CN1226413C - Trichina TS88 gene, their protein products and uses - Google Patents
Trichina TS88 gene, their protein products and uses Download PDFInfo
- Publication number
- CN1226413C CN1226413C CNB200310114934XA CN200310114934A CN1226413C CN 1226413 C CN1226413 C CN 1226413C CN B200310114934X A CNB200310114934X A CN B200310114934XA CN 200310114934 A CN200310114934 A CN 200310114934A CN 1226413 C CN1226413 C CN 1226413C
- Authority
- CN
- China
- Prior art keywords
- sequence
- polynucleotide molecule
- ser
- protein
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention relates to a new polynucleotide molecule from a trichina, a recombinant vector containing the polynucleotide molecule, a coded protein and an antibody generated by a protein immunity animal. The present invention also relates to the application of the polynucleotide molecule, the protein and the antibody.
Description
Invention field
The present invention relates to a kind of new nucleic acid molecule, contain the reorganization of this nucleic acid, coded protein and the antibody that produces by described protein immune animal from Trichinella spiralis.The invention still further relates to the application of described nucleic acid, protein and antibody.
Background technology
Trichina(Trichinella spiralis) (Trichinella spiralis, be called for short Trichinella spiralis), but infected person and more than 150 kind of animal, and its caused trichonematosis is a kind of infecting both domestic animals and human parasitosis, be global distribution, seriously threatened human health and livestock industry is caused the tremendous economic loss.Trichinella spiralis is summarized as follows the life history: when human or animal host eats raw or half a lifetime food contains the meat (pork, dog meats etc.) of Trichinella spiralis Nang Bao, in the capsule bag larva to overflow under gastric juice, intestinal juice effect and grow in small intestine be adult.Female, male worm After mating worm produces newborn larvae.Newborn larvae is invaded intestinal mucosa lymphatic vessel or vein, arrives host's voluntary muscle with lymph and circulation of blood and continues to grow.The pathogenic course of Trichinella spiralis was divided into for three phases: stage of invasion, larval migration and Nang Bao form the phase, and promptly each link in this worm life history all can make the host cause a disease.
The trichonematosis complicated clinical manifestation is various, and diagnosis is difficulty, gives timely that treatment causes certain difficulty, and immunodiagnosis and prevention that therefore should disease become the task of top priority.Because pathogenic agent can not limit antigenic obtaining in the external cultivation of going down to posterity in a large number; The antigenic complicacy of Trichinella spiralis, diversity cause the antigen that does not still have ideal high sensitive, high specific at present as diagnosis candidate antigens molecule in addition.
The objective of the invention is to: seek and the new gene of clone's Trichinella spiralis antigen, the recombinant protein of this gene is carried out the research of immunologic function, for trichinous immunodiagnosis provides new candidate antigens molecule.
Summary of the invention
One aspect of the present invention provides a kind of polynucleotide molecule, wherein comprises the nucleotide sequence shown in Fig. 1 (SEQ IDNO:1) or its height homologous sequence.
Another aspect of the present invention provides above-mentioned polynucleotide molecule encoded polypeptide (being called Ts88 albumen in the present invention sometimes), contains the recombinant vectors (comprising recombinant expression vector) and the host cell of above-mentioned polynucleotide molecule.
The present invention further provides the polypeptide of fusion rotein form, Trichinella spiralis Ts88 albumen of the present invention and carrier known in the art or fusion object merge in the described fusion rotein.The present invention further provides many skins of forming by above-mentioned proteinic essential part.Polypeptide of the present invention is applicable to that the trichinous vaccine composition neutralization of prevention Mammals is as diagnostic reagent.
The present invention further provides the method for preparing aforementioned polypeptides, it is included in cultivates under the condition that is suitable for express polypeptide with above-mentioned recombinant expression vector transformed host cells, said carrier comprises the polynucleotide molecule of the nucleotide sequence that contains the aforementioned polypeptides of encoding, but wherein said nucleotide sequence is connected with one or more regulatory elements with operating method; From cell culture, reclaim expressed polypeptide again.
Another aspect of the present invention provides the antibody at described polypeptide.
The present invention provides again and has been used for the trichonematosis diagnosis kits.
The present invention also provide can hybridize with described polynucleotide molecule or with have the oligonucleotide molecules that can hybridize as the polynucleotide molecule of the nucleotide sequence of the complement of polynucleotide molecule of the present invention.
Description of drawings
Fig. 1 is Ts88 full-length cDNA nucleotide sequence and coded proteinic aminoacid sequence.
Fig. 2 is the Southern results of hybridization of Trichinella spiralis Ts88 gene and the Trichinella spiralis genomic dna and the mouse gene group DNA of new clone.Wherein M is a dna molecular amount mark, and swimming lane 1 is a mouse gene group DNA, and swimming lane 2 is Trichinella spiralis genomic dnas.
Fig. 3 is inserted into the Ts88 construction of recombinant plasmid synoptic diagram that is built in pET-28c (+) prokaryotic expression carrier with the Ts88 gene.
Fig. 4 is the electrophorogram of the Trichinella spiralis Ts88 recombinant protein of expressing in the e. coli bl21 strain.Wherein M is a molecular weight protein marker, swimming lane 1 by the Ts88 recombinant plasmid transformed the lysate of e. coli bl21 strain when inducing without IPTG, swimming lane 2 by the Ts88 recombinant plasmid transformed the e. coli bl21 strain through IPTG induce, foreign protein elutriant after the affinity chromatography, swimming lane 3 is the collection liquid that contains the Ts88 recombinant protein of wash-out after the affinity chromatography, and swimming lane 4 is the Ts88 recombinant proteins behind the purification renaturation.The arrow indication is the recombinant protein band.
Fig. 5 is the immunological characteristic that the Western immunoblotting is identified the Ts88 recombinant protein.Wherein M is Marker molecular weight of albumen (19-206KD), swimming lane 1 is the Ts88 genetic expression albumen and the reaction of trichonematosis human serum of purifying, swimming lane 2 is Ts88 recombinant proteins and the porcine blood serum reaction of infecting Trichinella spiralis of purifying, swimming lane 3 is Ts88 recombinant proteins and the rabbit anteserum reaction of infecting Trichinella spiralis of purifying, swimming lane 4 is Ts88 recombinant protein and reactions of artificial immunization rabbit anteserum of purifying, and swimming lane 5 is Ts88 recombinant protein and reactions of Ts88 recombinant protein immune mouse serum of purifying.
Embodiment
Term used herein " polynucleotide molecule ", " polynucleotide sequence ", " encoding sequence ", " open reading frame (ORF) " etc. are meant strand or double-stranded DNA and RNA molecule, can comprise one or more protokaryon sequences, the cDNA sequence, the genomic dna sequence that comprises exon and intron, the DNA of chemosynthesis and RNA sequence, and justice and corresponding antisense strand are arranged.Term used herein " ORF " be meant the specific Trichinella spiralis protein of coding be Ts88 albumen required, without any the minimum nucleotide sequence of interference terminator codon.
The method of producing and operating polynucleotide molecule disclosed herein and oligonucleotide molecules is well known by persons skilled in the art, and can according to the recombinant technology of having described (referring to Maniatis etc., 1989,
Molecular cloning, laboratory manual, press of cold spring harbor laboratory, cold spring port, New York; Ausubel etc., 1989,
The molecular biology current techniques, Greene Publishing Associates ﹠amp; WileyInterscience, NY; Sambrook etc., 1989,
Molecular cloning, laboratory manual, the 2nd edition, press of cold spring harbor laboratory, cold spring port, New York; Innis etc. (volume), 1995,
PCR Strategy, Academic Press, Inc., San Diego; And Erlich (volume), 1992, round pcr, Oxford University Press, New York) finish.
The invention provides a kind of separation polynucleotide molecule that comprises the proteic nucleotide sequence of coding Trichinella spiralis Ts88.This polynucleotide molecule can be used for implementing the present invention.In further preferred embodiment, the isolating polynucleotide molecule of the present invention comprises the nucleotide sequence that is selected from the following member: the nucleotide sequence shown in (1) SEQ ID NO:1; (2) at least 70% identical with nucleotide sequence shown in the SEQ ID NO:1, preferred at least 80% identical, more preferably at least 90% identical, 95% identical nucleotide sequence most preferably; (3) under medium rigorous hybridization conditions (promptly at 0.5M NaHPO
4, in 7% sodium lauryl sulphate (SDS), 1mM EDTA in 65 ℃ with the DNA hybridization that is incorporated into filter membrane, and in 0.2 * SSC/0.1%SDS in the condition of 42 ℃ of washings; Referring to (volumes) such as Ausubel, 1989,
The molecular biology current techniques, the 1st volume, Green Publishing Associntes, Inc., and John Wiley ﹠amp; Sons, Inc., NY, P.2.10.3), the rigorous hybridization conditions of preferred heights is (promptly at 0.5M NaHPO
4, among 7%SDS, the 1mM EDTA in 65 ℃ with the DNA hybridization that is incorporated into filter membrane, and in 0.1 * SSC/0.1%SDS in 68 ℃ of wash conditions; Consult Ausubel etc., 1989, above-mentioned document) the following nucleotide sequence that can hybridize with polynucleotide molecule with SEQ ID NO:1 or its complementary sequence; (4) with the protein of SEQ ID NO:1 coding identical sequence but because of the degeneracy of genetic code different nucleotide sequence on sequence; Perhaps arbitrary nucleotide sequence complementary nucleotide sequence in (5) and (1)-(4).
The said polynucleotide molecule of this paper " can be used for implementing the present invention " and is meant this polynucleotide molecule and can be used for standard amplification technique amplification Trichinella spiralis specificity polynucleotide molecule, or as diagnostic reagent in order to detect by the existence of Trichinella spiralis specificity polynucleotide in the animal body fluid of trichinzation or the tissue sample.
The present invention further provides and comprising coding with a kind of separation polynucleotide molecule that comes from the nucleotide sequence of peptide more than the Trichinella spiralis Ts88 albumen.Mention herein that employed term " homology " is meant that polypeptide had the proteic aminoacid sequence of Trichinella spiralis Ts88 originally when coming from the proteic polypeptide of Trichinella spiralis Ts88, but wherein one or more amino-acid residues are conservatively replaced by different amino-acid residues, and resulting polypeptide can be used for implementing the present invention.It is known in the art that conserved amino acid replaces.Cause the rule of such replacement to comprise, M.D. described replacement rules such as (1978, national biomedical research fund, Washington, D.C., the 5th volume, supplementary issue 3) by Dayhof.More particularly, the conserved amino acid replacement occurs in the amino acid family that is associated with its acidity, polarity or side chain size.Generally the amino acid of genetic coding can be divided into four groups: (1) acidic amino acid=aspartic acid, L-glutamic acid; (2) basic aminoacids=Methionin, arginine, Histidine; (3) nonpolar amino acid=L-Ala, Xie Ansuan, leucine, Isoleucine, proline(Pro), phenylalanine, methionine(Met), tryptophane; (4) uncharged polare Aminosaeren=glycine, l-asparagine, glutamine, halfcystine, Serine, Threonine, tyrosine.Phenylalanine, tryptophane and tyrosine also common category are aromatic amino acid.One or more replacements in any particular group, for example replace leucine or replace aspartic acid or replace Threonine with Serine with L-glutamic acid with Isoleucine or Xie Ansuan, or the amino-acid residue of being correlated with on any other amino-acid residue structure, similar acidity, polarity, side chain size are for example arranged, or have the amino-acid residue of similarity to replace in its some combined aspects, generally function or the immunogenicity to polypeptide do not have too big influence.
Basic homologous protein and polypeptide is characterized in that having one or more aminoacid replacement, deletion or interpolation.These change the less conversion of preferred influence, i.e. conserved amino acid replacement (seeing Table 2) and other can not have a strong impact on the folding and active replacement of protein or polypeptide; Little deletion, normally about 30 the amino acid whose little deletions of 1-; And little amino or C-terminal extension, such as the N-terminal methionine residues, reach the little connection peptides of about 20-25 residue, or be convenient to the little extension (affinity labelling) of purifying, as polyhistidine bundle, albumin A (Nilsson etc., EMBO J.4:1075,1985; Nilsson etc., Enzymology method, 198:3,1991).The DNA of coding affinity labelling can buy from product vendor.
Said herein polypeptide " can be used for implementing the present invention " and is meant that this polypeptide can be used as diagnostic reagent, with detect recently by trichinzation or existing by Trichinella spiralis specific antibody in the animal blood of trichinzation or the serum sample.
The present invention further provides the polynucleotide molecule of forming by the essential part of Trichinella spiralis Ts88 dependency polynucleotide molecule of the present invention." essential part " of Trichinella spiralis Ts88 dependency polynucleotide molecule in this article refers to forms the complete nucleotide sequence of going up less than Ts88 dependency polynucleotide molecule, but comprise Ts88 dependency polynucleotide molecule nucleotide sequence at least about 5%, preferably at least about 10%, and can be used for implementing polynucleotide molecule of the present invention.
The present invention further provides with the above-mentioned polynucleotide molecule of the present invention and can hybridize, or with have the polynucleotide molecule that can hybridize as the polynucleotide molecule of the nucleotide sequence of the complement of the above-mentioned polynucleotide molecule of the present invention.Such oligonucleotide molecules better is to be about 15nt at least, is more preferably and is about 25nt, and 50nt especially at least, and can be under the height stringent condition and one or more above-mentioned polynucleotide molecules hybridization.Said height stringent condition is to wash film in the 6XSSC/0.5% trisodium phosphate, and washes film temperature and be about 37 ℃ for being about 14 base persons, is about 17 base persons and is about 48 ℃, is about 20 base persons and is about 55 ℃, is about 23 base persons and is about 60 ℃.Other hybridization conditions than the long oligonucleotide molecule of the present invention can be determined according to standard technique by those skilled in the art.In a preferred embodiment, oligonucleotide molecules of the present invention is complementary to the above-mentioned polynucleotide molecule of a present invention part one of at least.
Oligonucleotide molecules of the present invention can be used for multiple purpose, comprising as the primer of amplification Trichinella spiralis specificity polynucleotide molecule being used for such as disease differential diagnosis, perhaps coding or as the antisense molecule of generegulation.With regard to the diagnosis aspect, can use the primer of suitable design to detect the existence of Trichinella spiralis specificity polynucleotide molecule in the samples such as animal tissues or body fluid.The generation of specific amplification products can be supported the diagnosis of trichinzation, and the product that lacks amplification then may not indicated not infection.For example in people's (1995, the source is the same) such as Innis and Erlicch (1992, the source is the same) editor's the aforementioned documents method that increases has been described, for example polymerase chain reaction (PCR) method.Other amplification techniques known in the art also can use, for example the ligase chain reaction method.Also can use the sequences Design of polynucleotide molecule disclosed herein to be used for separating homogenic primer from other kinds or the strain system of Trichinella spiralis.
The present invention further provides the cloning vector, the expression vector that comprise polynucleotide molecule of the present invention, comprise any said carrier by transformed host cell, and by its deutero-new strain system or clone.In a preferred embodiment, the invention provides the recombinant vectors that comprises a kind of polynucleotide molecule, said polynucleotide molecule has the proteic nucleotide sequence of coding Trichinella spiralis Ts88.
Preferably, the building mode of recombinant vectors of the present invention, particularly expression vector can make polynucleotide molecule of the present invention encoding sequence with transcribe the one or more regulatory element operability ground required and be connected with translating encoding sequence, with the generation polypeptide.Term used herein " regulatory element " comprises but is not only limited to coding induction type and non-inducible promoter, enhanser, operon and the nucleotide sequence that can be used for driving and/or regulate other element that the polynucleotide encoding sequence expresses known in the art.In addition, the said encoding sequence of this paper and one or more regulatory elements " are connected to operability " and are meant that regulatory element can regulate and allow to transcribe encoding sequence effectively or translate its mRNA, or bring into play the function of two aspects.
The method that structure comprises the recombinant vectors of the specific coding sequence that is connected with suitable regulatory element operability ground is known, and can use these methods to realize the present invention.These methods comprise genetic recombination (as the above-mentioned document referring to people such as Maniatis (1989)) in extracorporeal recombination, synthetic technology and the body.
The various carriers that can be used for expressing Trichinella spiralis Ts88 albumen coded sequence of the present invention are known in the art, comprising the recombinant phage dna that contains the specific coding sequence, plasmid DNA and cosmid DNA expression vector.The plasmid that can contain polynucleotide molecule of the present invention through processing comprises pUC8, pUC9, pBR322 and pBR329 (Biorad Laboratories, Richmond, CA), pPL and pKK223 (Pharmacia, Piscataway, NJ), pQE50 (Qiagen, Chatsworth, CA) and pGEM-T EASY (Promega, Madison, WI) etc.The typical carrier for expression of eukaryon that can contain polynucleotide molecule of the present invention through processing comprises moulting hormone induction type mammalian expression system (Invitrogen, Carlsbad, CA), based on system (Promega, Madison, the WI of cytomegalovirus promoter-enhanser; Stratagene, La Jolla, CA; Invitrogen) with based on expression system (Promega) of baculovirus etc.
The regulatory element of these and other carriers can have nothing in common with each other aspect its intensity and the specificity.Based on the host/vector system that is utilized, can use multiple suitable in the element any transcribed and translate.For example, when in the mammal cell line system, cloning, can use isolating promotor from the mammalian cell genome, as the mouse metallothionein promoter, or from grow in these intracellular viruses isolating promotor, as vaccinia virus 7.5K promotor or Moloney muroid sarcoma virus long terminal repeat.Can use the promotor that obtains with recombinant DNA or synthetic technology to transcribe the sequence that is inserted into.In addition, at specific elicitor, for example be suitable under the existence of the zinc of metallothionein promoter and cadmium ion, the expression that is started by some promotor can be enhanced.The non-limitative example of transcriptional regulatory district or promotor comprises β-gal promotor, T7 promotor, TAC promotor, trp and lac promotor, the trp-lac promoter, fusion etc. that are used for bacterium; Be used for zymic glycolytic ferment promotor, as ADH-and ADH-II promotor, GPK promotor, PGI promotor, TRP promotor etc.; And the SV40 that is used for mammalian cell early stage and late promoter, adenovirus major late promoter etc.The present invention further provides the polynucleotide molecule of the nucleotide sequence of the promotor that comprises Trichinella spiralis Ts88 gene, it is used in and expresses encoding sequence of the present invention in the Trichinella spiralis.
Encoding sequence for translation sufficiently is inserted into also needs the specificity start signal.These signals generally comprise ATG initiator codon and flanking sequence.Under the polynucleotide molecule of the present invention of initiator codon that will comprise himself and flanking sequence is inserted into situation in the suitable expression, other translation control signal may needn't be added.Yet, when only inserting a part of encoding sequence, may need to comprise the external source translation control signal of ATG initiator codon etc.Can be from various sources, promptly natural and synthetic source obtains these external source translation control signal and initiator codons.Moreover initiator codon must be consistent with the frame of coding region, meets the translation of frame ground to guarantee whole insertion fragment.
Also can make up the expression vector that expression is comprised the fused protein of protein of the present invention or polypeptide and fusion object.Such fused protein for example can be used for producing the proteic antiserum(antisera) of anti-Trichinella spiralis, the proteic biochemical property of research Trichinella spiralis, through engineering approaches and modifies Trichinella spiralis albumen that performance has different immunologys or functional property, helps to identify or Trichinella spiralis albumen that purification of Recombinant is expressed or improve its stability.Possible fusion protein expression vector comprises but is not only limited to the carrier of the sequence of having inserted coding beta galactosidase enzyme and trpE syzygy, maltose binding protein syzygy, glutathione-S-transferase syzygy and polyhistidine syzygy (carrier zone).The method that can be used for making up these and other Expression of Fusion Protein carriers of coding is known in the art.
Available fused protein helps purifying expressed protein.In a non-limiting embodiments, can use amylose resin purifying Ts88-maltose associativity fusion rotein, glutathione agarose bead purifying Ts88-glutathione-S-transferase fused protein can be used, nickelous resin purification Ts88-polyhistidine fused protein can be used.Perhaps, also can use the antibody of anti-carrier protein or peptide that fused protein is carried out affinitive layer purification.For example, the nucleotide sequence through engineering approaches of target epi-position of coding monoclonal antibody can be transferred in the expression vector that is connected with regulatory element operability ground, and be limited its position so that expressed epi-position is fused on the Trichinella spiralis albumen of the present invention.In a non-limiting embodiments, the available standards technology is inserted coding FLAG on certain point of amino that is equivalent to Ts88 albumen or C-terminal
TMIn the nucleotide sequence of epi-position mark (it is a wetting ability mark peptide) (Znternational Biotechnologies Inc.), can use commercially available anti-FLAG then
TMTs88 albumen-FLAG that antibody test and affinity purification are expressed
TMEpi-position syzygy product.
Also can modify expression vector and make it to contain the polylinker sequence of encode specific protein enzyme cleavage site, thereby can handle and from the carrier zone or merge object and discharge the Trichinella spiralis albumen of having expressed through specific proteases.For example, the fusion rotein carrier can comprise the nucleotide sequence of coding zymoplasm or factor Xa cracking site.
The signal sequence that can use currently known methods will be arranged in Trichinella spiralis albumen coded sequence upstream and frame unanimity is worked into expression vector, to instruct expressed proteinic transportation and secretion.The limiting examples of signal sequence comprises the signal sequence of alpha factor, immunoglobulin (Ig), outer membrane protein, penicillinase and TXi Baoshouti etc.
In order to help to filter out host cell, can through engineering approaches modify the encoding sequence that carrier makes it further to comprise reporter gene product or other selection markers through recombinant vectors conversion of the present invention or transfection.Such encoding sequence better is connected with above-mentioned regulatory element operability ground.It is well known in the art being used to implement reporter gene of the present invention, comprises the gene of coding E.C. 2.3.1.28 (CAT), green fluorescent protein, firefly luciferase and human growth hormone etc.The nucleotide sequence of coding selection marker is known in the art, comprising that coding gives antibiotics resistance or metabolic antagonist resistance, or those nucleotide sequences of the gene product that auxotroph needs etc. are provided.The example of these sequences comprises the coding thymidine kinase activity, or those sequences of anti-methotrexate, penbritin, kantlex, paraxin, aminoglycoside or Totomycin etc.
The present invention further provides the transformed host cell that comprises polynucleotide molecule of the present invention or recombinant vectors, and by deutero-clone.Can be used for implementing host cell of the present invention can be eucaryon or prokaryotic cell prokaryocyte.Transformed host cell like this comprises but is not only limited to microorganism, for example use the bacterium of recombinant phage dna, plasmid DNA or the conversion of cosmid DNA carrier, the perhaps yeast that transforms with recombinant vectors, or zooblast, as insect cell with recombinant viral vector such as baculovirus infection, or with the mammalian cell of recombinant viral vector such as adenovirus or vaccinia virus infection etc.For example, can use coli strain, as DH5 α bacterial strain.Eukaryotic host cell comprises yeast cell, but also can effectively utilize mouse, mammalian cell such as hamster, ox, monkey or human cell line.The eukaryotic host cell that can be used for expressing recombinant protein of the present invention comprises Chinese hamster ovary (CHO) cell, NIH/3T3 etc.
Better be recombinant vectors of the present invention is transformed or transfection in one or more host cells of the basic homogeneous culture of cell.Generally can be according to known technique, for example protoplast transformation, calcium phosphate precipitation, calcium chloride processing, micro-injection, electroporation, contact through virus with reorganization infect, liposome-mediated technology such as transfection, the transfection of DEAE-dextran, transduction, joint or microparticle bombardment import carrier in the host cell.Can use standard method to select transformant, but for example express the method for the cell of selection marker relevant such as antibiotics resistance with recombinant expression vector by selection.
In case after expression vector imported host cell, the standard techniques such as pcr analysis that can use Southern hybridization analysis, restricted enzyme cutting analysis, comprise ThermoScript II PCR (rt-PCR) confirm whether polynucleotide molecule of the present invention is integrated and be retained in the host cell gene group or with the episome form and exist, perhaps use the protein of immunological detection detection of desired.A kind of evaluation in available following at least four kinds of general approach known in the art contains and/or expresses the host cell of polynucleotide molecule of the present invention: (i) DNA-DNA, DNA-RNA or RNA-sense-rna hybridization; (ii) detect the existence of " sign " gene function; The (iii) expression of detection specificity mRNA transcript in host cell is to estimate transcriptional level; Or (iv) detect existing of ripe polypeptide product with immunodetection known in the art.
In case with polynucleotide molecule of the present invention is stable import in the appropriate host cell after, can clonal expansion transformed host cells, and cultivate resulting cell helping maximum to produce under the condition of encoded polypeptide.Such condition generally comprises cultivates that cell transformed reaches high-density.When expression vector contains inducible promoter, can be as required, (as the carbohydrate analogue, for example isopropyl ss-D-thiogalactoside (IPTG), excess metabolism by product gather etc. suitably inductive condition with abduction delivering to utilize temperature change, nutrient substance to exhaust, add the gratuitous induction agent.
In the time of in polypeptide is retained in host cell, should gather in the crops and lysing cell, and under the extraction conditions that reduces protein degradation as far as possible known in the art, for example in 4 ℃ and/or have under the proteinase inhibitor existence condition, purifying or separated product basically from lysate.Can from host cell, secrete as polypeptide, then can collect the nutrient medium of having exhausted simply, and therefrom purifying or isolated polypeptide basically.
In case of necessity, can use standard method, comprise but be not only limited to ammonium sulfate precipitation, size fractionation separation, ion exchange chromatography, HPLC, density gradient centrifugation and affinity chromatography, purifying or isolated polypeptide basically from cell lysate or substratum.If polypeptide lacks biologic activity, then can do according to molecular size or with the reactivity of polypeptid specificity antibody, or detect it according to the existence of syzygy mark.Be used to implement when of the present invention, polypeptide can be to be secreted in the nutrient solution or to be present in not purified state in the cell lysate, but better is therefrom to obtain basic purifying or separation.Said herein polypeptide " basically purifying ", it is proteinic at least about 20% (weight) to be meant that this polypeptide constitutes in particular formulations.In addition, said herein polypeptide " separates ", refers to this polypeptide and constitutes in the particular formulations proteinic at least about 80% (weight).
Therefore, the invention provides purifying or isolating Trichinella spiralis Ts88 albumen basically by polynucleotide encoding of the present invention.In a preferred embodiment, Trichinella spiralis Ts88 albumen has the aminoacid sequence of Fig. 1 (SEQID NO:2).
The present invention further provides with coming from the proteic polypeptide of described Trichinella spiralis Ts88, wherein term " homology " has above the implication with regard to polypeptide limited.
The present invention further provides the polypeptide of forming by the essential part of any aforementioned polypeptides of the present invention." essential part " of term used herein-polypeptide of the present invention or " peptide fragment " mean form to go up less than the complete amino acid sequence of corresponding overall length polypeptide but comprise its aminoacid sequence at least about 10%, preferably at least about 20% and can be used for implementing polypeptide of the present invention (" can be used for " has above the implication with regard to polypeptide limited).Particularly preferably be and have immunogenicity the peptide fragment of (promptly can induction of immunity reaction and produce the antibody of anti-corresponding overall length Trichinella spiralis polypeptide specifically).
The present invention further provides the fused protein that comprises any aforementioned polypeptides that merges with carrier known in the art or fusion object.
Polypeptide of the present invention can be used for multiple purpose, comprises as diagnostic reagent, for example with the Trichinella spiralis specific antibody in standard detection methods such as ELISA detection screening animal blood or the serum sample; Or it is as described below as the antigen that produces polyclone or monoclonal antibody, wherein can use described antibody as diagnostic reagent, for example with the Trichinella spiralis specific protein in the screening of standard techniques such as Western trace detection method zooblast, tissue or the humoral sample.
Can on protein level, modify any polypeptide of the present invention, to improve or to change its biology or amynologic characteristic.Can use known technology that polypeptide is carried out one or more chemically modifieds, to prepare its analogue.
Can on molecule, connect one or more chemical groups or another kind of protein such as serum albumin, keyhole worm relative hemocyanin or BSA, perhaps polyamino acid (as poly-lysine), or polysaccharide is (as Sepharose, agarose, or through modifying or not modified Mierocrystalline cellulose) first-class, with the derivative of preparation polypeptide of the present invention.The method of carrying out these ligations is known in the protein chemistry field.
The present invention further provides the separation antibody of anti-polypeptide of the present invention.In a preferred embodiment, can use currently known methods to produce the proteic antibody of anti-Trichinella spiralis Ts88.Available part or purifying or isolating Trichinella spiralis Ts88 recombinant protein basically, or its homologue described above, fusion rotein, essential part, analogue or derivative immunity are selected from various host animals such as pig, ox, horse, rabbit, goat, sheep or mouse.Can use adjuvant described below to improve the antibody generation.
Can from the serum of immunized animal, obtain and separate polyclonal antibody, and use ordinary method to test it antigenic specificity.Perhaps, also can use any technology preparation and the separation monoclonal antibody of producing antibody molecule by the continuous cell line of cultivating.These technology comprise but be not only limited to originally by Kohler and Milstein (nature, 1975,256:495-497) hybridoma technology of Miao Shuing, human B cell hybridoma technology (Kosbor etc., 1983, today immunology, 4:72; Cote etc., 1983, institute of NAS newspaper, 80:2026-2030), and EBV hybridoma technology (Cole etc., 1985, monoclonal antibody and cancer therapy, Alan R.Liss, Inc., pp.77-86). perhaps, the technology that can adopt the manufacture order chain antibody of having stated is (as referring to United States Patent (USP) 4,946,778) produce Trichinella spiralis antigen-specific single-chain antibody.
The antibody fragment that contains the specific binding site of polypeptide of the present invention is also included within the scope of the invention, and the preparation of available known technology.Such fragment comprises but is not only limited to the F (ab ') that can be produced by gastric pepsin digestion complete antibody molecule
2Fragment and can through the reduction F (ab ')
2Segmental disulphide bridges and the Fab fragment that produces.Perhaps, also can make up the Fab expression library (Huse etc., 1989, science 246:1275-1281), has required specific Fab fragment with rapid evaluation to Trichinella spiralis albumen.
It is known in the art producing with the technology of separating monoclonal antibody and antibody fragment, and is for example providing more detailed description: Hariow and Lane in the following document, 1988,
Antibody: real Test the chamber handbook, cold spring harbor laboratory and J.W.Cooding, 1986,
Monoclonal antibody: principle with Practice, Academic Press, London (it classifies this paper reference as).
The following example is just described for example, and is not used for limiting the scope of the invention.
Embodiment
Clone and the sequential analysis of embodiment 1 Trichinella spiralis antigen gene Ts88
1. the foundation of Trichinella spiralis animal model:
By traditional gastric pepsin digestion method (Gamble HR.Comparison of immuneeffects in mice immunized with Trichinella spiralis adult and larvalantigens, J Parasitol.1985 Oct, 71 (5): the 680-682) trichinella larvae in digestion and collection pig source, Heilungkiang, give Kunming mouse with every 200 feedings, the conventional animal chamber is raised and is preserved.
2. the preparation of screening serum
Collect and separate from the Heilungkiang of pig body strain Trichinella spiralis (international standard worm strain coding ISS533) adult (reference " Trichinella spiralis newborn larvae difference subtracts the structure and the preliminary screening thereof in cDNA library ", Liu Mingyuan, China animal doctor journal, 2001.21 (4): 355-358), the adult polypide is put in the mill, and ice bath ground 15 minutes down fast.Liquid after grinding is moved into 10ml centrifuge tube, ultrasonic (on ice) 3 times, 3 minutes/time, interval 1 minute.The multigelation several, the centrifuging and taking supernatant promptly gets full worm soluble antigen.Immunity Japan large ear rabbit (200 μ g/ only) is strengthened 3 times every other week, obtains the artificial immunization rabbit anteserum; Experimental rabbit is fed with 4000 Trichinella spiralis muscle larvaes, obtains artificial challenge's rabbit anteserum after 4 weeks.The serum titer of measuring both through ELISA all reaches 1: 8000.
3. immunoscreening expression library
The Trichinella spiralis adult goes into ZAP II cDNA expression library available from Liu Mingyuan (reference " structure and the screening of Chinese Trichinella spiralis strain isolated adult and newborn larvae gene library ", Chinese animal doctor's journal, 1998,18 (2): 147-150.).
1 μ l Trichinella spiralis adult goes into ZAP II cDNA expression library diluent and adds among the 600 μ l host bacterium XL1-Blue, and 37 ℃, adsorb and added top-agar in 20 minutes, be inverted in the plaque that is cultured to the needle point size in 42 ℃ of incubators and grow.(Gelman company) is layered on the flat board nitrocellulose filter, is placed on 37 ℃ of incubator overnight incubation.At room temperature film was carried out mark in second day, and took off, immersed the anti-working fluid (artificial immunization rabbit anteserum and artificial challenge's rabbit anteserum are 1: 1000) that adsorbed in advance by coliphage lysate (STRTAGENE company) 30 minutes from flat board.Film is immersed two anti-working fluids (alkaline phosphatase-goat anti-rabbit igg is 1: 7500, Promega company), 30 minutes.Immerse among colour developing liquid NBT, the BCIP (Promega company), fully after the colour developing, add stop buffer (test kit ProtoBlot Immunoscreening System, Promega company).Obtain 9 positive colonies with artificial immunize rabbit serum screening, sieve again with artificial infected rabbits serum again, obtain 3 positive colonies, (reference " from the research of ovarian cancer cDNA expression library screening tumor antigen gene ", Yuan Ming, cell and molecular immunology magazine after the external shearing cyclisation, 2001,17 (2): 138-140), identify, choose and be numbered the Ts88 clone and carry out determined dna sequence through PCR and Southern Blot.
4.5 ' hold the terminal rapid amplifying technology of cDNA to obtain the DNA total length
Carry out 5 ' the terminal extension of Ts88 gene with 5 '-RACE test kit (Gibco BRL company).Three specific amplification primers of cDNA first chain design according to this gene carry out PCR.Primer sequence is:
T88-R1:GGCTCGAGTCAGTTGACCGATGCTGTGG(SEQ?IDNO:3);
T88-R2:CGGACATCTGCTTCCACTGT(SEQ?ID?NO:4;)
T88-R3:TTGCTACTGACTTGCATGCT(SEQ?ID?NO:5)。
Amplified production obtains Ts88 cDNA full length sequence through cloning and sequencing, is shown among Fig. 1 (SEQ IDNO:1):
TTATTTACCGAACTTAAAAGTTTTTGTGAATATTATAGCAAGTATTTTACTCGATTGCAACGCTCATGAACACTGTACTT 80
GCAAGGAATGCAGTGAGAGAGTGAGTGAATTGTACGCTGTTGCTCTGTTTTAAATTATCAATTCAAATAAATATTGTTTG 160
CTGATTAGCAGATTTGTGCATTTTTACAAAACGCCAAATAATTTATTTTCCATTTGAAATTGCCGTTGAACGGAAACTTT 240
AAAATTTACATGCAAACGCCTCCTCCACCGGAATAATGAAAGCATCGGCAGTGAAATGTGAAAATGAACAGGCAGTGAAT 320
M K A S A V K C E N E Q A V N 15
GCTGAACGAGAACAATATGTGGAAAATGGCCAAAAGTGCGAAGAGCAAAATGCACCCCGATTAATCGATCTGCTTGTGCA 400
A E R E Q Y V E N G Q K C E E Q N A P R L I D L L V Q 42
AGTTCACTATGACAATGATAATTTGTTGATGGTTTCAACGGAAAGAAATGGCACCATATTTTGTGGAGTGTTGCTCAGCA 480
V H Y D N D N L L M V S T E R N G T I F C G V L L S 68
TGCAAGTCAGTAGCAATGAGACACCGTTCGGCATGAATGCGAGCAAATTTGAACAGTGGAAGCAGATGTCCGCACAGCAG 560
M Q V S S N E T P F G M N A S K F E Q W K Q M S A Q Q 95
CATCGCGATGATATTTGTGAACTCAAAGAAATCTCTTCAGTAATATCCAGGCAGACATCCGAAGCGGCCGATACGAAGCC 640
H R D D I C E L K E I S S V I S R Q T S E A A D T K P 122
GTCATACAGTGAAACGGTGAACGATTTCAGAAGGAAATTAAAATGGCGTACAACTGATCACTGGTCGATGGCTAGAAAAA 720
S Y S E T V N D F R R K L K W R T T D H W S M A R K 148
ATAAATGGGGAATGAGGAGGCGAACACGTGGCGTGAAACGGTTATTGTTGTGCATCAAATGCCAACAGCAAGAAGCGAAC 800
N K W G M R R R T R G V K R L L L C I K C Q Q Q E A N 175
ACGTTCAACGTTGTTAAAGCTGCTGGCAAAAGAAAGTCGACAATAATTGAAAGTGATGATGATGATGATGATGGTGGAGC 880
T F N V V K A A G K R K S T I I E S D D D D D D G G A 202
GAGAAATTTGACCACAATTTCCCGGTTAAGCGGTTCGCTTAAGTTCACAGCTTCAACTTCGGTTGCGAACAAAAAGCGTC 960
R N L T T I S R L S G S L K F T A S T S V A N K K R 228
CACGCAGCCGTATTAGTTCCGGTATTCAAATTAATGATGATGATGATGATGGTCAATTGGCTCAATCTGCAAACAACGTT 1040
P R S R I S S G I Q I N D D D D D G Q L A Q S A N N V 255
AAATTGGAAACAAAGCAACCGTTGTTCAATGGAACCGAGCCGAGCATTTCTGGCAACAAGGAGAAAATGGTCGTTGCACC 1120
K L E T K Q P L F N G T E P S I S G N K E K M V V A P 282
GTTGACTTTGAAAATTTCTTACGGTAAACGCAGTCAGAAGAAAACGACTGTCATCAAGCCGAAAAGTGCTGCAGTAGTAG 1200
L T L K I S Y G K R S Q K K T T V I K P K S A A V V 308
TTTCAACCGGACGATTGACCGCTGCCAGTAGAAGAAACGGTTCCAAATCGCAAGGTATTATTGAAATGGAAACTGACCAC 1280
V S T G R L T A A S R R N G S K S Q G I I E M E T D H 335
CAGGCTGTGTTGTCTTCTGTTCAGCCTTCTTCCTCTGTAATTGACGATCACTGCAGTGTATGCAGCAGTAGTAGTAGCAG 1360
Q A V L S S V Q P S S S V I D D H C S V C S S S S S S 362
TAGCGACGGTTCACAACACCAGGTAGGCGATTTGGTTTGGGCAAAGTTGAAAGGCTATTCACCGTGGCCAGCAGAAATTT 1440
S D G S Q H Q V G D L V W A K L K G Y S P W P A E I 388
GCTCGCTAAATGAGCGTCGAATTCGCGTCCGATGGTGTGGTACGGCCGATCAGACCAACTCGGTGCCGTTGTCGAGCGTT 1520
C S L N E R R I R V R W C G T A D Q T N S V P L S S V 415
GAAAATTTCCAACAAAAATTCACCAATTATTACAACCCTTCACAAAGGCAAGAATACCAACAGGCGGTGGCCGACGCCCT 1600
E N F Q Q K F T N Y Y N P S Q R Q E Y Q Q A V A D A L 442
TGTCAAAGATCTGCTCGCCGGTCTCAACGGTCTTTGCTATTCGAAGCTGTTGTCGCCGGATTGTCGAACTGAAATGCTGC 1680
V K D L L A G L N G L C Y S K L L S P D C R T E M L 468
AACTGTTGCAGCAAGATCGACCACAAACGGCCACAGCATCGGTCAACTGAATCAGAAACAAATTTCATCTATCTATCTTA 1760
Q L L Q Q D R P Q T A T A S V N * 484
GATATCTAGATGTAGGAATGAAGACGAAGAAGAAGAAAAATATCGACCGCTCGTCAAAATTCAAACTAAACCCAAAAATC 1840
CCCCAATTGAAAATCTACACAAACTTATTGCTTATTATTATTATTCTTATTCATTTAAGCATTGTTGCTGACGAATGTAT 1920
ATGTTGAAATAAAACTTGACAATATTGTAAAAAAAAAAAAAAAA 1966
(SEQ?ID?NO:1)
5.cDNA sequence and amino acids coding analysis
Ts88 cDNA total length 1966bp, initiator codon ATG is positioned at sequence 276bp place, and TGA is a terminator codon, the long 1452bp of open reading frame, encoded protein matter contains 484 amino acid, and amino acid sequence corresponding is expressed as Fig. 1 (SEQ ID NO:2).
6.Ts88 gene specific is identified
Extract Trichinella spiralis and become molitor genomic dna (10 μ g), mouse gene group DNA (10 μ g), through agarose electrophoresis, be transferred to nitrocellulose filter (Gelman company), Ts88 cDNA is probe (1.2 μ g), carry out Southern hybridization, digoxigenin labeled (test kit Promega company).This gene becomes molitor genomic dna hybridization signal to occur with Trichinella spiralis, does not react with mouse gene group DNA.Show that this gene is Trichinella spiralis specific gene (Fig. 2).
The preparation of embodiment 2 Ts88 gene recombinant proteins and antibody thereof
1.Ts88 the structure of gene recombination plasmid expression vector
The Ts88 gene fragment is after Sac I and Xho I enzyme are cut, and obtaining length is the fragment of 1136bp, with the prokaryotic expression carrier pET-28c (+) (available from Novagen company) of the same sticky end of tool with 3: 1 mol ratios at T
4The following 15 ℃ of connections of spending the night of ligase enzyme (Promega company) effect.The expression vector establishment synoptic diagram is referring to Fig. 3.
2.Ts88 gene prokaryotic and purifying
With the recombinant plasmid transformed e. coli bl21 (Novagen company) that correctly connects, through 37 ℃, 150rpm, 1.0mM IPTG induced 3 hours, obtained the Ts88 gene recombinant protein, the about 37KD of molecular weight.Recombinant protein through His-binding affinity chromatography column purification (Novagen company) and Refolding kit renaturation (Novagen company) (Fig. 4).
3. prepare recombinant protein antibody
Divide experimental group and control group, every group of 10 BABL/c mouse.The Ts88 recombinant protein of purifying adds isopyknic freund's adjuvant (Promega company) through skin multi-point injection immunization experiment group BABL/c mouse (200 μ g/ only), control group injecting normal saline, booster immunization 3 times.Last is strengthened getting in back 8 days blood and is collected serum.
4. antibody is identified
With 300ng Ts88 recombinant protein is antigen coated 96 hole enzyme plates, one anti-is serum to be checked, two anti-corresponding two anti-(Sigma companies) for horseradish peroxidase-labeled, this albumen can with the immune serum reaction of Ts88 recombinant protein, ELISA measures antibody titer up to 1: 30000.The recombinant protein that the Ts88 gene is described has stronger antigenicity.
The immunodiagnosis of embodiment 3 Ts88 recombinant proteins
1. immunodiagnosis analysis
Press " modern molecular biology experimental technique " step operation of Lu Shengdong chief editor.The Ts88 expressing protein of purifying (1.5 μ g) is behind the SDS-PAGE electrophoresis, be transferred to nitrocellulose filter (Gelman company), detect with DAB development process (Amersco company), respectively with infect parasitic various patients serum 1: 50, infected pigs's serum 1: 50, infected rabbits serum 1: 100, artificial immunization rabbit anteserum 1: 100, two resisted corresponding two anti-(Sigma companies) for horseradish peroxidase-labeled to Ts88 recombinant protein immune serum as first antibody in 1: 2000.The result shows that about 37KD place all presents a tangible Western blot band (Fig. 5), shows that people, pig, rabbit anteserum and Ts88 recombinant protein immune mouse serum that the Ts88 recombinant protein can infected Trichinella spiralis discern.The patients serum of not infected other worm of Ts88 expressing protein (roundworm, whipworm, schistosomicide, liver fluke, cysticercus) discerns simultaneously, is not also discerned by following negative control sera (normal mouse serum, normal pig serum, normal human serum).Illustrate that the Ts88 recombinant protein has excellent specificity, can be used as diagnostic reagent.
All patents listed above, patent application and publication all are incorporated herein by reference document in full.
Scope of the present invention is not only limited to described particular, and these schemes just illustrate as the indivedual aspects of the present invention single and provide.The composition of functional equivalent and method are all within the scope of the present invention.Really, except the content of shown in this article and description, for the those skilled in the art that read foregoing, all be conspicuous concerning the various changes of the present invention.These changes will fall into the present invention and await the reply within the scope of claim.
Sequence table
<110〉Capital University of Medical Sciences
<120〉Trichinella spiralis Ts88 gene, its protein product and purposes
<130>IDC030102
<160>5
<170>PatentIn?version?3.1
<210>1
<211>1966
<212>DNA
<213〉nucleotide sequence of Trichinella spiralis Ts88 cDNA
<400>1
ttatttaccg?aacttaaaag?tttttgtgaa?tattatagca?agtattttac?tcgattgcaa 60
cgctcatgaa?cactgtactt?gcaaggaatg?cagtgagaga?gtgagtgaat?tgtacgctgt 120
tgctctgttt?taaattatca?attcaaataa?atattgtttg?ctgattagca?gatttgtgca 180
tttttacaaa?acgccaaata?atttattttc?catttgaaat?tgccgttgaa?cggaaacttt 240
aaaatttaca?tgcaaacgcc?tcctccaccg?gaataatgaa?agcatcggca?gtgaaatgtg 300
aaaatgaaca?ggcagtgaat?gctgaacgag?aacaatatgt?ggaaaatggc?caaaagtgcg 360
aagagcaaaa?tgcaccccga?ttaatcgatc?tgcttgtgca?agttcactat?gacaatgata 420
atttgttgat?ggtttcaacg?gaaagaaatg?gcaccatatt?ttgtggagtg?ttgctcagca 480
tgcaagtcag?tagcaatgag?acaccgttcg?gcatgaatgc?gagcaaattt?gaacagtgga 540
agcagatgtc?cgcacagcag?catcgcgatg?atatttgtga?actcaaagaa?atctcttcag 600
taatatccag?gcagacatcc?gaagcggccg?atacgaagcc?gtcatacagt?gaaacggtga 660
acgatttcag?aaggaaatta?aaatggcgta?caactgatca?ctggtcgatg?gctagaaaaa 720
ataaatgggg?aatgaggagg?cgaacacgtg?gcgtgaaacg?gttattgttg?tgcatcaaat 780
gccaacagca?agaagcgaac?acgttcaacg?ttgttaaagc?tgctggcaaa?agaaagtcga 840
caataattga?aagtgatgat?gatgatgatg?atggtggagc?gagaaatttg?accacaattt 900
cccggttaag?cggttcgctt?aagttcacag?cttcaacttc?ggttgcgaac?aaaaagcgtc 960
cacgcagccg?tattagttcc?ggtattcaaa?ttaatgatga?tgatgatgat?ggtcaattgg 1020
ctcaatctgc?aaacaacgtt?aaattggaaa?caaagcaacc?gttgttcaat?ggaaccgagc 1080
cgagcatttc?tggcaacaag?gagaaaatgg?tcgttgcacc?gttgactttg?aaaatttctt 1140
acggtaaacg?cagtcagaag?aaaacgactg?tcatcaagcc?gaaaagtgct?gcagtagtag 1200
tttcaaccgg?acgattgacc?gctgccagta?gaagaaacgg?ttccaaatcg?caaggtatta 1260
ttgaaatgga?aactgaccac?caggctgtgt?tgtcttctgt?tcagccttct?tcctctgtaa 1320
ttgacgatca?ctgcagtgta?tgcagcagta?gtagtagcag?tagcgacggt?tcacaacacc 1380
aggtaggcga?tttggtttgg?gcaaagttga?aaggctattc?accgtggcca?gcagaaattt 1440
gctcgctaaa?tgagcgtcga?attcgcgtcc?gatggtgtgg?tacggccgat?cagaccaact 1500
cggtgccgtt?gtcgagcgtt?gaaaatttcc?aacaaaaatt?caccaattat?tacaaccctt 1560
cacaaaggca?agaataccaa?caggcggtgg?ccgacgccct?tgtcaaagat?ctgctcgccg 1620
gtctcaacgg?tctttgctat?tcgaagctgt?tgtcgccgga?ttgtcgaact?gaaatgctgc 1680
aactgttgca?gcaagatcga?ccacaaacgg?ccacagcatc?ggtcaactga?atcagaaaca 1740
aatttcatct?atctatctta?gatatctaga?tgtaggaatg?aagacgaaga?agaagaaaaa 1800
tatcgaccgc?tcgtcaaaat?tcaaactaaa?cccaaaaatc?ccccaattga?aaatctacac 1860
aaacttattg?cttattatta?ttattcttat?tcatttaagc?attgttgctg?acgaatgtat 1920
atgttgaaat?aaaacttgac?aatattgtaa?aaaaaaaaaa?aaaaaa 1966
<210>2
<211>484
<212>PRT
<213〉the proteic aminoacid sequence of Trichinella spiralis Ts88
<400>2
Met?Lys?Ala?Ser?Ala?Val?Lys?Cys?Glu?Asn?Glu?Gln?Ala?Val?Asn?Ala
1 5 10 15
Glu?Arg?Glu?Gln?Tyr?Val?Glu?Asn?Gly?Gln?Lys?Cys?Glu?Glu?Gln?Asn
20 25 30
Ala?Pro?Arg?Leu?Ile?Asp?Leu?Leu?Val?Gln?Val?His?Tyr?Asp?Asn?Asp
35 40 45
Asn?Leu?Leu?Met?Val?Ser?Thr?Glu?Arg?Asn?Gly?Thr?Ile?Phe?Cys?Gly
50 55 60
Val?Leu?Leu?Ser?Met?Gln?Val?Ser?Ser?Asn?Glu?Thr?Pro?Phe?Gly?Met
65 70 75 80
Asn?Ala?Ser?Lys?Phe?Glu?Gln?Trp?Lys?Gln?Met?Ser?Ala?Gln?Gln?His
85 90 95
Arg?Asp?Asp?Ile?Cys?Glu?Leu?Lys?Glu?Ile?Ser?Ser?Val?Ile?Ser?Arg
100 105 110
Gln?Thr?Ser?Glu?Ala?Ala?Asp?Thr?Lys?Pro?Ser?Tyr?Ser?Glu?Thr?Val
115 120 125
Asn?Asp?Phe?Arg?Arg?Lys?Leu?Lys?Trp?Arg?Thr?Thr?Asp?His?Trp?Ser
130 135 140
Met?Ala?Arg?Lys?Asn?Lys?Trp?Gly?Met?Arg?Arg?Arg?Thr?Arg?Gly?Val
145 150 155 160
Lys?Arg?Leu?Leu?Leu?Cys?Ile?Lys?Cys?Gln?Gln?Gln?Glu?Ala?Asn?Thr
165 170 175
Phe?Asn?Val?Val?Lys?Ala?Ala?Gly?Lys?Arg?Lys?Ser?Thr?Ile?Ile?Glu
180 185 190
Ser?Asp?Asp?Asp?Asp?Asp?Asp?Gly?Gly?Ala?Arg?Asn?Leu?Thr?Thr?Ile
195 200 205
Ser?Arg?Leu?Ser?Gly?Ser?Leu?Lys?Phe?Thr?Ala?Ser?Thr?Ser?Val?Ala
210 215 220
Asn?Lys?Lys?Arg?Pro?Arg?Ser?Arg?Ile?Ser?Ser?Gly?Ile?Gln?Ile?Asn
225 230 235 240
Asp?Asp?Asp?Asp?Asp?Gly?Gln?Leu?Ala?Gln?Ser?Ala?Asn?Asn?Val?Lys
245 250 255
Leu?Glu?Thr?Lys?Gln?Pro?Leu?Phe?Asn?Gly?Thr?Glu?Pro?Ser?Ile?Ser
260 265 270
Gly?Asn?Lys?Glu?Lys?Met?Val?Val?Ala?Pro?Leu?Thr?Leu?Lys?Ile?Ser
275 280 285
Tyr?Gly?Lys?Arg?Ser?Gln?Lys?Lys?Thr?Thr?Val?Ile?Lys?Pro?Lys?Ser
290 295 300
Ala?Ala?Val?Val?Val?Ser?Thr?Gly?Arg?Leu?Thr?Ala?Ala?Ser?Arg?Arg
305 310 315 320
Asn?Gly?Ser?Lys?Ser?Gln?Gly?Ile?Ile?Glu?Met?Glu?Thr?Asp?His?Gln
325 330 335
Ala?Val?Leu?Ser?Ser?Val?Gln?Pro?Ser?Ser?Ser?Val?Ile?Asp?Asp?His
340 345 350
Cys?Ser?Val?Cys?Ser?Ser?Ser?Ser?Ser?Ser?Ser?Asp?Gly?Ser?Gln?His
355 360 365
Gln?Val?Gly?Asp?Leu?Val?Trp?Ala?Lys?Leu?Lys?Gly?Tyr?Ser?Pro?Trp
370 375 380
Pro?Ala?Glu?Ile?Cys?Ser?Leu?Asn?Glu?Arg?Arg?Ile?Arg?Val?Arg?Trp
385 390 395 400
Cys?Gly?Thr?Ala?Asp?Gln?Thr?Asn?Ser?Val?Pro?Leu?Ser?Ser?Val?Glu
405 410 415
Asn?Phe?Gln?Gln?Lys?Phe?Thr?Asn?Tyr?Tyr?Asn?Pro?Ser?Gln?Arg?Gln
420 425 430
Glu?Tyr?Gln?Gln?Ala?Val?Ala?Asp?Ala?Leu?Val?Lys?Asp?Leu?Leu?Ala
435 440 445
Gly?Leu?Asn?Gly?Leu?Cys?Tyr?Ser?Lys?Leu?Leu?Ser?Pro?Asp?Cys?Arg
450 455 460
Thr?Glu?Met?Leu?Gln?Leu?Leu?Gln?Gln?Asp?Arg?Pro?Gln?Thr?Ala?Thr
465 470 475 480
Ala?Ser?Val?Asn
<210>3
<211>28
<212>DNA
<213〉artificial sequence
<220>
<223〉description of artificial sequence: synthetic primer Ts88-R1
<400>3
ggctcgagtc?agttgaccga?tgctgtgg 28
<210>4
<211>20
<212>DNA
<213〉artificial sequence
<220>
<223〉description of artificial sequence: synthetic primer Ts88-R2
<400>4
cggacatctg?cttccactgt 20
<210>5
<211>19
<212>DNA
<213〉artificial sequence
<220>
<223〉description of artificial sequence: synthetic primer Ts88-R3
<400>5
ttgctactga?cttgcatgc 19
Claims (7)
1. it is one of following that isolating polynucleotide molecule, the nucleotide sequence that it is characterized in that described polynucleotide molecule are selected from:
(A) nucleotide sequence in the sequence as shown in Figure 1;
(B) with the protein of (A) nucleotide sequence coded same acid sequence, but because of the degeneracy of genetic code different nucleotide sequence on aminoacid sequence;
(C) with (A) or (B) described nucleotide sequence complementary nucleotide sequence.
2. polynucleotide molecule encoded polypeptides by claim 1, its aminoacid sequence are the aminoacid sequences in the sequence as shown in Figure 1.
3. a recombinant expression vector is characterized in that it contains the described polynucleotide molecule of claim 1.
4. by the described recombinant expression vector transformed host cells of claim 3.
5. a method of producing claim 2 polypeptide is included in and cultivates the described host cell of claim 4 under the condition that can make described expression of polypeptides.
6. a diagnostic kit that is used for in-vitro diagnosis trichinzation is characterized in that containing the described polypeptide of claim 2.
7. the described polypeptide of claim 2 is used for the purposes of the diagnostic kit of in-vitro diagnosis trichinzation in preparation.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB200310114934XA CN1226413C (en) | 2003-11-13 | 2003-11-13 | Trichina TS88 gene, their protein products and uses |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB200310114934XA CN1226413C (en) | 2003-11-13 | 2003-11-13 | Trichina TS88 gene, their protein products and uses |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1544628A CN1544628A (en) | 2004-11-10 |
CN1226413C true CN1226413C (en) | 2005-11-09 |
Family
ID=34337215
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB200310114934XA Expired - Fee Related CN1226413C (en) | 2003-11-13 | 2003-11-13 | Trichina TS88 gene, their protein products and uses |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1226413C (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN100460509C (en) * | 2007-01-04 | 2009-02-11 | 首都医科大学 | Trichina paramyosin gene and application thereof |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102181450B (en) * | 2011-03-07 | 2012-11-21 | 首都医科大学 | Trichina Ts27 gene, encoding protein and application thereof |
-
2003
- 2003-11-13 CN CNB200310114934XA patent/CN1226413C/en not_active Expired - Fee Related
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN100460509C (en) * | 2007-01-04 | 2009-02-11 | 首都医科大学 | Trichina paramyosin gene and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN1544628A (en) | 2004-11-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1217024A (en) | Chemokine alpha 2 | |
CN1226413C (en) | Trichina TS88 gene, their protein products and uses | |
CN1223677C (en) | Gene associated with esophagus cancer | |
CN1683403A (en) | Japanese blood fluke cell periodic static agent, its coded nucleic acid and its use | |
CN1670197A (en) | Arginase of Japanese blood fluke, its coding nucleic acid and application | |
CN1172954C (en) | High-expression gene of liver cancer, protein coded by it and its application | |
CN1271007A (en) | New human chitinase protein and its code sequence | |
CN1267727A (en) | New human phosphorylated zymoprotein of pyruvate dehydrogenase and its code sequence | |
CN1948490A (en) | Human hRAB-14 gene sequence, its coding protein and preparation method | |
CN1670195A (en) | Propionyl-CoA carboxylase of clonorchis sinensis, its coding nucleic acid and application thereof | |
CN1265424A (en) | Diene cryl coenzyme reductase as one new kind of human peroxidase and its code sequence | |
CN1632119A (en) | Human LSB gene sequence, encoded polypeptide thereof, preparation method and use therefor | |
CN1746187A (en) | Atrial fibrillation peccant gene and uses thereof | |
CN1278002A (en) | Human RNA binding protein and coding series thereof | |
CN1269365A (en) | New human cell withering-related protein and its code sequence | |
CN1267732A (en) | Human methyl transferase protein and its code sequence | |
CN1266899A (en) | Precursor heteromorphic protein of human calcium binding protein and its coding sequence | |
CN1278004A (en) | Novel human immune glubulin receptor subunit protein, and coding series thereof | |
CN1272540A (en) | Human immune factor related protein and its coded sequence | |
CN1272542A (en) | Human protein phosphoglycan protein and its coded sequence | |
CN1278000A (en) | Human glucotranferring protein, and coding series thereof | |
CN1329077A (en) | A novel polypeptide-embryonic development related protien 30 and polynucleotide for coding this polypeptide | |
CN1268566A (en) | New human teratocarnogenesis related protein and its coding sequence | |
CN1626550A (en) | Excreted proteins as indicators related to tumor and application | |
CN1278003A (en) | Human spermidine/spermine acetyl transferase protein isomer, and coding series thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20051109 Termination date: 20111113 |