CN118141714A

CN118141714A - Application of kiwi berry extract in resisting skin aging

Info

Publication number: CN118141714A
Application number: CN202311592608.3A
Authority: CN
Inventors: 林咏翔; 林晓鼐
Original assignee: TCI Co Ltd
Current assignee: TCI Co Ltd
Priority date: 2022-12-06
Filing date: 2023-11-27
Publication date: 2024-06-07
Also published as: TW202423463A

Abstract

The invention discloses application of a kiwi berry extract in preparing a skin aging resistant composition, wherein the kiwi berry extract is obtained by extracting kiwi berries (ACTINIDIA ARGUTA) with water.

Description

Application of kiwi berry extract in resisting skin aging

Technical Field

The invention relates to a kiwi berry extract, in particular to a kiwi berry extract with skin aging resistance.

Background

With the transition of the times, people pursue a perfect appearance, and have high requirements from the appearance outline, skin texture, skin elasticity and skin texture posture seen from the outside to the internal collagen content. Healthy skin and its complexion are a major factor in maintaining a bright appearance, and thus people pay more attention to health care and maintenance of the skin, and the skin is maintained in an optimal state from inside to outside.

In order to solve the above problems, those skilled in the art are required to develop functional foods for solving the above problems to benefit a wide group of people in need thereof.

Disclosure of Invention

In view of the above, the present invention provides a kiwi extract prepared from kiwi (ACTINIDIA ARGUTA) having an anti-skin aging function.

In some embodiments, the use of a kiwi extract for preparing a composition for combating skin aging, wherein the kiwi extract is obtained by extracting kiwi (ACTINIDIA ARGUTA) with water.

In some embodiments, the kiwi extract is obtained by leaching kiwi in water at 70 ℃ to 90 ℃ for 90 minutes to 120 minutes.

In some embodiments, the kiwi extract is obtained by leaching kiwi in water at 70 ℃ to 90 ℃ until the mixed solution meets a predetermined specification, wherein the predetermined specification is that the Brix (Brix) of the mixed solution at 20 ℃ is 0.6±0.5.

In some embodiments, the weight ratio of kiwi berry to water is 1-5:5-10.

In some embodiments, the foregoing anti-skin aging is reduction of skin damage, reduction of structural damage to DNA, or a combination thereof.

In some embodiments, the kiwi extract is effective to reduce skin damage by reducing Reactive Oxygen Species (ROS).

In some embodiments, the kiwi extract is used to achieve reduced structural damage to DNA by increasing the expression levels of NAD-dependent deacetylase (Sirtuin-1, sirt 1) genes and/or 8-hydroxyguanine glycosylase (OGG 1) genes.

In some embodiments, the foregoing anti-skin aging is reducing skin relaxation.

In some embodiments, the foregoing anti-skin aging is to improve skin elasticity.

In some embodiments, the foregoing anti-skin aging is soothing skin redness.

In some embodiments, the effective dose of the liquid composition is 2 grams per day and the effective dose of the solid composition is 0.2 grams per day.

In summary, the kiwi extract of any of the embodiments is prepared by extracting kiwi with water, which can be used to prepare an anti-skin aging composition. In some embodiments, the foregoing anti-skin aging is reducing skin damage by reducing Reactive Oxygen Species (ROS), reducing structural damage to DNA by increasing expression of SIRT1 genes and/or OGG1 genes, or a combination thereof. In some embodiments, the foregoing anti-skin aging is reducing skin relaxation, improving skin elasticity, soothing skin redness, or a combination thereof.

Drawings

FIG. 1 is a graph of data analysis of relative expression levels of SIRT1 genes;

FIG. 2 is a graph of data analysis of Reactive Oxygen Species (ROS) relative content;

FIG. 3 is a graph of data analysis of cellular DNA structure damage;

FIG. 4 is a graph of data analysis of average relative expression of SIRT1 genes at weeks 0 and 4 in subjects;

FIG. 5 is a graph showing data analysis of average relative expression amounts of OGG1 genes at week 0 and week 4 of subjects;

FIG. 6 is a data analysis graph of skin looseness of subjects at weeks 0 and 4;

FIG. 7 is a graph of data analysis of skin elasticity of subjects at weeks 0 and 4;

FIG. 8 is a data analysis of redness of the skin of the subject at weeks 0 and 4; and

Fig. 9 is a photograph of one of the subjects showing redness of the skin at weeks 0 and 4.

Detailed Description

Statistical analysis was performed herein using Excel software. Data are expressed as mean.+ -. Standard Deviation (SD), and differences between groups are analyzed by student's t-test (student's s t-test). In the drawings, "or" # "means that the p value is less than 0.05," "or" # "means that the p value is less than 0.01, and" "or" # # "means that the p value is less than 0.001. The more "×" or "#", the more significant the statistical difference is represented.

The term "extract" refers to a product prepared by extraction. The extract may be in the form of a solution in a solvent, or the extract may be in the form of a concentrate or concentrate that is free or substantially free of solvent, or may be in the form of a dried powder.

Kiwi (academic name: ACTINIDIA ARGUTA var. Cordifolia; english: kiwiberry) is actinidia arguta, also known as mini kiwi fruit, is a plant of the genus actinidia of the family actinidiaceae, and is one of the most successful wild fruit varieties for artificial domestication and cultivation in 1901 to 2000. The kiwi fruit is a close relation of kiwi fruit, the volume of the kiwi fruit is 3 to 4 times smaller than that of kiwi fruit, and the vitamin C content of the kiwi fruit is 1.3 times that of the kiwi fruit. In addition, the kiwi berry further contains substances such as polyphenol compounds, carotenoid, trace elements and the like.

In some embodiments, the fruit of the kiwi berry (ACTINIDIA ARGUTA) is coarsely crushed, mixed with an extraction solvent (e.g., water) in a certain weight ratio, extracted at a specific temperature to obtain a mixed solution containing solids, the primary extract is filtered to remove fine solid impurities, and the filtered mixed solution is concentrated to obtain a concentrated solution. And then sterilizing the concentrated solution to obtain the sterilized liquid kiwi berry extract. And drying the concentrated solution into powder in a spray drying mode to obtain the solid-state kiwi berry extract. For example, the extraction solvent may be water; the certain weight ratio can be 1-5:5-10; the specific temperature may be 70 ℃ to 90 ℃; and the specific time may be 90 minutes to 120 minutes.

In some embodiments, the fruit of the kiwi berry comprises pericarp, pulp, and seed.

The extraction efficiency can be obviously improved by the specific ratio of the extraction solvent to the extract (such as crushed fruits) or the specific extraction time; and the specific extraction time can avoid degradation of active ingredients in the extract caused by overlong extraction time.

In some embodiments, the kiwi fruit extract is prepared by coarsely crushing kiwi fruit and mixing the kiwi fruit with water at a ratio of 1-5:5-10, and extracting at 70-90deg.C for 90-120 min. For example, the kiwi extract is prepared by mixing fruit powder of kiwi crushed to 12mm with water at a ratio of 1:10, and extracting at 85+ -5deg.C for about 90 min.

In some embodiments, the kiwi extract is obtained by leaching kiwi in water at 70 ℃ to 90 ℃ until the mixed solution meets a predetermined specification, wherein the predetermined specification is that the brix of the mixed solution at 20 ℃ is 0.6±0.5. Wherein, the weight ratio of the kiwi berry to the water is 1-5:5-10. For example, fruit powder of kiwi berry coarsely crushed to 12mm is mixed with water at 1:10 and extracting at 85+ -5deg.C for about 90 min to obtain mixed solution, and measuring Brix of the mixed solution to confirm whether the mixed solution meets the predetermined specification. The predetermined specification is that the Brix of the mixed solution at 20 ℃ is 0.6+/-0.5.

In some embodiments, the mixed solution is filtered with a 400 mesh filter screen to remove fine solids, and the filtered mixed solution is concentrated under reduced pressure to obtain the kiwi berry extract. For example, the temperature of the reduced pressure concentration may be 60 ℃ ± 5 ℃.

In some embodiments, the reduced pressure concentration is performed using 1.+ -. 0.2kg/cm ² of steam.

In some embodiments, the kiwi extract has an anti-skin aging function. For example, anti-skin aging is reduction of skin damage, reduction of structural damage to DNA, or a combination thereof. Specifically: the kiwi extract is used for reducing skin injury by reducing Reactive Oxygen Species (ROS). The kiwi extract can reduce the structural damage of DNA by increasing the expression level of NAD-dependent deacetylase (NAD-DEPENDENT DEACETYLASE sirtuin-1, SIRT 1) gene and/or 8-hydroxyguanine glycosylase (OGG 1) gene.

In some embodiments, the kiwi extract is effective in promoting an anti-aging gene, and the anti-aging gene may be a SIRT1 gene. The protein coded by SIRT1 gene can maintain the stability of telomere and slow down the shortening speed of telomere by means of tissue protein deacetylation (histone deacetylation) and chromatin modification (chromatin modification), so as to achieve the effects of delaying cell aging and prolonging service life. Specifically, the kiwi extract has the capacity of improving the expression level of SIRT1 genes by about 1.3 times, thereby reducing skin DNA damage, protein inactivation and inflammatory reaction.

In some embodiments, the kiwi extract is effective in promoting a DNA repair gene, and the DNA repair gene is an OGG1 gene. The OGG1 gene increases secretion of 8-Oxoguanine DNA Glycosylase in vivo, thereby excision of damaged DNA and aiding DNA repair.

In some embodiments, the kiwi extract is effective to inhibit ROS content. In other words, the administration of the kiwi berry extract to the recipient can slow down the skin inflammation aging phenomenon caused by ROS and avoid the inflammation vicious circle. For example, the kiwi extract can be effective in reducing ROS-induced skin damage by up to 20%.

In some embodiments, the kiwi extract can reduce DNA structural damage. The damage to the cellular DNA structure can be caused either by the metabolic process of the cell itself or by the damage caused by external stimuli. When the receptor takes the kiwi berry extract, the DNA damage of the receptor cells can be effectively reduced, and the skin can be effectively anti-aging to be as new as the original state.

In some embodiments, the anti-skin aging is reducing skin relaxation, improving skin elasticity, soothing skin redness, or a combination thereof. In other words, the receptor can improve the skin relaxation condition and improve the skin elasticity and relieve the skin redness after taking the kiwi berry extract.

In some embodiments, the subject is a human.

In some embodiments, any of the foregoing compositions may be a pharmaceutical. In other words, the pharmaceutical product comprises an effective amount of the kiwi berry extract.

In some embodiments, the aforementioned pharmaceuticals may be manufactured into dosage forms suitable for enteral, parenteral (PARENTERALLY), oral, or topical (topically) administration using techniques well known to those skilled in the art.

In some embodiments, the dosage form for enteral or oral administration may be, but is not limited to, a lozenge (tablet), a tablet (troche), a buccal tablet (lozenge), a pill (pill), a capsule (caplet), a dispersible powder (dispersible powder) or fine particles (granule), a solution, a suspension (suspension), an emulsion (emulgent), a syrup (syrup), an elixir (elixir), a slurry (slurry), or the like. In some embodiments, the dosage form for parenteral or topical administration may be, but is not limited to, an injectable product (injection), sterile powder (sterile powder), external preparation (external preparation), or the like. In some embodiments, the administration of the injectate can be subcutaneous (subcutaneous injection), intradermal (INTRAEPIDERMAL INJECTION), intradermal (INTRADERMAL INJECTION), or intralesional (intralesional injection).

In some embodiments, the aforementioned medicaments may comprise pharmaceutically acceptable carriers (pharmaceutically acceptable carrier) widely used in pharmaceutical manufacturing technology. In some embodiments, the pharmaceutically acceptable carrier may be one or more of the following: solvents (solvents), buffers (buffers), emulsifiers (emulsifier), suspending agents (suspending agent), disintegrants (decomposer), disintegrants (DISINTEGRATING AGENT), dispersants (DISPERSING AGENT), binders (binding agents), excipients (excipients), stabilizers (stabilizing agent), chelating agents (CHELATING AGENT), diluents (diluent), gelling agents (GELLING AGENT), preservatives (PRESERVATIVE), wetting agents (WETTING AGENT), lubricants (lubricant), absorption retarders (absorption DELAYING AGENT), liposomes (liposome) and the like. The type and number of carriers selected will be within the purview of those skilled in the art of expertise and routine skill. In some embodiments, the solvent as a pharmaceutically acceptable carrier may be water, normal saline (normal saline), phosphate buffered saline (phosphate buffered saline, PBS), or an aqueous solution containing alcohol (aqueous solution containing alcohol).

In some embodiments, any of the foregoing compositions may be a non-medical edible product. In other words, the edible product comprises a specific content of the kiwi extract. In some embodiments, the edible product may be a general food, a health food, or a dietary supplement.

In some embodiments, the foregoing edible products may be manufactured into dosage forms suitable for oral administration using techniques well known to those skilled in the art. In some embodiments, the aforementioned general food product may be the edible product itself. In some embodiments, the general food product may be, but is not limited to: beverage (beverages), fermented food (FERMENTED FOODS), baked product (bakery products) or flavoring.

In some embodiments, the resulting kiwi extract can be further used as a food supplement (food additive) to produce a food composition containing the kiwi extract. The kiwi berry extract of any embodiment can be added during the preparation of the raw materials by the prior art method, or the kiwi berry extract of any embodiment can be added during the preparation process of food, and the food product (namely the food composition) for feeding human beings and non-human animals can be prepared by the kiwi berry extract and any edible material.

In some embodiments, the aforementioned compositions containing the kiwi extract may be in a liquid or solid state. For example, the solid state may be a powder or an ingot.

In some embodiments, the composition is used in an amount of at least 2.0 grams per day of liquid kiwi berry extract.

In some embodiments, the composition is used in an amount of at least 0.2 grams per day of solid kiwi extract.

Example 1: preparation of kiwi berry extract

First, the fruit of the kiwi berry (ACTINIDIA ARGUTA) (origin: new Zealand) was prepared and coarsely crushed into pieces of 12 mm. Next, water was mixed with kiwi fruit pieces at 10:1, and extracting at 85 + -5 deg.c for 90 min to form a mixed solution containing solids. Here, brix (Brix) of the mixed solution at 20 ℃ was measured to confirm whether it reached 0.6±0.5 of a predetermined specification.

Next, the mixed solution containing solids was filtered with a 400 mesh sieve to remove fine solids from the mixed solution. Concentrating the filtered mixed solution with a concentrator (brand/model: BUCHI-Rotavapor R-100) at 60deg.C+ -5deg.C with vapor of 1+ -0.2 kg/cm ² under reduced pressure until the Brix value (Degrees Brix) of the solution is 2.5+ -0.5, to obtain liquid Rubus corchorifolius extract.

Example 2: anti-aging Gene test

Here, the anti-aging gene detected was SIRT1 (GeneID: 23411) gene. The medium used was Eagle's minimal essential medium (hereinafter referred to as MEM medium) containing 10vol% of fetal bovine serum albumin (fetal bovine serum, FBS; brand: gibco), 1mM sodium pyruvate (90; brand: gibco), 0.1mM Non-essential amino acid (Non-ESSENTIAL AMINO ACIDS; brand: gibco) and 1.5g/L sodium bicarbonate (sodium bicarbonate; brand: gibco). The cell line used was human skin fibroblasts (CCD-966 Sk cell, brand: CRL-1881), hereinafter referred to as CCD-966Sk cells.

CCD-996SK cells were seeded in a number of 1X 10 ⁵ cells per well in 6-well plates containing 2 ml MEM medium per well and incubated at 37℃for 24 hours and divided into experimental and control groups. Next, MEM medium was replaced with the experimental medium and cultured for 48 hours. Wherein the experimental medium of the experimental group is MEM medium containing 0.125% of the kiwi berry extract prepared in example 1. The experimental medium of the control group was pure MEM medium (i.e., MEM medium without the kiwi extract).

Next, RNA from the CCD-996SK cells cultured in each group of experimental media was extracted with an RNA extraction kit (RNA extraction kit; brand Genemark). 1000 nanograms (ng) of each extracted RNA were used as templates, and cDNA synthesis reagents (purchased from Geneaid Corp., taiwan, china) andIII reverse transcriptase translates each set of RNAs into cDNAs. Next, quantitative Real-time reverse transcription polymerase chain reaction (quantitative Real-TIME REVERSE transcription polymerase chain reaction) was performed using KAPA CYBR FAST qPCR sets (KAPA Biosystems) and ABI Step One Plus Real-time PCR system instrument (ABI StepOnePlus ^TM Real-TIME PCR SYSTEM) in combination with SIRT1-F (SEQ ID NO: 1) primer and SIRT1-R (SEQ ID NO: 2) primer (shown in Table 1) to quantitatively analyze the target gene, and the analysis results are shown in FIG. 1. Wherein, the instrument for quantitative real-time reverse transcription polymerase chain reaction is set under the conditions of 95 ℃ for 23 seconds and 60 ℃ for 30 seconds, and the total time is 40 cycles; the cDNA PCR size of the FBN1 gene was 166bp. It should be noted that the gene expression in fig. 1 is presented as a percentage, wherein standard deviation was calculated using the STDEV formula of Excel software, and statistically significant differences between groups were statistically analyzed by student t-test. In fig. 1, "p" is a p value obtained in comparison with the control group.

TABLE 1

Sequence numbering	Sequence name	Sequence (5 '. Fwdarw.3')	Length of
				SEQ ID NO:1	SIRT1-F	TAGCCTTGTCAGATAAGGAAGGA	23
SEQ ID NO:2	SIRT1-R	ACAGCTTCTTCACAGTCAACTTTGT	25

Please refer to fig. 1. The expression level of SIRT1 gene in the control group was regarded as 100%, and the expression level of SIRT1 gene in CCD-996SK cells not treated with the kiwi extract was regarded as 100%. Accordingly, the expression level of the SIRT1 gene in the experimental group was 126%. In other words, the SIRT1 gene in CCD-996SK cells treated with the kiwi extract was elevated approximately 1.3-fold.

Therefore, the kiwi berry extract has the effect of improving the expression quantity of the SIRT1 gene. In other words, taking the kiwi berry extract can be used for improving the expression quantity of SIRT1 genes in a receptor body, so that SIRT1 proteins are generated, and the SIRT1 proteins have deacetylation capability and participate in multiple physiological regulation in the receptor body, such as gene expression, metabolism and aging, so that the DNA damage, protein inactivation and inflammatory reaction of skin can be reduced, and the cell aging can be delayed.

Example 3: reactive oxygen species test

Here, the medium used was Eagle's minimal medium (hereinafter referred to as MEM medium) containing 10vol% of fetal bovine serum albumin (fetal bovine serum, FBS; brand: gibco), 1mM sodium pyruvate (90; brand: gibco), 0.1mM of Non-essential amino acids (Non-ESSENTIAL AMINO ACIDS; brand: gibco), 1% of penicillin-streptomycin (brand: gibco; cat. 15140122), and 1.5g/L of sodium bicarbonate (sodium bicarbonate; brand: gibco). The cell line used was human skin fibroblasts (CCD-966 Sk cell, brand: CRL-1881), hereinafter referred to as CCD-966Sk cells. The DCFH-DA solution used was a reaction solution prepared by dissolving dichlorofluorescein diacetate (2, 7-dichloro-dihydro-fluorescein diacetate, DCFH-DA; product No. SI-D6883, from Sigma) in dimethyl sulfoxide (dimethyl sulfoxide, DMSO, from Sigma, product No. SI-D6883-50 MG).

CCD-996SK cells were seeded in 6-well plates containing 2ml MEM medium per well in an amount of 2X 10 ⁵ cells per well and incubated at 37℃for 24 hours, and divided into experimental, control and blank groups. After the CCD-996SK cells were confirmed to be attached to the bottom of the culture medium plate, the MEM medium was replaced as an experimental medium, and the reaction was carried out for 1 hour. Wherein, the experimental culture medium of the blank group is a simple cell culture medium. The experimental medium of the control group was MEM medium containing 1mM hydrogen peroxide. The experimental medium of the experimental group was MEM medium containing 1mM hydrogen peroxide and 0.125% of the kiwi extract prepared in example 1.

Next, 1. Mu.L of 5. Mu.g/mL DCFH-DA solution was added to each group and the cells were treated at 37℃for 15 minutes in each well of the experimental medium. And after the DCFH-DA solution was reacted, 10. Mu.L of 100mM hydrogen peroxide (purchased from Sigma) was added to each group of the experimental medium, and reacted at 37℃for 1 hour.

Next, after removing each set of experimental media, each set of CCD-996SK cells was rinsed 2 times with 1mL/well of 1 XDPBS solution. Then, 200. Mu.L/well trypsin was added to each well and reacted for 5 minutes in the dark. After the reaction, 1mL of cell culture medium was added to each well to terminate the reaction. The CCD-996SK cells and cell culture medium in each well were collected into respective corresponding 1.5mL microcentrifuge tubes, and the microcentrifuge tubes containing the CCD-996SK cells and cell culture medium were centrifuged at 400 Xg for 10 minutes. After centrifugation, the supernatants in each set of microcentrifuge tubes were removed, and the pellet of CCD-996SK cells was redissolved with 1 XDPBS solution and centrifuged at 400 Xg for 10 minutes. After centrifugation, the supernatant in each set of microcentrifuge tubes was removed again, and CCD-996SK cells were resuspended in the dark with 1mL of 1 XPBS solution per centrifuge tube to give each set of test cell fluids.

The fluorescence signal of DCFH-DA in each group of test cell fluids was detected using a Flow cytometer (Flow cytometry; manufacturer: beckman; catalogNo. 660519). The excitation wavelength of the fluorescence detection is 450nm-490nm and the emission wavelength is 510nm-550nm. Since DCFH-DA enters CCD-996SK cells and is hydrolyzed into DCFH (dichlorofluorescein) firstly, and then is oxidized into DCF (dichlorofluorescein) capable of emitting green fluorescence by Reactive Oxygen Species (ROS), the fluorescence intensity of the CCD-996SK cells treated by DCFH-DA can reflect the content of Reactive Oxygen Species (ROS) in the CCD-996SK cells, and the proportion of the number of cells highly expressed by the Reactive Oxygen Species (ROS) in the CCD-996SK cells to the number of primary cells can be known. Since the experiment was performed in triplicate, the measurement results of the triplicate experiments were averaged to obtain an average value, and then, in the case where the control group was 100%, the ratio of each group to the control group was calculated and presented as a percentage value, as shown in fig. 2. Where "# #" is the p value compared to the blank group and "×" is the p value compared to the control group.

Please refer to fig. 2. The cells of the blank group are not treated by hydrogen peroxide, and the standardized generation amount of the relative ROS is 12.50%, which represents the background value of the generation amount of ROS when not treated by hydrogen peroxide. After being treated by hydrogen peroxide, the control group has a standardized generation amount of 100.00% relative to ROS, and shows that the hydrogen peroxide treatment can indeed cause ROS to be generated in cells, so that subsequent damage to CCD-996SK cells is generated. After the experimental group is treated by hydrogen peroxide, the standardized generation amount of relative ROS is 87.50 percent, but is reduced by 12.5 percent relative to the control group; the result shows that the kiwi berry extract in the cell culture medium can effectively reduce the generation or accumulation of Reactive Oxygen Species (ROS) in cells, so that the CCD-996SK cells are better assisted to resist the cell oxidation pressure caused by hydrogen peroxide, and the result represents that the kiwi berry extract has the capabilities of effectively reducing the generation or accumulation of Reactive Oxygen Species (ROS) in cells, helping the cells resist ROS injury, resisting oxidization and resisting ageing. In other words, the kiwi extract can act as an active oxygen scavenger. That is, the kiwi extract can reduce oxidative damage to cells caused by Reactive Oxygen Species (ROS) by reducing the ROS content in the cells.

Therefore, when the receptor takes the kiwi berry extract, the skin inflammation aging phenomenon caused by ROS can be slowed down, and the inflammation vicious circle is avoided.

Example 4: cellular DNA structural damage assay

In this experiment, hydrogen peroxide (H ₂O₂) was used to induce DSBs to phosphorylate Histone H2AX, and this type of phosphorylation was called Gamma-H2AX (Ser 139) (Gamma H2 AX) as one of the indicators of DNA double-strand breaks (DNA double-strand breaks, DSBs) and could represent cell DNA structural damage. Further, the Enzyme-linked immunosorbent assay (Enzyme-linked immunosorbent assay, ELISA) was used.

The medium used was Eagle's minimal basal medium (hereinafter referred to as MEM medium) containing 10vol% of fetal bovine serum albumin (fetal bovine serum, FBS; brand: gibco), 1mM sodium pyruvate (90%; brand: gibco), 0.1mM Non-essential amino acid (Non-ESSENTIAL AMINO ACIDS; brand: gibco), 1% penicillin-streptomycin (brand: gibco; cat.15140122) and 1.5g/L sodium bicarbonate (sodium bicarbonate; brand: gibco). The cell line used was human skin fibroblasts (CCD-966 Sk cell, brand: CRL-1881), hereinafter referred to as CCD-966Sk cells.

The kit used: phospho-gamma H2A.X (S139) ELISA kit (ex Abcam, cat. Ab27986) was placed on ice at room temperature before the start of the test. The kit contains a standard used in the following experiments and a reagent such as a 1X cleaning solution.

Pretreatment of experiment: CCD-996SK cells were seeded in a 6-well culture dish containing 2 ml MEM medium per well in an amount of 2X 10 ⁵ cells per well, and cultured at 37℃for 24 hours, and were divided into an experimental group, a control group and a blank group. After the CCD-996SK cells were confirmed to be attached to the bottom of the culture medium plate, the MEM medium was replaced as an experimental medium, and the reaction was carried out for 1 hour. Wherein the experimental culture medium of the blank group and the control group is a simple cell culture medium, and the experimental culture medium of the experimental group is a MEM culture medium containing 0.0625% of the kiwi berry extract prepared in example 1. After 1 hour of reaction, 2mM hydrogen peroxide was added to the experimental medium of the control group and the experimental group to react for 1 hour.

Next, after removal of each set of experimental media, each set of CCD-996SK cells was rinsed with 1X PBS solution. Then, the CCD-996SK cells were trypsinized off the culture dish and collected into each group of 1.5mL microcentrifuge tubes individually corresponding thereto, and the microcentrifuge tubes containing the CCD-996SK cells and the cell culture medium were centrifuged at 400 Xg for 10 minutes. After centrifugation, the supernatants in each set of microcentrifuge tubes were removed, and the pellet of CCD-996SK cells was redissolved in 1 XPBS and centrifuged at 300 Xg for 10 minutes. After centrifugation again the supernatants in each set of microcentrifuge tubes were removed and the cells were lysed with 120 μl lysis buffer. Next, each of the cell lysis-treated supernatants was centrifuged at 13,000Xg for 30 minutes in a microcentrifuge at 4℃and then the centrifuged supernatant was collected in a 1.5mL microcentrifuge tube to be used as a sample to be tested for each group.

Protein concentration was confirmed for each tube after protein quantification of each set of samples tested, and Phospho-gamma h2a.x (S139) assay was performed using a Phospho-gamma h2a.x (S139) ELISA kit.

Phospho-gamma H2A.X (S139) content detection procedure: 100 μl of standard in each corresponding dilution set was added to each corresponding 7-well 96-well plate. 100 μl of each set of properly diluted samples to be tested was added to the corresponding 96-well plate, and after 100 μl of the prepared Phospho-gamma H2A.X (S139) antibody was added, the 96 Kong Panfeng membrane was used. Next, the 96-well plate after the sealing was allowed to stand in a CO ₂ incubator at 37℃for 1 hour. After the reaction was completed, the supernatant in each well of each group was removed and washed 4 times with 1X washing solution in the kit, and 100ul of prepared HRP-conjugated anti-rabit IgG antibody was added. The 96-well plate was again sealed and placed in a CO ₂ incubator at 37℃for 1 hour. Next, each set of supernatants was removed and washed 4 times with 1 Xwash solution, followed by addition of TMB One-step Medium reagent (TMB One-Step Substrate Reagent) and left at room temperature for 30 minutes in the dark. Finally, after washing again 4 times with 1X washing solution, 50ul of stop solution was added to each set of wells, and the absorbance at OD450nm was immediately read on ELISA instrument. And, the absorbance value of each experimental group is calculated to subtract the background value of the average zero (blank) light, so as to obtain the final average absorbance value of each group (3 repeated numbers). Here, "# #" in fig. 3 is a p value compared to the blank group, and "×" is a p value compared to the control group.

Please refer to fig. 3. The cells of the blank group are not treated by hydrogen peroxide, the cell DNA structure of the blank group is not damaged by ROS, and the relative content of phosphoric acid-H2 AX (phosphorus-H2 AX) is taken as a reference standard of 100 percent. After being treated by hydrogen peroxide, the cell DNA structure of the control group is damaged by ROS, so that the content of the control group relative to phosphoric acid-H2 AX (phospho-H2 AX) is 161.64%; it shows that hydrogen peroxide treatment does lead to damage of the DNA structure. The content of phosphoric acid-H2 AX (phospho-H2 AX) in the experimental group after being treated by hydrogen peroxide and the kiwi berry extract is 103.72 percent, but the content is reduced by 57.92 percent (the reduction amplitude is about 36 percent) compared with the control group; this represents that the kiwi extract in the cell culture medium is effective in reducing the production or accumulation of Reactive Oxygen Species (ROS) within the cell, thereby avoiding or reducing damage to the cellular DNA structure.

Example 5: human body test

To further confirm the effect of the kiwi berry extract on the human body. Each bottle of the 50mL kiwi berry drink containing 2g of the liquid kiwi berry extract prepared in example 1 and 48 g of water was provided to 12 subjects, and each person took one bottle of the kiwi berry drink on a daily empty stomach for 4 weeks. Wherein 12 subjects are healthy adults over 20 years of age who want to improve skin condition.

The blood collection and analysis and skin quality detection of the subjects will be performed before taking the kiwi fruit drink containing the kiwi fruit extract (considered as week 0) and after taking the kiwi fruit drink containing the kiwi fruit extract for 4 weeks (considered as week 4), respectively. Wherein, the blood test items include expression of anti-aging gene (SIRT 1 gene) and DNA repair gene (OGG 1 gene) in blood. The skin detection items comprise skin elasticity detection probesMPA580 (C+K Multi Probe ADAPTER SYSTEM, germany)) performs skin elasticity testing, and facial skin photography with the RBX polarized light technique of VISIA Complexion ANALYSIS SYSTEM (CANFIELD SCIENTIFIC, USA) detects skin redness.

It should be noted that the statistically significant difference between the measurement results at week 0 and week 4 was statistically analyzed by student t-test. Where "/" is the p value compared to week 0.

Example 5-1: analysis of expression of anti-aging genes and DNA repair genes in blood

Here, the anti-aging-related Gene detected was the SIRT1 Gene (Gene ID: 23411) and the OGG1 Gene (Gene ID: 4968).

First, the collected venous blood was centrifuged at 300 Xg for 15 minutes. From the centrifuged venous blood, 2mL of buffy coat (white blood cell layer) was taken, and the white blood cell layer was diluted to 4mL with 2mL of phosphate buffer (1 XPBS; hereinafter referred to as 1 XPBS buffer), and then slowly added to a centrifuge tube containing 3mL of cell separation liquid (Ficoll-Paque Plus cell separation liquid) in which the diluted white blood cell layer and the cell separation liquid had to be in a layered state during the addition, and could not be mixed. Next, a centrifuge tube containing the layered diluted leukocyte layer and the cell separation liquid was centrifuged at 400 Xg for 40 minutes, and after centrifugation, the supernatant was removed, and 2mL to 3mL of peripheral blood mononuclear cells (PERIPHERAL BLOOD MONONUCLEAR CELL, PBMC; hereinafter referred to as PBMC) in the intermediate layer in the centrifuge tube after centrifugation was taken. PBMCs were rinsed with 3 volumes of 1X PBS buffer and then mixed well with the aforementioned 1X PBS buffer to form PBMC mix. The PBMC mixture was then centrifuged at 300×g for 10min to form PBMC supernatant and PBMC pellet, and the PBMC pellet was taken for RNA extraction after lysis with 600 μ LRNA lysis buffer. Next, after reverse transcription of the extracted RNA into cDNA as in example 2, quantitative real-time reverse transcription polymerase chain reaction was performed on cDNA using the two sets of primers (SEQ ID NO:1 and SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO: 4) shown in Table 2, respectively, to observe the expression levels of SIRT1 gene and OGG1 gene in blood at week 0 and week 4, as shown in FIG. 4.

TABLE 2

In Table 2, F is the Forward primer and R is the reverse primer (REVERSE PRIMER).

It should be noted that the gene performances in fig. 4 and 5 are presented at relative magnification, wherein standard deviation was calculated using the STDEV formula of Excel software, and statistically significant differences between groups were statistically analyzed by student t-test. In fig. 4, "×" represents that the p-value is less than 0.05 when compared to week 0.

Please refer to fig. 4. When the relative gene expression rate of the SIRT1 gene was 1.02 in 12 subjects at week 0, the relative gene expression rate of the SIRT1 gene was 2.50 (2.5 fold improvement) at week 4. As a result, when the subject took the kiwi berry extract containing 2g daily for 4 weeks, the expression level of the SIRT1 gene in the blood of the subject increased, representing an increase in the expression level of the protein encoded by the SIRT1 gene. The SIRT1 gene is used as a downstream gene of NAD ⁺ and is related to the activity of the granulosa, and when the SIRT1 gene in blood is increased, the content of NAD ⁺ in the blood is increased, so that the anti-aging function is achieved. In other words, increasing the expression level of SIRT1 gene in blood by taking the Rubus parvifolius extract can represent that the Rubus parvifolius extract has anti-aging potential.

Please refer to fig. 5. When the relative gene expression magnification of the OGG1 gene was 1.07 for 12 subjects at week 0, the relative gene expression magnification of the OGG1 gene was 2.84 (2.84 fold improvement) at week 4. As a result, when the subject took the kiwi berry extract containing 2g daily for 4 weeks, the expression level of OGG1 gene in the blood of the subject was increased, OGG1 gene was secreted by 8-Oxoguanine DNA Glycosylase, and damaged DNA was excised and DNA repair was assisted.

Example 5-2: skin condition analysis

Skin detection principle:

Skin elasticity and sagging: the testing principle is based on the suction and stretching principle, negative pressure is generated on the surface of the tested skin to suck the skin into a testing probe, the depth of the skin sucked into the probe is detected through an optical testing system, and the elasticity and the looseness of the skin are analyzed and calculated through software.

Skin redness: and (3) shooting the facial skin by using an RBX polarization light technology, and detecting deep blood vessels or heme of the skin. The higher the measured value, the more severe the Pi Fufan red condition.

Please refer to fig. 6. The average skin relaxation-R0 parameter (%) percentage detected by the skin elasticity detection probe before taking the kiwi berry extract (week 0) was taken as 100%. After a sustained administration for 4 weeks, the average percentage of skin relaxation was reduced to 86.7%. In other words, the sustained consumption of the kiwi drink containing 2g of kiwi extract for 4 weeks resulted in a 13.3% decrease in the percentage of skin relaxation in these subjects compared to prior to the consumption of the kiwi extract (week 0). Thus, it is known that the skin relaxation of the subject can be reduced by taking the kiwi berry extract for a long period of time, and the skin condition of the subject can be improved, so that the skin is compact and elastic.

Please refer to fig. 7. The average skin elasticity-R2 parameter (%) percentage detected by the skin elasticity detection probe before 12 subjects took the kiwi berry extract (week 0) was regarded as 100%. The average percent skin elasticity of the subjects increased to 117.1% after 4 weeks of continued administration. In other words, the continuous drinking of the kiwi drink containing 2g of kiwi extract for 4 weeks resulted in a 17.1% improvement in the skin elasticity percentage of these subjects compared to before the kiwi extract was taken (week 0). Therefore, the skin elasticity can be improved and the skin can be compacted after long-term administration of the kiwi berry extract.

Please refer to fig. 8. The average percentage of myoglobin (%) detected by a VISIA high-order digital skin detector before taking the kiwi extract (week 0) was taken as 100%. After a sustained administration for 4 weeks, the average percentage of skin redness was reduced to 88.7%. In other words, the sustained consumption of the kiwi drink containing 2g of kiwi extract for 4 weeks reduced the percentage of skin redness in these subjects by 11.3% compared to before the kiwi extract was taken (week 0). Thus, the skin redness can be relieved after long-term administration of the kiwi berry extract.

Please refer to fig. 9. One of the subjects was photographed with a visual high-order digital skin detector for skin redness, and it was seen that the skin redness was reduced after the subject was continuously administered the kiwi extract for 4 weeks.

In summary, the raspberry extract according to any of the embodiments of the present invention is used to prepare a composition for preventing skin aging, wherein the raspberry extract is obtained by extracting raspberry fruits with water, and in some embodiments, the raspberry extract has the effects of reducing skin damage, reducing structural damage of DNA, reducing skin relaxation, improving skin elasticity, relieving skin redness, and the like.

Of course, the present invention is capable of other various embodiments and its several details are capable of modification and variation in light of the present invention by one skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. The use of a kiwi berry extract for preparing a skin aging resistant composition, wherein the kiwi berry extract is obtained by extracting kiwi berries (ACTINIDIA ARGUTA) with water.

2. The use of claim 1, wherein the anti-skin aging is reduction of skin damage, reduction of structural damage to DNA, or a combination thereof.

3. The use of claim 2, wherein the kiwi extract is effective to reduce the skin damage by reducing Reactive Oxygen Species (ROS).

4. The use of claim 2, wherein the kiwi extract is used to reduce structural damage to the DNA by increasing the expression levels of the NAD-dependent deacetylase (Sirtuin-1, sirt 1) gene and/or the 8-hydroxyguanine glycosylase (OGG 1) gene.

5. The use of claim 1, wherein the anti-skin aging is reduction of skin laxity.

6. The use of claim 1, wherein the anti-skin aging is to improve skin elasticity.

7. The use of claim 1, wherein the anti-skin aging is soothing skin redness.

8. The use of claim 1, wherein the kiwi extract is obtained by leaching the kiwi in the water at 70 ℃ to 90 ℃ for 90 minutes to 120 minutes.

9. The use of claim 1, wherein the kiwi extract is obtained by leaching the kiwi in water at 70 ℃ to 90 ℃ until the mixed solution meets a predetermined specification, and the predetermined specification is that the Brix of the mixed solution at 20 ℃ is 0.6±0.5.

10. The use of claim 8 or 9, wherein the weight ratio of the kiwi berry to the water is 1-5:5-10.

11. The use of claim 8 or 9, wherein the effective dose of the composition in liquid is 2 g/day and the effective dose of the composition in solid is 0.2 g/day.