comprises the steps:
1) will the encode gene of growth factor of human nerve is operably connected to expression vector pPIC9KL, the recombinant expression vector of construction expression growth factor of human nerve;
2) with described recombinant expression vector transformed yeast host, the yeast expression system of construction expression growth factor of human nerve;
3) cultivate described yeast expression system, obtain recombinant human nerve growth factor.
7, the described method of claim 6 comprises following step in the wherein said step 1):
1.1) adopt the pPIC9K plasmid construction to contain the plasmid pPIC9KL of single XhoI enzyme restriction enzyme site;
1.2) gene of the growth factor of human nerve of will encoding is operably connected to expression vector, makes up the recombinant expression vector pPKLNGF that contains growth factor of human nerve.
8, the described method of claim 7 is wherein in aforesaid method step 1.1) in, the step that makes up the plasmid that contains single XhoI enzyme restriction enzyme site comprises:
1.1.1) plasmid pPIC9K is cut with XhoI enzyme enzyme, after klenow enzyme benefit is flat, use T
4DNAligase connects, and changes bacillus coli DH 5 alpha over to;
1.1.2) cultivate and collect thalline, extract plasmid, order-checking selects the XhoI enzyme restriction enzyme site of non-polylinker5 ' end to cut and mend flat plasmid, obtains the pPIC9KL plasmid.
9, the described method of claim 7 is wherein in step 1.2) in, the preparation process that contains the recombinant expression vector pPKLNGF of growth factor of human nerve comprises:
1.2.1) classify primer as with following synthetic nucleotides sequence:
Primer 1:5 ' CTCGAGAAAAGATCTTCTTCTCACCCAATC3 '
Primer 2: 3 ' CGCCGGCGAATAGTAGACTGTCGGAAAGA5 '
With normal people's blood leukocytes genomic dna is template, carries out pcr amplification respectively;
1.2.2) from the PCR product that obtains, reclaim synthetic recombinant human nerve growth factor dna fragmentation, insert carrier pPIC9KL, obtain to contain the recombinant expression vector pPKLNGF of growth factor of human nerve.
10, the described method of claim 6 wherein further comprises the step of the recombinant human nerve growth factor purifying that will obtain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101232242A CN100357441C (en) | 2005-11-15 | 2005-11-15 | Yeast expressing system of recombined human nerve growth factor and process for preparing recombined human nerve grouth factor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101232242A CN100357441C (en) | 2005-11-15 | 2005-11-15 | Yeast expressing system of recombined human nerve growth factor and process for preparing recombined human nerve grouth factor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1793375A CN1793375A (en) | 2006-06-28 |
| CN100357441C true CN100357441C (en) | 2007-12-26 |
Family
ID=36805026
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005101232242A Expired - Fee Related CN100357441C (en) | 2005-11-15 | 2005-11-15 | Yeast expressing system of recombined human nerve growth factor and process for preparing recombined human nerve grouth factor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100357441C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831455A (en) * | 2010-04-20 | 2010-09-15 | 刘振平 | Yeast expression system for expressing glycosylated interferon and method for preparing recombinant glycosylated interferon |
| CN106148349A (en) * | 2016-06-20 | 2016-11-23 | 深圳职业技术学院 | Recombinant human nerve growth factor gene, expression vector and the method preparing recombinant human nerve growth factor |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101260398B (en) | 2007-03-07 | 2013-06-05 | 舒泰神（北京）生物制药股份有限公司 | Nerve growth factor gene positioning reconstruction animal and its preparation method and application |
| CN103060249B (en) * | 2012-06-06 | 2015-12-16 | 浙江普洛康裕制药有限公司 | Colon bacillus and the method by its efficient secretory expression human epidermal growth factor |
| CN103014048A (en) * | 2012-11-19 | 2013-04-03 | 厦门北大之路生物工程有限公司 | Preparation method and application of target protein |
| CN102978211B (en) * | 2012-11-19 | 2015-04-08 | 未名生物医药有限公司 | Interest protein preparation method and purpose thereof |
| CN103417955A (en) * | 2013-09-09 | 2013-12-04 | 东北农业大学 | Medical application of nerve growth factor in prevention of peripheral neuropathy caused by colistin |
| CN112439053B (en) * | 2019-08-29 | 2024-08-02 | 江苏中新医药有限公司 | Use of long-acting protein preparation for improving sexual dysfunction |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH03139285A (en) * | 1989-07-27 | 1991-06-13 | Takeda Chem Ind Ltd | Production of human nerve growth factor by yeast |
| CN1410539A (en) * | 2002-11-15 | 2003-04-16 | 王革 | Recombinant human nerve growth factor expressed using yeast secretion |
-
2005
- 2005-11-15 CN CNB2005101232242A patent/CN100357441C/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH03139285A (en) * | 1989-07-27 | 1991-06-13 | Takeda Chem Ind Ltd | Production of human nerve growth factor by yeast |
| CN1410539A (en) * | 2002-11-15 | 2003-04-16 | 王革 | Recombinant human nerve growth factor expressed using yeast secretion |
Non-Patent Citations (2)
| Title |
|---|
| 人神经生长因子β亚基的基因在P.pastoris和E.coli中的表达 范乔，刘宏迪，孙彤，赫荣乔.科学通报，第44卷第6期 1999 * |
| 人神经生长因子的A-T克隆及在Pichia pastoris酵母中的表达 舒红，任常山.中国现代医学杂志，第14卷第11期 2004 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831455A (en) * | 2010-04-20 | 2010-09-15 | 刘振平 | Yeast expression system for expressing glycosylated interferon and method for preparing recombinant glycosylated interferon |
| CN106148349A (en) * | 2016-06-20 | 2016-11-23 | 深圳职业技术学院 | Recombinant human nerve growth factor gene, expression vector and the method preparing recombinant human nerve growth factor |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1793375A (en) | 2006-06-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100357441C (en) | Yeast expressing system of recombined human nerve growth factor and process for preparing recombined human nerve grouth factor | |
| CN102154189B (en) | A kind of fermentation culture method of rhG-CSF recombinant bacterial strain | |
| CN102443057A (en) | Recombinant humanized collagen and its preparation method | |
| CN101492675A (en) | Method for producing recombinant human epidermal growth factor acceptor 2 cytoplasmic region with methylotrophy yeast | |
| CN101974587A (en) | Efficient expression method of human serum albumin | |
| WO2023056891A1 (en) | Engineering yeast strain for producing hyaluronidase at high yield and use thereof | |
| CN105543144A (en) | Culture medium of Escherichia coli suitable for expressing crybb2 antigen protein, and fermentation method and application thereof | |
| CN101665798B (en) | Method for preparing recombinant human serum albumin and interferon alpha fusion protein | |
| CN101450961B (en) | Artificial synthetic porcine interferon and method for preparing porcine interferon | |
| CN106337054A (en) | Method for preparing high activity recombinant porcine epidermal growth factor | |
| CN100348720C (en) | Mannase and its coding gene and uses | |
| CN117903319A (en) | Human lactoferrin peptide trimer fusion protein, and preparation method and application thereof | |
| CN112608963A (en) | Method for culturing pichia pastoris engineering bacteria through semi-continuous fermentation | |
| CN103966253A (en) | Method for efficiently preparing recombinant human interluekin-33 protein | |
| CN108251375B (en) | Method for producing recombinant human interleukin-12 by fermentation | |
| CN105734066B (en) | A kind of building of the eukaryon Hansenula yeast engineering bacteria containing recombinant hepatitis B virus gene and the production method of hepatitis B surface antigen | |
| CN116082494A (en) | Recombinant human III type collagen polypeptide, expression vector, expression strain and construction method thereof | |
| CN1544640A (en) | Expression method for high temperature resistant xylanase and specific expression carrier for same | |
| CN101684475A (en) | Construction and application of recombinant pichia pastroris engineering bacteria | |
| CN105755035B (en) | A kind of building of Hansenula yeast specific expression vector and hepatitis B virus surface antigen is being improved in the method for expressed by Hansenula yeast amount | |
| CN101649340A (en) | Method for preparing human interleukin-18 | |
| CN101831455A (en) | Yeast expression system for expressing glycosylated interferon and method for preparing recombinant glycosylated interferon | |
| CN103773793A (en) | Method for efficiently expressing human serum albumin | |
| CN101492674A (en) | Method for producing human amyloid A<beta>1-42 with methylotrophy yeast | |
| CN102367468B (en) | Method for quickly and efficiently screening L-arginine-producing strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20071226 Termination date: 20101115 |