CN118127045A - Fungal laccase over-expression gene, over-expression strain and expression method - Google Patents

Abstract

The application discloses a fungal laccase over-expression gene, an over-expression strain and an expression method. In one aspect, the application provides a fungal laccase over-expressed gene ThbZIP, wherein the nucleotide sequence of the fungal laccase over-expressed gene ThbZIP is shown in SEQ ID No: 1. On the other hand, the application provides an over-expression strain of the fungal laccase, wherein the over-expression strain of the fungal laccase is obtained after the fungal gene ThbZIP is over-expressed in the trametes AH 28-2; the fungal laccase over-expressed strain is named Trametes hirsutaAH-2 (ThbZIP-OE-13), and the preservation unit is: china center for type culture Collection, address: chinese, wuhan, university of Wuhan, date of preservation: 2023 12 months 12 days, deposit number: cctccc M20232545. The application constructs the over-expression strain by screening the transcription factors for regulating and controlling laccase expression, and can effectively improve laccase yield under the condition of no induction.

Description

Fungal laccase over-expression gene, over-expression strain and expression method

Technical Field

The application relates to the technical field of microorganisms, in particular to a fungal laccase over-expressed gene, an over-expressed strain and an expression method.

Background

Laccase (benzene diol: oxygen oxidoreductase, EC 1.10.3.2) is a class of copper-containing polyphenol oxidase widely distributed in higher filamentous fungi, especially basidiomycetes, capable of catalyzing the oxidation of hydroxyl functions in various substrates and reducing molecular oxygen to water. In recent years, with the call and pursuit of sustainable and environment-friendly catalysis by society, the broad substrate specificity of fungal laccase and the catalytic advantages of H ₂ O and the like by taking O ₂ as an electron acceptor byproduct are gradually reflected, and the research on fungal laccase is also widely focused by scientific researchers in various countries. Fungal laccase enzymes have now demonstrated great potential applications in various industries, such as: pulp, paper, food, textile, biofuel, bioremediation, biosensors, novel pharmaceutical synthesis, cosmetics, etc.

However, wild-type fungi have lower secretion of laccase and weaker extracellular laccase activity. To increase laccase yield, fungal laccase heterologous expression is typically selected. At present, the prior art has reported that the fungal laccase gene successfully realizes recombinant expression, but the heterologous expression has the defects of low yield, long fermentation period, high cost and the like, and is difficult to meet the industrial requirement.

Fungal laccase-induced expression is another important approach to increase fungal laccase production, and it is currently widely accepted that the mechanism of laccase-induced activation is achieved by cis-acting element interactions of transcription factors and promoter regions. In the prior art, a plurality of Chinese patent inventions applied by Anhui university use the wild strain trametes AH28-2, and construct an over-expression strain by regulating and controlling the transcription factor expressed by laccase, thereby realizing the improvement of laccase yield. However, in the prior art, the obtained strain can realize high yield of laccase only by the induction of trace aromatic compounds, and the aromatic compounds such as o-toluidine and the like used in the strain have toxicity, so that the industrial application has pollution and potential safety hazard.

Disclosure of Invention

In order to solve at least one of the technical problems, an over-expression strain is constructed by screening transcription factors for regulating and controlling laccase expression, and the laccase-producing strain can effectively improve laccase yield under the condition of no induction.

In one aspect, the application provides a fungal laccase over-expressed gene ThbZIP, wherein the nucleotide sequence of the fungal laccase over-expressed gene ThbZIP is shown in SEQ ID No: 1.

In a second aspect, the application provides a fungal laccase over-expression plasmid, comprising the fungal laccase over-expression gene ThbZIP, wherein the fungal laccase over-expression plasmid comprises a linearized recombinant pYSK plasmid subjected to enzyme digestion, and a linked L22-ThbZIP-L24 sequence; the recombinant pYSK plasmid adopts a pYSK plasmid with a recombined promoter, and the nucleotide sequence of the promoter of the recombinant pYSK plasmid is shown as SEQ ID No:2 is shown in the figure; the L22-ThbZIP-L24 sequence is a fungal laccase over-expressed gene ThbZIP with two sides respectively connected with the L22 sequence and the L24 sequence, and the nucleotide sequence of the L22 sequence is shown in SEQ ID No:3, the nucleotide sequence of the L24 sequence is shown as SEQ ID No: 4.

In a third aspect, the application provides a method for preparing the fungal laccase over-expression plasmid, which comprises the following steps:

sa, carrying out enzyme digestion on the fungal laccase over-expressed gene ThbZIP and pet-22b empty vector according to claim 1, and then connecting by using DNA ligase to obtain a connecting vector;

Sb, converting the connecting vector obtained in the step Sa into E.coli DH5 alpha competent cells, culturing and screening to obtain positive clones, and obtaining pet-22b-ThbZIP recombinant plasmids;

Sc and pet-22b-ThbZIP recombinant plasmid obtained in the step Sb are used as templates, L22-ThbZIP-F and L24-ThbZIP-R are used as upstream and downstream primers, and a target sequence is amplified; purifying the amplified target sequence, using the purified product as a template, and using the L22 sequence and the L24 sequence as an upstream primer and a downstream primer to amplify to obtain an L22-ThbZIP-L24 sequence; the nucleotide sequences of the L22-ThbZIP-F and L24-ThbZIP-R primers are respectively shown in SEQ ID No:5 and SEQ ID No:6 is shown in the figure;

Sd, carrying out enzyme digestion on the recombinant pYSK plasmid to obtain a linearized pYSK plasmid, and connecting the L22-ThbZIP-L24 sequence obtained in the step Sc with the linearized pYSK plasmid by using a Saccharomyces cerevisiae homologous recombination method to obtain the fungal laccase over-expression plasmid.

Optionally, in step S3, the purification is performed by agarose gel purification.

Optionally, in the step S4, the specific preparation steps of the linearized pYSK a plasmid are as follows: after the recombinant pYSK plasmid is subjected to enzyme digestion, the enzyme digestion product is incubated for 1h at 37 ℃, and then agarose gel purification is carried out, so that the linearized pYSK plasmid is obtained.

In a fourth aspect, the application provides an over-expression strain of a fungal laccase, which is obtained after over-expression of a fungal gene ThbZIP in Trametes sp.AH28-2; the fungal laccase over-expression strain is named Trametes hirsuta AH-2 (ThbZIP-OE-13); preservation unit: china center for type culture Collection; address: chinese university of Wuhan; preservation date: 2023, 12 months 12; preservation number: cctccc M20232545.

In a fifth aspect, the application provides a method for preparing an overexpression strain of the fungal laccase, comprising the following steps: preparing protoplast by using laccase-producing wild strain T.hirsutaAH28-2; then the fungus laccase over-expression plasmid is transformed into protoplast of laccase-producing wild strain T.hirsutaAH28-2; regenerating, prescreening and rescreening the transformed protoplast to obtain an over-expressed strain of the fungal laccase.

Optionally, the fungal laccase over-expressed plasmid is transformed into protoplast of laccase-producing wild strain T.hirsuta AH28-2 by using PEG/CaCl ₂ method.

In a sixth aspect, the application provides an over-expressed strain of the fungal laccase as described above, and its use in the field of laccase production.

Optionally, the specific method for producing laccase comprises the following steps:

S1, activating an overexpression strain of the fungus laccase to obtain activated thalli;

S2, inoculating the activated thalli obtained in the step S1 into a liquid culture medium containing cellobiose and asparagine, fermenting for 120-160 hours by a shaking table, centrifuging a fermentation liquid, and removing thalli to obtain a fermentation supernatant;

and S3, purifying the fermentation supernatant obtained in the step S2 to obtain laccase.

In summary, the present invention includes at least one of the following beneficial technical effects:

1. According to the application, through screening, the fungal laccase over-expressed gene ThbZIP is selected, and through regulating over-expression of the above genes by using the trametes AH28-2, the obtained strain can stably pass through to over-express the above genes, and the laccase yield of the obtained strain can be obviously improved under the condition of no induction of any substances.

2. According to the application, the L22 sequence and the L24 sequence are connected at two sides of the fungal laccase over-expressed gene ThbZIP and then connected with the linearized pYSK plasmid, so that the fungal laccase over-expressed plasmid is constructed, the fungal laccase over-expressed gene ThbZIP can be conveniently transformed into the trametes AH28-2, the strain for over-expressing the genes is constructed, the transformation operation is convenient, and the repeatability is good.

3. The application selects a wild strain Trametes sp.AH28-2 strain with high laccase yield as a basic strain, constructs an over-expression strain of the fungal laccase over-expressing the fungal gene ThbZIP, which is named Trametes hirsuta AH-2 (ThbZIP-OE-13), and the constructed novel strain not only can stably passage over-express the genes, but also can improve the laccase yield by more than 1.5 times under the condition of no induction substances compared with the basic Trametes sp.AH28-2 strain, and has excellent yield.

Drawings

FIG. 1 is an electrophoretogram of the amplification ThbZIP sequence of example 1 of the present application;

FIG. 2 is a graph showing the change in transcript levels of laccase gene lacA in ThbZIP over-expressed strains;

FIG. 3 is a graph showing changes in transcription level of ThbZIP gene in ThbZIP overexpressing strains;

FIG. 4 is a graph showing the total laccase activity change of the over-expressed strain and the wild strain;

FIG. 5 is a graph showing the isozymogram changes of the over-expressed strain and the wild-type strain.

Detailed Description

The application is described in further detail below with reference to the drawings and examples.

The application provides a fungal laccase over-expressed gene ThbZIP, wherein the nucleotide sequence of the fungal laccase over-expressed gene ThbZIP is shown as SEQ ID No: 1.

The fungus gene ThbZIP is obtained through screening, can be obtained from the trametes AH28-2, allows the trametes AH28-2 to overexpress the gene, and can remarkably improve laccase yield.

The application also provides an over-expression strain of the fungal laccase, which is obtained after the fungal gene ThbZIP of the application is over-expressed in Trametes sp.AH28-2; the fungal laccase over-expression strain is named Trametes hirsuta AH-2 (ThbZIP-OE-13); preservation unit: china center for type culture Collection; address: chinese university of Wuhan; preservation date: 2023, 12 months 12; preservation number: cctccc M20232545.

The Trametes sp.AH28-2 used in the application is a wild laccase high-yield strain. Trametes sp.AH28-2 accession number: china center for type culture Collection; address: chinese university of Wuhan; preservation date: 11/22/2005; preservation number: cctccc NO: m205134.

The following are examples of the application

The primer sequences used in the application are all prepared from a trusted third party biological enterprise, and are all independently designed by the inventor.

Example 1

Preparation of fungal laccase over-expressed gene ThbZIP

The preparation of the full-length sequence of the fungal laccase over-expressed gene ThbZIP in the embodiment adopts the following steps:

step 1), selecting T.hirsuta AH28-2 strain, extracting total RNA, and performing reverse transcription to obtain cDNA;

Step 2), PCR is carried out by taking the cDNA obtained in the step 1) as a template to obtain a ThbZIP full-length sequence; the amplification primers are shown in table 1, and the PCR amplification system is shown in table 2; the PCR amplification conditions are as follows: pre-denaturation at 94 ℃ for 30s, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 10s, extension at 72 ℃ for 90s, 30 cycles total, and extension at 72 ℃ for 10min finally;

TABLE 1 primer sequences

Primer name	Sequence (5 '-3')
		ThbZIP-F	ATGTCCTCATCCTTGCCGCCGT
ThbZIP-R	TTAGATGGTGTCGAAGGGGGGAG

TABLE 2PCR reaction System

Component name	Addition amount of
		T.hirsutaAH28-2cDNA	3μL
2×ApexHFFLPCRMasterMix	20μL
		ThbZIP-F	1.5μL
ThbZIP-R	1.5μL
		ddH2O	Supplement to 40. Mu.L

Step 3) detecting the amplified product obtained in the step 2) by using 1% agarose gel and recovering the target fragment, wherein the detection result of electrophoresis is shown in figure 1.

Sequencing the recovered target sequence fragment, and identifying that the sequence of the target fragment is consistent with the sequence of the fungal laccase over-expressed gene ThbZIP.

The PCR primer is designed by the inventor according to the sequence of the fungal laccase over-expressed gene ThbZIP obtained by screening. The primers used in the examples of the present application are only exemplified, and other primers designed based on the sequence of fungal laccase over-expressed gene ThbZIP of the present application can also achieve the purpose of PCR of the present application by Primer 5 software or other Primer sequence design software.

In addition, the specific PCR system and PCR conditions in the embodiments of the present application may be adjusted as needed when they are specifically implemented.

Example 2

Construction of fungal laccase over-expression plasmid

The recombinant pYSK vector and the pet-22b vector used in the embodiment, as well as the E.coli DH5 alpha competent cells and the Saccharomyces cerevisiae competent cells Y1H, are all obtained commercially, and the used reagents are all obtained by purchasing the experimental materials in a matched manner, and the recombinant pYSK vector is designed and customized according to the application.

The preparation method of the fungal laccase over-expression plasmid comprises the following steps:

Sa, the fungal laccase over-expressed gene ThbZIP obtained in example 1 and the pet-22b empty vector were double digested with BamHI and NotI, respectively, and then ligated using T4 DNA ligase to obtain a ligation vector.

Sb, transforming the connecting vector obtained in the step Sa into E.coli DH5 alpha competent cells, culturing and screening to obtain positive clones, and obtaining the pet-22b-ThbZIP recombinant plasmid.

The method comprises the following specific steps:

1) Taking 100 mu L of frozen E.coli DH5 alpha competent cells, and immediately placing the cells on ice;

2) After the competent cells are melted, rapidly adding 10 mu L of connecting carrier into the competent cells, flicking and uniformly mixing, and placing on ice for 30min to obtain a cell mixed solution;

3) Heating the cell mixture to 42 ℃ and heat-shock for 50s, immediately placing on ice, standing and cooling for 3min;

4) Adding 900 mu L of LB culture medium into the heat-shocked cell mixture, gently mixing, and carrying out shaking table incubation for 1h at 37 ℃ and 200rpm to obtain a cell incubation liquid;

5) Centrifuging the cell incubation liquid for 10s under the condition of 1000g, discarding 600 mu L of supernatant, and uniformly mixing the rest thalli to obtain a bacterial liquid;

6) Uniformly coating 200 mu L of bacterial liquid on an LB solid medium containing 1% amp, and culturing in an incubator at 37 ℃ for 12 hours in an inverted mode;

7) 3 single clones are selected from the thalli obtained by culture, colony PCR verification is carried out, positive clones are cultured in a test tube containing 5mL of LB culture medium, the culture is carried out for 8 hours at 37 ℃, bacterial liquid is preserved in 15% glycerol, and the bacterial liquid is preserved in a refrigerator at the temperature of minus 70 ℃ for standby;

8) And (3) referring to the instruction book of the Axygen plasmid extraction kit, extracting plasmids from the prepared bacterial liquid, sequencing the plasmids by a company, and obtaining the prepared bacterial liquid, extracting the plasmids after sequencing and identifying correctly, thus obtaining the pet-22b-ThbZIP recombinant plasmids.

Sc and pet-22b-ThbZIP recombinant plasmid obtained in the step Sb are used as templates, L22-ThbZIP-F and L24-ThbZIP-R are used as upstream and downstream primers, and a target sequence is amplified by PCR; the specific PCR primers used are shown in Table 3 below, and the PCR system is shown in Table 4 below;

The PCR conditions used were: pre-denaturation at 94 ℃ for 30s, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 10s, extension at 72 ℃ for 90s, 30 cycles total, and extension at 72 ℃ for 10min finally; detecting the product by using 1% agarose gel and recovering the target fragment;

TABLE 3PCR primer sequences

TABLE 4PCR reaction System

Component name	Addition amount of
		Pet-22b-ThbZIP plasmid	2μL
2×ApexHFFLPCRMasterMix	20μL
		L22-ThbZIP-F	1.5μL
L24-ThbZIP-R	1.5μL
		ddH2O	Supplement to 40. Mu.L

Taking the recovered target fragment as a template, and then taking the L22 sequence and the L24 sequence as an upstream primer and a downstream primer, and carrying out PCR amplification to obtain an L22-ThbZIP-L24 sequence; the specific PCR primers used are shown in Table 5 below, and the PCR system is shown in Table 6 below; the PCR conditions used were the same as above.

TABLE 5PCR primer sequences

Primer name	Sequence (5 '-3')
		L22	ACATCCACCATCTCCGTTTTCTCCCATCTACACACAACAAGCTTATCGCC
L24	TGACTATAGCAGCCTCCTACCACTGGCCCTCTGGTCAACTATAATATTAT

TABLE 6PCR reaction System

Component name	Addition amount of
		Recovery of target fragment from gel	5μL
2×ApexHFFLPCRMasterMix	20μL
		L22	1.5μL
L24	1.5μL
		ddH2O	Supplement to 40. Mu.L

Sd, carrying out double digestion on pYSK plasmid by BamHI and HpaI, incubating for 1h at 37 ℃, detecting by 1% agarose gel electrophoresis, and recovering target fragment to obtain linearized pYSK plasmid; the cleavage reaction system is shown in Table 7;

TABLE 7 double cleavage reaction System

And (3) connecting the L22-ThbZIP-L24 sequence with the linearized pYSK plasmid by homologous recombination by using a Saccharomyces cerevisiae competent cell to obtain the fungal laccase over-expression plasmid.

The specific steps of homologous recombination connection are as follows:

1) Taking 100 mu L of ice-thawed Saccharomyces cerevisiae competent cells Y1H, sequentially adding pre-cooled CARRIER DNA mu L (heated at high temperature for 5min before use to denature into single-stranded state), 10 mu L of L22-ThbZIP-L24 mesh fragment and 10 mu g of linearized pYSK7 plasmid; then adding 500 mu L of PEG/LiAc (PEG 3500, TE Buffer, liAc is mixed uniformly according to the proportion of 8:1:1), lightly blowing and uniformly mixing; carrying out water bath reaction at 30 ℃ for 30min (turning over and mixing uniformly every 10 min);

2) Placing the reaction solution into a centrifuge tube, adding 20 mu L of DMSO, and gently mixing; carrying out water bath reaction at 42 ℃ for 15min (turning over and mixing uniformly every 5 min);

3) Centrifuging the reaction solution under 12000g for 10s, discarding the supernatant, placing in 1mL YPDA culture medium to resuspend the thallus, and then culturing for 1h by shaking table incubation at 30 ℃ and 200 rpm;

4) Centrifuging the culture solution under 12000g for 10s, discarding the supernatant, and placing in 1mL of 0.9% NaCl solution to resuspend the thallus;

5) Centrifuging the suspension at 12000g for 10s, removing supernatant, and coating 200 μL of bacterial liquid on SD/-Ura solid culture medium, and culturing in a 30 ℃ incubator for 3 days;

6) Randomly picking 3 yeast monoclonals from SD/-Ura plates, placing the yeast monoclonals in 3mL YPDA culture medium, and performing shake culture for 16h at 30 ℃ and 200 rpm; centrifuging the culture solution under 12000g for 10min, collecting thallus, and storing in a refrigerator at-70deg.C;

7) And referring to TIANGEN company yeast plasmid extraction kit instruction, extracting yeast plasmids, sending company sequencing, obtaining the prepared thalli after sequencing identification is correct, extracting plasmids, and obtaining fungal laccase over-expression plasmids.

The applicant carries out more than 10 repeated experiments on the embodiment, can successfully prepare the fungal laccase over-expression plasmid, and has better repeatability.

Example 3

Construction of overexpression strains of fungal laccase

In this example, the wild laccase high-producing strain Trametes sp.AH28-2 was selected as the base strain.

The preparation method of the overexpression strain of the fungal laccase comprises the following steps:

Step 1) preparation of Traames sp.AH28-2 protoplasts

The method comprises the following specific steps:

1) Taking 10 CPDA plates, respectively culturing T.hirsutaAH28-2 strain, and culturing in an incubator for 7 days at 28 ℃;

2) Adding 10mL of sterile water into each CPDA flat plate on an ultra-clean workbench to soak mycelia, and slightly scraping mycelia on the surface of the flat plate by using a sterile medicine spoon to obtain mycelia suspension;

3) Sucking mycelium suspension by a pipetting gun, filtering mycelium in a spore filter filled with glass wool, transferring the obtained spore suspension into a sterile EP tube, centrifuging for 10min under the condition of 3000g, and discarding the supernatant to obtain mycelium precipitate;

4) Re-suspending mycelium precipitate with 8mL MM buffer solution, centrifuging at 3000g for 10min, and discarding supernatant to obtain thallus;

5) Adding 400 mu L of enzyme solution (containing 0.5% of chitinase and 1.5% of cellulase) into thalli to blow and absorb resuspended cells, incubating for 5 hours at a constant temperature of 37 ℃ and observing the spore enzymolysis degree by using a microscope every 1 hour, and adding 5mL of MMC solution to terminate the enzymolysis reaction when the generation rate of protoplast reaches more than 50%, so as to obtain cell suspension;

6) The cell suspension was centrifuged at 640g for 10min, the supernatant was slowly discarded, and 350. Mu.L of MMC buffer was added to the obtained pellet to prepare Traames sp.AH28-2 protoplast.

The applicant can successfully prepare protoplast by repeating the experiment for more than 10 times. The protoplast prepared by repeating the experiment of the step adopts the FDA method to detect the activity, and the activity can reach more than 70 percent.

Step 2) transformation of fungal laccase over-expression plasmid into protoplast

The method comprises the following specific steps:

1) Pre-cooling sterilized EP tube on ice, and sequentially adding 50 μl protoplast, 12.5 μl PEG solution and 1 μg fungal laccase over-expression plasmid into the EP tube to obtain mixed solution;

2) Placing the mixed solution on ice, standing for 20min, adding 500 μl of PEG solution (for preparation, filtering for sterilization before use), gently mixing, and standing at room temperature for 5min;

3) Adding 1mL of STC buffer solution into the system, uniformly mixing, absorbing 350 mu L of STC buffer solution, coating the STC buffer solution into a culture dish filled with a regenerated solid culture medium, and culturing the mixture in an incubator for 24 hours at the temperature of 28 ℃;

4) 5mL of regeneration medium containing hygromycin (final concentration: 300. Mu.g/mL) was covered on a petri dish, and after 3 days of culture, transformants were grown.

Step 3) Primary and Secondary screening of Positive transformants

The method comprises the following specific steps:

1) Transferring the transformant obtained in the step 2) to a regeneration medium containing hygromycin with a final concentration of 300 mug/mL, screening, observing the growth condition of colonies, and selecting a transformant strain with hygromycin resistance.

2) Transferring the selected transformed strains with hygromycin resistance into a new CPDA culture medium for culture, and performing PCR verification and screening when mycelia grow on a culture dish;

scraping part of mycelium, placing in an EP tube, adding MIGHTY PREP mu L of fungus genome extraction reagent, mixing by vortex, heating at 95 ℃ for 10min, centrifuging for 2min under 12000g, and transferring the supernatant into a new sterile EP tube to obtain genome solution;

Performing PCR amplification by using the L22 sequence and the L24 sequence as an upstream primer and a downstream primer and using a genome solution as a template solution, wherein a PCR reaction system is shown in Table 8; the PCR amplification conditions were: pre-denaturation at 94 ℃ for 30s, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 10s, extension at 72 ℃ for 90s for 30 cycles, and extension at 72 ℃ for 10min, detecting the product by using 1% agarose gel, and observing whether a band of the over-expressed target gene exists;

TABLE 8PCR reaction System

Component name	Addition amount of
		Genome (genome)	3μL
2×ApexHFFLPCRMasterMix	10μL
		L22	1μL
L24	1μL
		ddH2O	Supplement to 20. Mu.L

The transformed strains with the target gene bands are selected, and the strains are strains which are successfully transformed into fungal laccase over-expression plasmids in the T.hirsuta AH28-2 strain.

3) The bacterial strain successfully transformed into the fungal laccase over-expression plasmid is subjected to qRT-PCR rescreening, and the specific operation is as follows:

Fresh hyphae of wild type T.hirsuta AH28-2 strain and strain successfully transformed into fungal laccase over-expression plasmid are taken, total RNA extraction is carried out according to RNAiso Plus reagent (Takara) instruction book, and purity and concentration are measured;

1. Mu.g of total RNA was taken and cDNA was synthesized according to the method of PRIMESCRIPT RT reagent (Takara);

qRT-PCR analysis was performed on the transcript levels of lacA and ThbZIP using specific primer sets on LightCycler96 (Roche) according to SYBR Premix Ex TaqTMII kit (Takara) using cDNA as a template; using glyceraldehyde triphosphate dehydrogenase Gene (GAPDH) as an internal gene, using a 2- ΔΔct method, analyzing the data using LC96SW1.1 software to calculate the relative expression level of each gene; the sequences of specific primer groups are shown in the following table 9, and the qRT-PCR reaction system is shown in the following table 10; the PCR amplification conditions were: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 5s, annealing at 60 ℃ for 20s, 40 cycles total;

TABLE 9 specific primer set sequences

Primer name	Sequence (5 '-3')
		lacA-qF	TCCTTCGTGTTGAATGCCGA
lacA-qR	GTTGATACCGCCCGCAAATC
		ThbZIP-qF	CGTGAGGAACTCGCTGAAG
ThbZIP-qR	AACACCGAGAAGACTGCCT
		GAPDH-qF	GCCGCTTCAAGGGCAAAGTC
GAPDH-qR	TGTAGTCGGCACCAACGGA

TABLE 10qRT-PCR reaction System

Component name	Addition amount of
		T.hirsutaAH28-2cDNA	1μL
2×SYBRPremixExTaqII	10μL
		lacA-qF/ThbZIP-qF	1μL
lacA-qR/ThbZIP-qR	1μL
		ddH2O	7μL
Total	20μL

And screening the strain with the transcription level of the fungal laccase over-expressed gene ThbZIP obviously higher than that of the wild type T.hirsuta AH28-2 to obtain the fungal laccase over-expressed strain.

In this example, a strain with the highest transcription level of fungal laccase over-expressed gene ThbZIP was selected, and the results obtained by detection and analysis are shown in fig. 2 and 3.

As can be seen from FIGS. 2 and 3, the overexpression strain of the fungal laccase finally screened in this example has a 1.4-fold increase in the transcription level of laccase gene lacA and a 4.5-fold increase in the transcription level of ThbZIP gene, compared with the wild-type strain of T.hirsutaAH28-2.

The strain with the highest transcription level prepared in the example is used as the fungus laccase over-expression strain for preservation.

And taking the bacterial strain which is preserved as a basic bacterial strain, subculturing, taking bacterial cells obtained by subculturing, and carrying out qRT-PCR detection again, wherein the same operation steps as the qRT-PCR rescreening of the embodiment are adopted.

The expression level of laccase gene lacA and ThbZIP gene are not obviously different from the basic strain. Therefore, the fungal laccase over-expression strain can stably pass over-expression fungal laccase over-expression genes ThbZIP.

Example 4

Laccase production

The strain Trametes hirsutaAH-2 (ThbZIP-OE-13) of the application was selected in this example.

The preparation method of the culture medium used in this example is as follows:

CPDA solid Medium (1L): 20.0g of glucose, 15.0g of agar powder, 3g of KH ₂PO₄, 1.5g of MgSO ₄·7H₂ O,0.04g of VB1, 20% potato filtrate, deionized water to a volume of 1L, and then sterilizing at 115 ℃ for 30 min.

Cellobiose-asparagine broth (1L): 15.0g cellobiose, 1.5g D-L-asparagine, 1.0g peptone, 1.0g KH ₂PO₄, 0.1g Na ₂HPO₄·12H₂ O,0.028g adenine, 0.01g CaCl ₂, 0.01g FeSO ₄·7H₂ O,0.002g CuSO ₄·5H₂ O, 50.0. Mu.g VB1, deionized water to a volume of 1L, then autoclaved at 115℃for 30 min.

The laccase production of this embodiment comprises the following steps:

Step 1) inoculating the strain Trametes hirsutaAH-2 (ThbZIP-OE-13) to a CPDA culture medium plate for activation, namely taking mycelium blocks with the diameter of 0.5cm on a preservation inclined plane, inoculating to the central position of the CPDA culture medium plate, culturing at the temperature of 28 ℃ in an incubator, and completing activation when the mycelium edges grow to about 1cm from the edge of a culture dish.

Step 2) 6 mycelium blocks with the diameter of 0.5cm are taken on an activated flat plate, inoculated into 100mL of cellobiose-asparagine liquid culture medium (250 mL), subjected to shaking table fermentation at 28 ℃ and 120rpm, monitored for enzyme activity in the fermentation process, and stopped when the enzyme activity reaches the highest (about 144 h).

Step 3) centrifuging the fermentation liquor, removing the supernatant, and then concentrating and purifying by ultrafiltration to obtain laccase.

Detection experiment:

The same laccase production procedure as in this example was followed using the wild-type laccase highly productive Trametes sp.AH28-2 strain as a control.

The Trametes hirsutaAH-2 (ThbZIP-OE-13) strain and the wild-type laccase of the application were tested for their ability to produce laccase with high yield of Traames sp.AH28-2 strain, respectively.

At 7 time points of 0h, 24h, 48h, 72h, 96h, 120h and 144h of the fermentation in the step 2), samples were taken to determine the laccase total enzyme activity and isoenzyme profile.

The test results are shown in fig. 4 and 5.

As can be seen from FIGS. 4 and 5, under the action of no inducing substances, the Trametes hirsuta AH-2 (ThbZIP-OE-13) strain of the application adopts the application method for producing laccase of the application, and the laccase yield is improved by more than 1.5 times compared with the wild-type laccase high-yield Trametes sp.AH28-2 strain, which fully shows that the Trametes hirsuta AH-2 (ThbZIP-OE-13) strain of the application has extremely excellent laccase production characteristics.

The above embodiments are not intended to limit the scope of the present application, so: all equivalent changes in structure, shape and principle of the application should be covered in the scope of protection of the application.

Claims (10)

1. The fungal laccase over-expressed gene ThbZIP is characterized in that the nucleotide sequence of the fungal laccase over-expressed gene ThbZIP is shown in SEQ ID No: 1.

2. A fungal laccase over-expression plasmid comprising the fungal laccase over-expression gene ThbZIP of claim 1, said fungal laccase over-expression plasmid comprising an digested linearized recombinant pYSK plasmid, and a linked L22-ThbZIP-L24 sequence; the recombinant pYSK plasmid adopts a pYSK plasmid with a recombined promoter, and the nucleotide sequence of the promoter of the recombinant pYSK plasmid is shown as SEQ ID No:2 is shown in the figure; the L22-ThbZIP-L24 sequence is a fungal laccase over-expressed gene ThbZIP with two sides respectively connected with the L22 sequence and the L24 sequence, and the nucleotide sequence of the L22 sequence is shown in SEQ ID No:3, the nucleotide sequence of the L24 sequence is shown as SEQ ID No: 4.

3. A method for preparing the fungal laccase over-expression plasmid according to claim 2, comprising the following steps:

sa, carrying out enzyme digestion on the fungal laccase over-expressed gene ThbZIP and pet-22b empty vector according to claim 1, and then connecting by using DNA ligase to obtain a connecting vector;

Sb, converting the connecting vector obtained in the step Sa into E.coli DH5 alpha competent cells, culturing and screening to obtain positive clones, and obtaining pet-22b-ThbZIP recombinant plasmids;

Sc and pet-22b-ThbZIP recombinant plasmid obtained in the step Sb are used as templates, L22-ThbZIP-F and L24-ThbZIP-R are used as upstream and downstream primers, and a target sequence is amplified; purifying the amplified target sequence, using the purified product as a template, and using the L22 sequence and the L24 sequence as an upstream primer and a downstream primer according to claim 2 to amplify to obtain an L22-ThbZIP-L24 sequence; the nucleotide sequences of the L22-ThbZIP-F and L24-ThbZIP-R primers are respectively shown in SEQ ID No:5 and SEQ ID No:6 is shown in the figure;

Sd, carrying out enzyme digestion on the recombinant pYSK plasmid of claim 2 to obtain a linearized pYSK plasmid, and connecting the L22-ThbZIP-L24 sequence obtained in the step Sc with the linearized pYSK plasmid by using a Saccharomyces cerevisiae homologous recombination method to obtain the fungal laccase over-expression plasmid.

4. The method of claim 3, wherein in step S3, agarose gel purification is used for the purification.

5. The method for preparing fungal laccase over-expression plasmid according to claim 3, wherein in the step S4, the specific preparation steps of linearization pYSK plasmid are as follows: after the recombinant pYSK plasmid is subjected to enzyme digestion, the enzyme digestion product is incubated for 1h at 37 ℃, and then agarose gel purification is carried out, so that the linearized pYSK plasmid is obtained.

6. An over-expression strain of a fungal laccase, characterized in that the over-expression strain of the fungal laccase is obtained after over-expression of a fungal gene ThbZIP in Trametes sp.AH28-2; the fungal laccase over-expression strain is named Trametes hirsutaAH-2 (ThbZIP-OE-13); preservation unit: china center for type culture Collection; address: chinese university of Wuhan; preservation date: 2023, 12 months 12; preservation number: cctccc M20232545.

7. A method for preparing an overexpressed strain of fungal laccase according to claim 6, comprising the steps of: preparing protoplast by using laccase-producing wild strain T.hirsutaAH28-2; then the fungal laccase over-expression plasmid of claim 2 is transformed into protoplast of laccase-producing wild strain T.hirsuta AH 28-2; regenerating, prescreening and rescreening the transformed protoplast to obtain an over-expressed strain of the fungal laccase.

8. The method for preparing the fungal laccase over-expressed strain according to claim 7, wherein the fungal laccase over-expressed plasmid is transformed into protoplast of laccase-producing wild strain T.hirsutaAH28-2 by using a PEG/CaCl ₂ method.

9. An over-expressed strain of the fungal laccase of claim 6, for use in the field of laccase production.

10. The use of an overexpressing strain of a fungal laccase according to claim 9, wherein the specific method of producing the laccase comprises the steps of:

S1, activating an overexpression strain of the fungal laccase according to claim 6 to obtain activated thalli;

S2, inoculating the activated thalli obtained in the step S1 into a liquid culture medium containing cellobiose and asparagine, fermenting for 120-160 hours by a shaking table, centrifuging a fermentation liquid, and removing thalli to obtain a fermentation supernatant;

and S3, purifying the fermentation supernatant obtained in the step S2 to obtain laccase.