CN1626550A - Excreted proteins as indicators related to tumor and application - Google Patents
Excreted proteins as indicators related to tumor and application Download PDFInfo
- Publication number
- CN1626550A CN1626550A CN 200310109301 CN200310109301A CN1626550A CN 1626550 A CN1626550 A CN 1626550A CN 200310109301 CN200310109301 CN 200310109301 CN 200310109301 A CN200310109301 A CN 200310109301A CN 1626550 A CN1626550 A CN 1626550A
- Authority
- CN
- China
- Prior art keywords
- tsp1
- sequence
- polypeptide
- polynucleotide
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
A novel tumor marker-protein TSP1, the polynucleotide for coding it, a process for preparing said protein by recombinantion, the application of said protein and its code sequence (diagnosing liver cancer for example), and the reagent kit for detecting said protein are disclosed.
Description
Technical field
The invention belongs to biotechnology and medical field, specifically, the present invention relates to relevant secretory protein 1 (the Tumor Associated Secretory Protein1 of a kind of new tumor markers-tumour, abbreviate TSP1 albumen as), proteic polynucleotide of coding TS P1 and produce the proteic method of this TSP1 through recombinant technology.The invention also discloses the purposes of TSP1 albumen and encoding sequence thereof, as be used for diagnosing tumour, and the pharmaceutical composition that contains TSP1 protein antagonist (as antibody and antisense nucleic acid).
Background technology
Twentieth century since the fifties medical science development of leap has been arranged, the progress of cancer therapy also is fruitful, and found many directly with relevant oncogene and the cancer suppressor gene of cancer generation.
Up to now, in melanoma and comprise in the various tumor tissues of prostate cancer, thymic carcinoma, ovarian cancer, stomach cancer and found many tumour antigens.The human tumor immunological rejection antigen of having found at present can be divided into four types.First kind antigen comes from the somatic mutation of normal gene product, and the second class antigen comes from the transgenation relevant with oncogenic process.This two classes antigen is patient-specific antigen, is not suitable for the ubiquity treatment.The 3rd class antigen is the sort of expression to be arranged also in healthy tissues, but the product of the gene that expression amount raises in tumour.If do not relate to sudden change, this class antigen has ubiquity in various cancer patients, but they are normally tissue-specific, and is not peculiar by tumour, has little significance in clinical application.The 4th class antigen has strict tumour-specific, and is relevant with general oncogenic process.Therefore, this class antigen is expressed in human tumor widely, is suitable for the target spot as tumor markers and antineoplastic immune attack most.In addition, the tumor markers that is particularly suitable for diagnosing is the albumen of those secretion property.Yet, seldom belong to this class in the antigen of having found at present.
Be of great significance in order to treat with the relevant secretory protein of diagnostic purpose exploitation tumour.Therefore, this area presses for the tumor markers of the new secretion of exploitation, is used for the diagnosis and the treatment of tumour.
Summary of the invention
The purpose of this invention is to provide a kind of new human tumor marker thing TSP1 albumen with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
The present invention has found and has isolated the new antigen gene that can be used as tumor markers: TSP1 through extensive and deep research.This expression of gene product can detect in the serum of hepatocarcinoma patient, but the serum in normal people and other non-liver cancers patient lack detect less than.This shows that TSP1 is the liver cancer marker of a special secretion.Finished the present invention on this basis.
In a first aspect of the present invention, novel isolated TSP1 polypeptide is provided, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.
Preferably, this TSP1 polypeptide is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have the function that promotes liver cancer cell growth by (a) polypeptides derived.
More preferably, this polypeptide has the aminoacid sequence of 1-208 position among the SEQ ID NO:2 or 26-208 position.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned people TSP1 polypeptide of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has 1-208 position or 26-208 amino acids polypeptide of sequence among the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 779-1402 position among the SEQ ID NO:1; (b) has the sequence of 1-2978 position among the SEQ ID NO:1; (c) has the sequence of 854-1402 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, preparation TSP1 is provided proteic method, this method comprises: (a) under the condition that is fit to expressing protein, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate TSP1 albumen.
In a fifth aspect of the present invention, provide and above-mentioned people TSP1 polypeptid specificity bonded antibody.The nucleic acid molecule that can be used as primer or probe also is provided, and it contains a successive 15-2978 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism people TSP1 polypeptide active is provided, and the compound that suppresses people TSP1 polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of people TSP1 polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of TSP1 in the test sample, it comprises: sample is contacted with the proteic specific antibody of TSP1, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample TSP1 albumen.A kind of method that detects tumour also is provided, comprise step: the sample (as blood, urine, body fluid, saliva etc.) of individuality to be detected is contacted with the proteic antibody of the anti-TSP1 of specificity, observe whether form antibody complex, formed antibody complex and just represented that this individuality suffers from liver cancer or liver cancer susceptibility is higher than normal population.
In a eighth aspect of the present invention, the present invention also provides the test kit of a kind of detection tumour (especially liver cancer), and it contains proteic specific antibody of TSP1 and specification sheets.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screen the agonist that promotes people TSP1 polypeptide active, perhaps suppresses the antagonist of people TSP1 polypeptide active or is used to the peptide finger print identification.The proteic encoding sequence of people TSP1 of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains the people TSP1 antagonist of the present invention and the pharmaceutically acceptable carrier of safe and effective amount.Preferred TSP1 antagonist is antibody and the TSP1 antisense sequences of anti-TSP1.These pharmaceutical compositions can be treated tumour.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 has shown the proteic expression of TSP1.Wherein, figure A is the expression before and after inducing, before swimming lane 1.pT7470-TSP1-HMS174 (DE3) induces; 2.pT7470-TSP1-HMS174 (DE3) induce after; 3.pT7470-TSP1-HMS174 (DE3) inclusion body; 4. standard protein molecular weight.Figure B is the electrophorogram before and after the purifying, swimming lane 1. standard protein molecular weight; 2.pT7470-TSP1-HMS174 (DE3) inclusion body; 3.pT7470-TSP1-HMS174 (DE3) ultrasonic supernatant for the second time; 4.TSP1 albumen rubber tapping back concentrates sample.Figure C is a Western trace detected result (1: 10000), and swimming lane 1.pT7470-TSP1-HMS174 (DE3) induces preceding thalline; 2.TSP1 protein sample.
Fig. 2 has shown in mice serum the proteic detected result of TSP1.Each swimming lane is as follows: A, electricity change the mice serum of empty carrier plasmid and change TSP1 plasmid mice serum without co-immunoprecipitation through the positive control C of B, TSP1 protein expression behind the co-immunoprecipitation, mice serum that electricity changes the TSP1 plasmid D that (is respectively 5ul and 10ul sample) behind co-immunoprecipitation, electricity.
Fig. 3 has shown the Western Blot result to the part patients serum.Each swimming lane is as follows: the positive control of A, TSP1 protein expression; H1-H5, HBV male hepatitis serum; K1-K5, liver cancer patient blood; N1-N3, normal human serum.
Fig. 4 is pT
7The structure iron of 470 carriers.
Detailed Description Of The Invention
In the present invention, term " TSP1 albumen ", " TSP1 polypeptide " or " tumor markers TSP1 " are used interchangeably, and all refer to have albumen or the polypeptide of human tumor marker thing TSP1 amino acid sequence (SEQ ID NO:2). They also comprise the mature T SP1 that does not contain signal peptide (1-23 position).
As used herein, " separation " refers to that material separates (if crude, primal environment namely is natural surroundings) from its primal environment. Do not have separation and purification such as the polynucleotides under the native state in the active somatic cell and polypeptide, but same polynucleotides or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " TSP1 albumen or the polypeptide of separation " refers to that the TSP1 polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material. Those skilled in the art can use the purified technology of protein purifying TSP1 albumen of standard. Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide. Polypeptide of the present invention can be the product of natural purifying, or the product of chemical synthesis, or uses recombinant technique to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell). The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated. Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analog of people TSP1 albumen. As used herein, term " fragment ", " derivative " refer to basically keep the identical biological function of natural human TSP1 albumen of the present invention or active polypeptide with " analog ". Polypeptide fragment of the present invention, derivative or analog can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino acid residue (preferred conservative amino acid residue), and the amino acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide half-life, polyethylene glycol for example) merges formed polypeptide, or (iv) additional amino acid sequence is fused to this peptide sequence and the polypeptide that forms (such as targeting sequencing or secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion of the formation of antigen I gG fragment). According to the instruction of this paper, these fragments, derivative and analog belong to the known scope of those skilled in the art.
In the present invention, term " people TSP1 polypeptide " refers to have full-length polypeptide or the mature polypeptide of the SEQ ID NO:2 sequence of people TSP1 protein active. This term also comprises having and people TSP1 albumen identical function variant form (as promoting the function of liver cancer cell growth), SEQ ID NO.2 sequence. These variant forms comprise (but being not limited to): one or more (it is individual to be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several and (be generally in 20 in that C end and/or N are terminal, preferably being in 10, more preferably is in 5) amino acid. For example, in the art, when replacing with the close or similar amino acid of performance, usually can not change the function of protein. Again such as, add the function that or several amino acid also can not change protein usually in that C end and/or N are terminal. This term also comprises active fragment and the reactive derivative of people TSP1 albumen.
The variant form of this polypeptide comprises: homologous sequence, conservative variant, allelic variant, natural mutation, induced mutation body, under high or low stringency condition can with the coded albumen of the DNA of people TSP1 DNA hybridization and the polypeptide or the albumen that utilize the antiserum of anti-human TSP1 polypeptide to obtain. The present invention also provides other polypeptide, as comprises the fusion of people TSP1 polypeptide or its fragment. Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people TSP1 polypeptide. Usually, this fragment have people TSP1 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analog of people TSP1 albumen or polypeptide. The difference of these analogs and natural human TSP1 polypeptide can be the difference on the amino acid sequence, also can be the difference that does not affect on the modified forms of sequence, perhaps haves both at the same time. These polypeptide comprise genetic variant natural or that induce. The induce variation body can obtain by various technology, as by radiation or be exposed to mutagens and produce random mutagenesis, also can pass through direct mutagenesis method or the biological technology of other known moleculars. Analog also comprises having the analog that is different from the amino acid whose residue of natural L-(such as D-amino acid), and has that non-natural exists or synthetic amino acid analogue. Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(usually the not changing primary structure) form of modification comprises; Chemically derived form such as acetylation or the carboxylated of the polypeptide that body is interior or external. Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing such as those in the synthetic and processing of polypeptide or further. This modification can be carried out glycosylated enzyme (such as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to. Modified forms also comprises have the phosphorylated amino acid residue sequence of (such as phosphotyrosine, phosphoserine, phosphothreonine). Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " people TSP1 albumen conservative variation polypeptide " refers to compare with the amino acid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best. These conservative variation polypeptide preferably carry out amino acid substitution according to table 1 and produce.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotides of the present invention can be dna form or rna form. Dna form comprises cDNA, genomic DNA or artificial synthetic DNA. DNA can be strand or double-stranded. DNA can be coding strand or noncoding strand. The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the variant of degeneracy. As used herein, " variant of degeneracy " refers in the present invention encode and has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotides of the mature polypeptide of coding TS P1 comprise: the coded sequence of an encoding mature polypeptide; The coded sequence of mature polypeptide and various additional code sequence; The coded sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence. Term " polynucleotides of coded polypeptide " can be the polynucleotides that comprise this polypeptide of encoding, and also can be the polynucleotides that also comprise additional code and/or non-coding sequence.
The invention still further relates to the variant of above-mentioned polynucleotides, its coding has the polypeptide of identical amino acid sequence or fragment, analog and the derivative of polypeptide with the present invention. The variant of these polynucleotides can be the allelic variant of natural generation or the variant that non-natural occurs. These nucleotide diversity bodies comprise and replace variant, deletion mutation body and insert variant. As known in the art, allelic variant is the replacement form of polynucleotides, and it may be replacement, disappearance or the insertion of one or more nucleotides, but can be from not changing in fact the function of its coded polypeptide.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, more preferably at least 80%, the polynucleotides of at least 90% or 95% homogeny best. The present invention be more particularly directed under stringent condition and the interfertile polynucleotides of polynucleotides of the present invention. In the present invention, " stringent condition " refers to: (1) than the hybridization under LIS and the higher temperature and wash-out, such as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturant, such as 50% (v/v) formamide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above. And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization, comprise the nucleic acid fragment of justice and antisense. As used herein, the length of " nucleic acid fragment " contains 15 nucleotides at least, better is at least 30 nucleotides, is more preferably at least 50 nucleotides, preferably more than at least 100 nucleotides. Nucleic acid fragment can be used for the amplification technique (such as PCR) of nucleic acid to determine and/or to separate the polynucleotides of coding TS P1 albumen. Because TSP1 one has the albumen that promotes liver cancer cell growth, so the nucleic acid fragment of antisense can be used for suppressing the expression of TSP1.
People TSP1 nucleotides full length sequence of the present invention or its fragment can use pcr amplification method, recombination method or artificial synthetic method to obtain usually. For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of conventional method well known by persons skilled in the art as template, amplification and must relevant sequence. When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain in large quantity relevant sequence with recombination method. This normally is cloned into carrier with it, changes cell over to again, then separates obtaining relevant sequence from the host cell after the propagation by conventional method.
In addition, also can synthesize relevant sequence, especially fragment length more in short-term with artificial synthetic method. Usually, by first synthetic a plurality of small fragments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, derivative) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
The method of using round pcr DNA amplification/RNA is optimized for and obtains gene of the present invention.The primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or TSP1 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
By the recombinant DNA technology of routine, can utilize polynucleotide sequence of the present invention to can be used to express or produce the TSP1 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people TSP1 polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, people TSP1 polynucleotide sequence can be inserted in the recombinant expression vector.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains people TSP1 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, the bacterial cell of streptomyces; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS or 293 cells etc.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The people TSP1 albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the antibody, polypeptide or other material that are used to screen antagonism TSP1 protein function.
On the other hand, the present invention also comprises people TSP1 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people TSP1 gene product or fragment.Preferably, refer to that those can combine with people TSP1 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Antibody of the present invention can be prepared by the known various technology of those skilled in that art.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule; Or chimeric antibody.
The proteic antibody of anti-people TSP1 can be used in the immunohistochemistry technology, detects the people TSP1 albumen in the biopsy specimen.
Antibody of the present invention can be used for treatment or prevention people's TSP1 protein related diseases such as tumour.A kind of method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell of people TSP1 protein positive, as tumour cell.
Utilize albumen of the present invention,, can filter out with TSP1 albumen interactional material takes place, as acceptor, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
TSP1 antagonist (as antibody and antisense sequences) can be directly used in disease treatment, for example, is used for the treatment of tumour aspect.In addition, but also coupling other treatment agent, as TNF-α, TNF-β etc.
The present invention also provides a kind of pharmaceutical composition, and it contains TSP1 antagonist of the present invention (as antibody and antisense sequences) and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents be the treatment significant quantity, for example every day about 1 microgram-10 mg/kg body weight.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people TSP1 protein level.These tests are known in the art.The people TSP1 protein level that is detected in the test can be used for diagnosing tumour.
Whether having the proteic method of TSP1 in a kind of test sample is to utilize the proteic specific antibody of TSP1 to detect, and it comprises: sample is contacted with the TSP1 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample TSP1 albumen.
The proteic polynucleotide of TSP1 can be used for the diagnosis and the treatment of TSP1 protein related diseases.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray or DNA chip, is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.The antibody of anti-TSP1 can be fixed on the protein chip, is used for the TSP1 albumen of test sample.
The present invention also provides a kind of test kit that detects tumour, the primer that it contains specific amplification TSP1 to and/or the TSP1 specific antibody.In addition, also can contain specific probe and/or PCR damping fluid etc.
In addition, in view of TSP1 is the distinctive immunity antigen of tumour cell, be secreted in the body fluid.Therefore, the direct mensuration of the TSP1 in blood sample or the urine also can be used as the foundation of early diagnosis of tumor except the auxiliary diagnosis that can be used as tumour with the observation index more.
Major advantage of the present invention is:
(1) TSP1 exists only in the hepatocarcinoma patient serum, and can not detect in normal people or non-liver cancer patient's serum.Therefore, false positive rate is low.
(2) TSP1 is a secreted protein, is convenient to be applied to serodiagnosis, the prognosis monitoring of liver cancer, and can be used as the target molecule of gene therapy, development genetically engineered drug or conduct design PTS.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, condition described in the molecular cloning laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989), or the condition of advising according to manufacturer.
The acquisition of TSP1
TSP1 obtains by make up human fetal cDNA library with ordinary method.Get 3,6,9 the monthly age fetal tissue, (GIBCO BRL company) extracts total RNA by manufacturer's specification sheets with Trizol reagent, extracts mRNA with the mRNA test kit (Pharmacia company) of purifying.Make up the cDNA library of above-mentioned mRNA with pCMV-script TMXR cDNA library construction test kit (Stratagene company).Wherein ThermoScript II is used MMLV-RT-Superscript II (GIBCO BRL) instead, and reverse transcription reaction carries out at 42 ℃.Transform XL 10-Gold recipient cell, obtained 1 * 10
6The cDNA library of cfu/ μ g cDNA titre.The first round is picking cDNA clone at random, is probe with high abundance cDNA clone with the cDNA clone who has proved short growth of cancer cells function thereafter, screening by hybridization cDNA library, weak positive and negative clone of picking.With Qiagen 96 orifice plate plasmid extraction test kits, carry out the extraction of plasmid DNA by shop instruction.Plasmid DNA and empty carrier transfection simultaneously hepatoma cell line 7721.After the 100ng DNA alcohol precipitation drying, add 6 μ l H
2Transfection is treated in the O dissolving.Add 0.74 μ l liposome and 9.3 μ l serum-free mediums in every part of DNA sample, behind the mixing, room temperature was placed 10 minutes.Add 150 μ l serum-free mediums in every pipe, divide equally and add 3 holes and grow in 7721 cells of 96 orifice plates, placed 2 hours for 37 ℃, every hole adds 50 μ l serum-free mediums again, 37 ℃ 24 hours.Every hole is changed 100 μ l and is trained liquid entirely, 37 ℃ 24 hours, change the full training liquid 100 μ l that contain G418,37 ℃ 24-48 hour, the limit is observed, the training liquid that G418 concentration does not wait is changed on the limit.After about 2-3 time, there is the clone to form up to the microscopy cell, counting.Find that the TSP1 clone has the cancer cells of promotion clone formation effect, the result is as shown in the table.
CDNA clone's transfectional cell (7721) clone formation situation
| CDNA clones title | CDNA clones number (three repetitions) | Empty carrier clone number (three repetitions) | ||||
| ??TSP1 | ????49 | ????53 | ????45 | ????19 | ????22 | ????16 |
The cDNA clone is adopted two deoxidation cessation method, on the ABI377 automatic dna sequencer, measure its nucleotide sequence, obtain full length sequence SEQ ID NO:1, ORF is positioned at the 779-1402 position, one 208 the amino acid whose TSP1 albumen (the about 21Kda of molecular weight) of encoding, wherein signal peptide is positioned at the 1-23 position, so maturation protein has the aminoacid sequence of 26-208 position among the SEQ ID NO:2.
1?
MGTGGSLLCG?CSLVLSCLCP?SASLPDPGNS?TWPPGAQAGL?PAALALPLPR?LPRILFPMAG
61?RPARPSSDFV?GCAQGMCCHG?RQGTVHIHTS?SVSCWTPCPV?TGTGGTAVSR?KDRVLPHRRQ
121?VSLACVCAVG?ERAGQLWSQK?PVQMARPSAR?HLLPRGSSPN?SQAVLLPSVC?PVPWPPVGPS
181?PGQGEGLSPA?FPGVGTDRGD?SWALVLQV(SEQ?ID?NO：2)
Embodiment 2: PCR obtains full-length gene from placenta or fetus cDNA:
Get the fetal tissue at 3,6,9 monthly ages, (GIBCO BRL company) extracts total RNA by manufacturer's specification sheets with Trizol reagent, extracts mRNA with the mRNA test kit (Pharmacia company) of purifying.With MMLV-RT-Superscript II (GIBCO BRL), ThermoScript II is carried out reverse transcription reaction at 42 ℃, obtains placenta or fetus cDNA.Utilize special primer (as shown in the table), by 97 ℃ of 3 ' 1 circulation.94 ℃ 30 " 60 ℃ 30 " 72 ℃ of 1 ' 35 circulation, pcr amplification is carried out in 72 ℃ of 10 ' 1 circulation, and acquisition contains the amplified production of each protein gene of complete open reading frame sequence.Amplified production is through sequence verification, and the sequence that records with embodiment 1 conforms to.
Gene specific primer
| Clone's title | Special primer 1 (5 ' → 3 ') | Special primer 2 (5 ' → 3 ') |
| ??TSP1 | ?GGTCTTGATGTGGCAGGAGT(SEQ?ID?NO：3) | GATTGACCCGAAACAGGTGG(SEQ?ID?NO：4) |
Recombinant expressed and the purifying of embodiment 3TSP1 albumen
In this embodiment, be template with the pcr amplification product among the embodiment 2,5 ' and 3 ' the PCR Oligonucleolide primers held following with sequence increases, and obtains people TSP1 DNA as inserting fragment.
5 ' end Oligonucleolide primers sequence is: 5 '-GCCCGAATTCGACCCTGGCAACAGCACCTGG-3 ' (SEQID NO:5).This primer contains the restriction enzyme site of EcoRI restriction enzyme, is the part encoding sequence that does not contain signal peptide sequence after this restriction enzyme site;
3 ' end primer sequence is: 5 '-GCCCAAGCTTCTACACCTGAAGGACCAATG-3 ' (SEQ ID NO:6).This primer contains the part encoding sequence of restriction enzyme site, translation termination and the people TSP1 of HindIII restriction enzyme.
Added the plasmid pT that forms after the 6XHis tag sequence at the N of the pET21a+ of Novagen company carrier end
7470 (Fig. 4)
People TSP1 albumen cDNA PCR product purification is after EcoRI, and the HindIII double digestion is with the pT of double digestion
7470 carriers are connected to form carrier pT
7470-TSP1 also is converted into competence intestinal bacteria HMS174 (DE3) (Novagen company), and the picking positive colony is identified back purifying and order-checking (377 type sequenators of ABI company, BigDye Terminator test kit, PE company).Order-checking confirms to insert complete TSP1 encoding sequence.
Choosing the positive intestinal bacteria DE3 clone who expresses TSP1 is inoculated in the 10ml LB substratum, 37 ℃ of 300rpm shaking culture are spent the night, be diluted at 1: 100 and be inoculated in LB substratum shaking culture 2.5hr, add behind the 100mM IPTG to 0.1mM 37 ℃ and induce 2-3hr, 5,4 ℃ of centrifugal 10min of 000g remove supernatant, put and use 50ml sample-loading buffer (0.5M NaCl on ice, 20mM imidazoles 2.7mM KCl, 10.1mM Na
2HPO
4, 1.8mM KH
2PO
4, pH8.0) resuspended, ultrasonic (B.Braun Labsonic U) fragmentation, then 12,4 ℃ of centrifugal 10min of 000g, supernatant with 0.8 μ m membrane filtration after, cross 1ml Ni
2+Metal-chelating Sepharose 4B chromatography column behind the sample-loading buffer thorough washing, adds 500ul imidazoles elution buffer (0.5M NaCl, 500mM imidazoles 2.7mM KCl, 10.1mM Na
2HPO
4, 1.8mM KH
2PO
4, pH8.0) room temperature leaves standstill after 30 minutes and collects elutriant, repeats wash-out 2-3 time, obtains people TSP1 albumen.
The result is shown in Figure 1A and 1B, and the proteic molecular weight of TSP1 is about 21Kda, conforms to predictor.
The generation of embodiment 4 anti-TSP1 protein antibodies
The recombinant human TSP1 albumen that obtains among the embodiment 3 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.With the albumen of 150 μ g/0.2ml emulsifications, rabbit (new zealand rabbit) is carried out peritoneal injection.After 14 days,, rabbit is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people TSP1 protein gene translation product with it.
Found that antibody can combine (Fig. 1 C) specifically with albumen of the present invention.
Embodiment 5:TSP1 electricity changes mouse test
The TSP1 coding region sequence is cloned into commercially available pCDNA3.1 carrier, and plasmid DNA and empty carrier electricity respectively forward the BALB/e mouse to.Concrete grammar is: only get BALB/e mouse 16-18, at both sides leg muscle injection DNA (every mouse 20ug DNA is dissolved in the 100ul physiological saline).The muscle position of electric shock injection immediately.
The back mouse execution of three weeks is from eyeball blood sampling, separation of serum.Method with co-immunoprecipitation identifies in the serum whether have TSP1 albumen.Get mice serum 20ul, add albumin A/G sepharose 4B (Invitrogen company) 1ul, behind the mixing, placed 1 hour for 4 ℃.Centrifugal 2,000g * 2min gets supernatant.Add albumin A/G sepharose 4B 10ul and the anti-TSP1 polyclonal antibody of rabbit 10ul.Behind the mixing, 4 ℃ of placements are spent the night.Centrifugal 2000g * 2min gets precipitation.After precipitation is washed 5 times repeatedly with PBS, add 1 * sample buffer 15ul, mixing be placed on 100 ℃ 5 minutes.SDS PAGE electrophoresis 15% separation gel, 5% concentrates glue.Deposition condition: 100V * 10min, 200V * 50min.Electrotransfer is to pvdf membrane, jump condition: 40V * 35min.After pvdf membrane is used the PBST rinsing, at room temperature with the PBST sealing that contains 5% skim-milk 4 hours.Add the anti-TSP1 polyclonal antibody of rabbit (dilution in 1: 2000), 4 ℃ are spent the night.Wash film 3 times with PBST.Add the mouse-anti rabbit antibody (Invitrogen, dilution in 1: 2500) that has horseradish peroxidase, room temperature was placed 1 hour.PBST washes film 3 times.After Super Signal West Femto MaximumSensitivity Substrate (PIERCE, horseradish peroxidase substrate) processing, press the X-ray sheet.
The result detects the TSP1 albumen of secreting, expressing as shown in Figure 2 in mice serum.
The detection of embodiment 6:TSP1 in hepatitis, hepatocarcinoma patient serum
Detect TSP1 albumen among the patients serum with Wester Blot.
Sample preparation: serum sample 2ul, 6 * sample preparation liquid 1.67ul, H
2O 6.33ul.100 ℃, 3 minutes.High speed centrifugation (13,000rpm, 3min).Get sample on the supernatant.
The SDS-PAGE electrophoretic analysis: 12% separation gel, 4% concentrates glue.
Electrotransfer (wet type) is to protran film (Schleicher ﹠amp; Schuell): 400mA 3 hours.
After film is used the PBST rinsing, at room temperature with the PBST sealing that contains 5% skim-milk 4 hours.Add the anti-TSP1 polyclonal antibody of rabbit (1: 500 dilution), 4 ℃ 16 hours.Add the mouse-anti rabbit antibody (Invitrogen, dilution in 1: 2000) that has horseradish peroxidase, room temperature was placed 1 hour.After Super Signal West Femto MaximumSensitivity Substrate (PIERCE, horseradish peroxidase substrate) processing, press the X-ray sheet.
The result as shown in Figure 3.Detected hepatocarcinoma patient serum 21 examples altogether, wherein 15 examples detect TSP1 albumen (positive rate 71.4%); Normal human serum 3 examples, HBV male hepatitis patient serum 16 examples, ovarian cancer patients serum's 4 examples, carcinoma of the pancreas patients serum's 3 examples, blood serum of colon cancer patient 4 examples, Patients with Gastric Cancer serum 4 examples, rectum cancer patients serum's 1 example, pelvic cancer patients serum 1 example, cancer of the brain patients serum's 1 example, the TSP1 Protein Detection is all negative.This shows that TSP1 is a kind of liver cancer marker of special secretion.
Embodiment 7
Detection kit
In the present embodiment, preparation detects the diagnostic kit of TSP1, this test kit contain 200 microlitre embodiment, 4 preparations anti-TSP1 specific antisera and describe and how to use test kit to detect the illustrative material of TSP1.Test kit also can contain one or more in the following group: be used to assist the various markers or the labelled reagent that detect; The reagent that is used to hybridize (comprising damping fluid etc.); Sampling apparatus comprises that fine needle is first-class; And positive and negative hybridization contrast etc.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Xinshijie Gene Techn Development Co., Ltd.
＜120〉as relevant secretory protein of the tumour of tumor markers and uses thereof
<130>032890
<160>6
<170>PatentIn?version?3.1
<210>1
<211>2978
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<220>
<221>CDS
<222>(779)..(1402)
<223>
<400>1
ggcttactgc?ggaacagcag?gttggtgtcc?acagcattca?gcatctggaa?cacggcctgg?????60
gggtggtagc?agatggtgtg?gcctgtgtaa?cagacgggca?gctggtggct?cagggctccc????120
tgtctcctgg?ggggctgtag?cccacccctg?cccctcttca?gccccaagct?cctcctcatc????180
cacccccttt?cctctcttgt?gggtggtgag?tcagggaggg?tcaagggtgc?ttgggtgggg????240
gcaggcctgg?gggtctttaa?gcccggcctc?gccctcccac?ctatgaagag?tgtcacccag????300
gtcttgatgt?ggcaggagtg?gctgtgcagg?tagctgaggg?cctgtgacaa?gtggatgctg????360
aattcctcct?ggctgcgggt?catctggccg?gaggagagca?cacctggctg?ggacgggctg????420
ggggccctgg?gcataccagg?gtcctccagc?cccagtttgc?cttgcccagc?ccctggagct????480
gctatagcag?ctgtgtgtga?gacgggagtg?aatgggggag?ccgcaagcct?ggtctccccc????540
actccctggc?cctgttcctc?cccaccgatc?ccaggcctct?caccaggcag?gtccagagga????600
agtggcgggc?gctgaggccc?ctctcccagg?ccagcgtgca?gaagagggtg?tgcagtagcc????660
gccagcggag?cagcacagca?cagcggtaga?aggtgaactt?ggcctgctgc?agggacaggc????720
gtggagggtc?acccaccgcc?tatgtctgag?ccctttcccc?tagaggccac?aggcctcc??????778
atg?ggc?act?gga?ggc?agc?ctg?ctg?tgc?ggg?tgt?tcc?ctg?gtt?ctg?tcc????826
Met?Gly?Thr?Gly?Gly?Ser?Leu?Leu?Cys?Gly?Cys?Ser?Leu?Val?Leu?Ser
1???????????????5???????????????????10??????????????????15
tgc?ttg?tgc?ccc?tcg?gca?agc?ctc?ccc?gac?cct?ggc?aac?agc?acc?tgg????874
Cys?Leu?Cys?Pro?Ser?Ala?Ser?Leu?Pro?Asp?Pro?Gly?Asn?Ser?Thr?Trp
20??????????????????25??????????????????30
ccc?ccc?gga?gcc?cag?gct?ggt?ctg?ccc?gcg?gcc?ctg?gcc?ctg?ccc?ctt????922
Pro?Pro?Gly?Ala?Gln?Ala?Gly?Leu?Pro?Ala?Ala?Leu?Ala?Leu?Pro?Leu
35??????????????????40??????????????????45
cca?cgg?ttg?ccc?cgt?atc?ctt?ttc?ccc?atg?gca?ggg?aga?ccc?gcg?agg????970
Pro?Arg?Leu?Pro?Arg?Ile?Leu?Phe?Pro?Met?Ala?Gly?Arg?Pro?Ala?Arg
50??????????????????55??????????????????60
cca?agc?tct?gac?ttc?gtg?ggc?tgt?gca?cag?ggc?atg?tgc?tgc?cac?ggc????1018
Pro?Ser?Ser?Asp?Phe?Val?Gly?Cys?Ala?Gln?Gly?Met?Cys?Cys?His?Gly
65??????????????????70??????????????????75??????????????????80
agg?cag?ggc?aca?gtc?cat?att?cac?aca?agc?tct?gtg?agc?tgc?tgg?acc????1066
Arg?Gln?Gly?Thr?Val?His?Ile?His?Thr?Ser?Ser?Val?Ser?Cys?Trp?Thr
85??????????????????90??????????????????95
ccc?tgc?ccc?gtt?aca?ggg?act?ggg?ggc?aca?gca?gtg?agc?aga?aaa?gac????1114
Pro?Cys?Pro?Val?Thr?Gly?Thr?Gly?Gly?Thr?Ala?Val?Ser?Arg?Lys?Asp
100?????????????????105?????????????????110
cgg?gtc?ctg?ccg?cat?cga?cgg?caa?gtc?tcg?ctc?gca?tgc?gtg?tgc?gca????1162
Arg?Val?Leu?Pro?His?Arg?Arg?Gln?Val?Ser?Leu?Ala?Cys?Val?Cys?Ala
115?????????????????120?????????????????125
gtg?ggg?gag?cgg?gca?ggc?caa?ctg?tgg?tca?cag?aaa?cca?gtg?cag?atg????1210
Val?Gly?Glu?Arg?Ala?Gly?Gln?Leu?Trp?Ser?Gln?Lys?Pro?Val?Gln?Met
130?????????????????135?????????????????140
gcc?aga?ccc?tct?gcc?cgc?cac?ttg?ctg?ccc?cgt?ggg?agc?tcc?ccc?aac????1258
Ala?Arg?Pro?Ser?Ala?Arg?His?Leu?Leu?Pro?Arg?Gly?Ser?Ser?Pro?Asn
145?????????????????150?????????????????155?????????????????160
tct?cag?gca?gtg?ctg?ctg?cca?tcc?gtc?tgc?ccc?gta?ccc?tgg?cct?cct????1306
Ser?Gln?Ala?Val?Leu?Leu?Pro?Ser?Val?Cys?Pro?Val?Pro?Trp?Pro?Pro
165?????????????????170?????????????????175
gtg?ggt?ccc?agc?cct?ggc?caa?ggt?gaa?ggc?cta?tca?cct?gcc?ttt?cct????1354
Val?Gly?Pro?Ser?Pro?Gly?Gln?Gly?Glu?Gly?Leu?Ser?Pro?Ala?Phe?Pro
180?????????????????185?????????????????190
ggg?gtg?ggc?act?gac?cgt?ggc?gac?agc?tgg?gca?ttg?gtc?ctt?cag?gtg????1402
Gly?Val?Gly?Thr?Asp?Arg?Gly?Asp?Ser?Trp?Ala?Leu?Val?Leu?Gln?Val
195?????????????????200?????????????????205
taggagcagg?ggcaccatgc?tctggtgcac?ctgggtccgc?agccgctcag?ctccctgtct????1462
gccatggccg?ccaccaggtc?cccgaacagt?gccatggctg?ccgcccgaat?cccgtccgct????1522
cctgcaaggc?agaggctcag?aggcacggcc?agacctgtcc?aggggtccca?gctttggtcc????1582
aagttgggac?cccacacctt?gtaggggtac?aactcagttc?tttctgcagg?attccttcac????1642
ccaggctctc?ggctcccggg?gaagggaagg?gctggggctc?ccccctcaca?cagggctctc????1702
tggtgtccct?gaggatgtaa?gaatcacatc?tcccttctac?ccacaactgc?atcctggcag????1762
cccaggcctc?atgaatgcat?ttgaggggcg?cctatccccc?agattcccca?gtgaaggaaa????1822
aacagccacg?ctaaccgtgc?tgacatgtca?gaaagcaaat?ctgggtaggc?tgtcgtgggg????1882
ccggagacca?ctgcacttgg?agactgaacg?tgagaactag?ttcagccctg?tggagaaggg????1942
gtgagcgcca?ggggcccacc?cagcccacct?gctcagtgcc?cacctcaacc?gagggccaca????2002
agcgggcagc?tccccagggc?ctgggcctcc?ctgcttgcag?cttggggttc?cccctttggc????2062
agaggaaggg?agctgggttg?ggaggagggt?cctggagggc?gtgagcagga?ggtagccccg????2122
ccctgcccca?gtgctcacgt?cattaaagaa?ggagcgtgtg?ctgatggcaa?cgccgaggct????2182
ctgactccct?gtgccctgcg?cgcccaggcg?gtgcagcgtg?tctgacacgg?tgcccatgat????2242
gcacacgatc?acctggtcgc?tgctctggaa?gaagccgtcg?agcaagggct?gcagctgtcc????2302
ctggagcagg?cttccctggg?ggtggtggcg?gctggtgggc?ggagagcact?aggacccgct????2362
ggccccatgc?ccccgcctcg?ttctcccact?tgaccccctc?accccatctg?cactgggtgg????2422
gggggtgggg?ggtggtgatt?cagagctgtg?ggtcccggcc?tggcccttcc?cgccatgggg????2482
agctgtgggt?cccggcctgg?ccctgcccac?cgtggggagc?tgtgccccta?actgggcttt????2542
gtccaccagg?agctgcgtgg?tctggacagg?gtggcctctt?ttcttttttg?agacagggtc????2602
tcacactgtc?acccaggctg?gagtacagtg?gtgtgaccat?agcttactgc?agccttgacc????2662
tcccaggctc?aagcaatcct?cccaacataa?cctcctgagt?agctgggtct?acagccagtt????2722
ccgtcttctc?cacttgattg?cgtgtttgca?gtgagttcct?gagttatcgg?gatgaatggt????2782
cagaaagcag?tgtgcccacc?aatggatgtt?tcctgccatt?gggcccctta?gcagtgactt????2842
gggtgcaaac?cagggtgatt?tttacaactt?ttaaacaagt?ttaaagcaac?tttgttggct????2902
ttcttagctg?tttgctttga?aaatattaaa?ttcattttca?gcaagtgagt?cattcaacaa????2962
aaaaaaaaaa?aaaaaa????????????????????????????????????????????????????2978
<210>2
<211>208
<212>PRT
＜213〉homo sapiens (Homo sapiens)
<400>2
Met?Gly?Thr?Gly?Gly?Ser?Leu?Leu?Cys?Gly?Cys?Ser?Leu?Val?Leu?Ser
1???????????????5???????????????????10??????????????????15
Cys?Leu?Cys?Pro?Ser?Ala?Ser?Leu?Pro?Asp?Pro?Gly?Asn?Ser?Thr?Trp
20??????????????????25??????????????????30
Pro?Pro?Gly?Ala?Gln?Ala?Gly?Leu?Pro?Ala?Ala?Leu?Ala?Leu?Pro?Leu
35??????????????????40??????????????????45
Pro?Arg?Leu?Pro?Arg?Ile?Leu?Phe?Pro?Met?Ala?Gly?Arg?Pro?Ala?Arg
50??????????????????55??????????????????60
Pro?Ser?Ser?Asp?Phe?Val?Gly?Cys?Ala?Gln?Gly?Met?Cys?Cys?His?Gly
65??????????????????70??????????????????75??????????????????80
Arg?Gln?Gly?Thr?Val?His?Ile?His?Thr?Ser?Ser?Val?Ser?Cys?Trp?Thr
85??????????????????90??????????????????95
Pro?Cys?Pro?Val?Thr?Gly?Thr?Gly?Gly?Thr?Ala?Val?Ser?Arg?Lys?Asp
100?????????????????105?????????????????110
Arg?Val?Leu?Pro?His?Arg?Arg?Gln?Val?Ser?Leu?Ala?Cys?Val?Cys?Ala
115?????????????????120?????????????????125
Val?Gly?Glu?Arg?Ala?Gly?Gln?Leu?Trp?Ser?Gln?Lys?Pro?Val?Gln?Met
130?????????????????135?????????????????140
Ala?Arg?Pro?Ser?Ala?Arg?His?Leu?Leu?Pro?Arg?Gly?Ser?Ser?Pro?Asn
145?????????????????150?????????????????155?????????????????160
Ser?Gln?Ala?Val?Leu?Leu?Pro?Ser?Val?Cys?Pro?Val?Pro?Trp?Pro?Pro
165?????????????????170?????????????????175
Val?Gly?Pro?Ser?Pro?Gly?Gln?Gly?Glu?Gly?Leu?Ser?Pro?Ala?Phe?Pro
180?????????????????185?????????????????190
Gly?Val?Gly?Thr?Asp?Arg?Gly?Asp?Ser?Trp?Ala?Leu?Val?Leu?Gln?Val
195?????????????????200?????????????????205
<210>3
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
ggtcttgatg?tggcaggagt????????????????????????????????????????20
<210>4
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
gattgacccg?aaacaggtgg??????????????????????????????????????????20
<210>5
<211>31
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>5
gcccgaattc?gaccctggca?acagcacctg?g?????????????????????????31
<210>6
<211>30
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>6
gcccaagctt?ctacacctga?aggaccaatg???????????????????????????30
Claims (10)
1. isolating people TSP1 polypeptide is characterized in that this polypeptide is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have the function that promotes liver cancer cell growth by (a) polypeptides derived.
2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide has the aminoacid sequence of the group of being selected from down: 1-208 position or 26-208 amino acids sequence among the SEQ ID NO:2.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is selected from down group:
(a) polynucleotide of polypeptide according to claim 1 of encoding;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the sequence of 779-1402 position among the SEQ ID NO:1;
(b) has the sequence of 1-2978 position among the SEQ ID NO:1;
(c) has the sequence of 854-1402 position among the SEQ ID NO:1.
5. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
6. a host cell is characterized in that, it contains the described carrier of claim 5.
7. proteic preparation method of TSP1 is characterized in that this method comprises:
(a) under conditions suitable for the expression, cultivate the described host cell of claim 7;
(b) from culture, isolate TSP1 albumen.
8. energy and the described TSP1 protein-specific of claim 1 bonded antibody.
9. whether there is the proteic method of TSP1 in a test sample, it is characterized in that, comprising:
Sample is contacted with TSP1 protein-specific bonded antibody, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample TSP1 albumen.
10. a test kit that detects cancer is characterized in that, it contains described antibody of claim 8 and specification sheets.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310109301 CN1281622C (en) | 2003-12-12 | 2003-12-12 | Excreted proteins as indicators related to tumor and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310109301 CN1281622C (en) | 2003-12-12 | 2003-12-12 | Excreted proteins as indicators related to tumor and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1626550A true CN1626550A (en) | 2005-06-15 |
| CN1281622C CN1281622C (en) | 2006-10-25 |
Family
ID=34758932
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200310109301 Expired - Fee Related CN1281622C (en) | 2003-12-12 | 2003-12-12 | Excreted proteins as indicators related to tumor and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1281622C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101643503B (en) * | 2009-09-03 | 2012-04-18 | 广西医科大学 | Neutrophil-activating peptide 2 (72) taken as primary liver cancer markers and application thereof |
-
2003
- 2003-12-12 CN CN 200310109301 patent/CN1281622C/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101643503B (en) * | 2009-09-03 | 2012-04-18 | 广西医科大学 | Neutrophil-activating peptide 2 (72) taken as primary liver cancer markers and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1281622C (en) | 2006-10-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1281622C (en) | Excreted proteins as indicators related to tumor and application | |
| CN1244595C (en) | Tumor suppressor protein and its application | |
| CN1234728C (en) | Novel human lymphokine, its coding sequence and use | |
| CN1244375C (en) | Human liver regeneration related protein and its application | |
| CN1194012C (en) | Sperm formation relative protein and its coding sequence and use | |
| CN1281962C (en) | Tumor relevant secretory protein as a liver cancer marker and uses thereof | |
| CN1169832C (en) | Identification and function research of gene p28-II | |
| CN1216910C (en) | Novel liver regeneration related protein, its code sequence and application | |
| CN1257271C (en) | Serine proteinase and coded sequence thereof | |
| CN1209369C (en) | Cell death inducing protein and its coding sequence and use | |
| CN1670197A (en) | Arginase of Japanese blood fluke, its coding nucleic acid and application | |
| CN1172954C (en) | High-expression gene of liver cancer, protein coded by it and its application | |
| CN1238379C (en) | New osteoclast formation inhibiting factor and its coding sequence and use | |
| CN1746187A (en) | Atrial fibrillation peccant gene and uses thereof | |
| CN1271007A (en) | New human chitinase protein and its code sequence | |
| CN1267727A (en) | New human phosphorylated zymoprotein of pyruvate dehydrogenase and its code sequence | |
| CN1631898A (en) | Mitochondria traffic protein molecule for human marrow stromal cell and sequence encoding same and use thereof | |
| CN1724664A (en) | Human HOLF 402 protein and its coding sequence | |
| CN1272540A (en) | Human immune factor related protein and its coded sequence | |
| CN1384114A (en) | Growth promoting factor and its prepn and use | |
| CN1390852A (en) | Human auricular fibrillation pathogene and coding protein and its usage | |
| CN1352248A (en) | New polypeptide-S-adenosylmethionine synthetase 14.08 and polynucleotide for encoding such polypeptide | |
| CN1632119A (en) | Human LSB gene sequence, encoded polypeptide thereof, preparation method and use therefor | |
| CN1268566A (en) | New human teratocarnogenesis related protein and its coding sequence | |
| CN1310184A (en) | New human transposition chain related membrane protein and its coding sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |