CN110628788A - Construction method of monascus purpureus comp51725_ c0 gene overexpression strain - Google Patents

Abstract

The invention discloses a construction method of a purple monascus comp51725_ c0 gene overexpression strain, which comprises the steps of strain culture, overexpression vector construction, overexpression plasmid transformation and the like. The invention successfully clones out the monascus purpureus M1 straincomp51725_c0And (3) verifying the existence of the gene, connecting the gene with an overexpression plasmid pBC-Hygro, and introducing the gene into a monascus M1 strain to successfully construct an overexpression engineering strain C6. Over-expression by contrastcomp51725_c0The related physiological indexes of the secondary metabolite yield, the thallus dry weight, the mycelium morphology and the like of the C6 strain and the M1 strain of the gene are discovered and the gene is down regulatedcomp51725_c0Overexpression of the gene reduces the yield of Monacolin K in monascusThe form of the mycelium is changed to a certain extent, but the influence on monascus pigment and the biomass of the mycelium is little.

Description

Construction method of monascus purpureus comp51725_ c0 gene overexpression strain

The technical field is as follows:

the invention relates to a construction method of a purple monascus comp51725_ c0 gene overexpression strain, belonging to the field of biological genetic engineering.

Background art:

monascus is also called monascus, and belongs to the phylum mycomycota, subgenomycota, class of incomplete ascomycete, family of monascus, genus Monascus in the taxonomic classification of fungi. Monascus can produce various secondary metabolites, such as monascus pigment, Monacolin K, gamma-aminobutyric acid, citrinin and the like, wherein a plurality of metabolites are widely applied to the aspects of food pigment, medicine, wine brewing and the like, and the Monacolin K is also called lovastatin and is a polyketone substance with physiological activity produced by the monascus. Research finds that Monacolin K has the effect of inhibiting the activity of key enzyme HMG-CoA in cholesterol synthesis and can effectively inhibit cholesterol synthesis, so that Monacolin K is regarded as an ideal drug for reducing cholesterol at home and abroad.

The applicant of the invention analyzes the transcriptome of monascus purpureus M1 by using a high-throughput sequencing technology at the early stage of a laboratory, finds 52 transcription factors and 27 target genes, predicts the gene functions of 10 transcription factors and the target genes and obtains related gene information. As the specific regulation mechanism of Monacolin K of monascus is not completely clear, the transcription factor and the target gene can be subjected to gene cloning, functional verification and other works so as to obtain the key regulation factor in the synthesis process of the secondary metabolite of monascus.

The invention selects a down-regulated gene comp51725_ c0 obtained by transcriptome sequencing to clone genes, constructs a gene over-expression engineering strain, and explores the influence of the over-expression of a target gene on the synthesis of Monacolin K of monascus, the synthesis of monascus pigment, the mycelium morphology, the biomass and the expression quantity of related genes. .

Disclosure of Invention

The invention aims to solve the technical problem of providing a construction method of a monascus purpureus comp51725_ c0 gene overexpression strain.

In order to solve the technical problems, the invention adopts the technical scheme that:

the invention provides a construction method of a purple monascus comp51725_ c0 gene overexpression strain, which comprises the following steps:

(I) culture of bacterial species

Culturing the monascus purpureus M1 strain on a PDA solid culture medium, activating for 2 generations, wherein each generation is 3-4d, then inoculating the monascus purpureus M1 strain into a liquid seed culture medium, culturing at 30 ℃ and 200r/min until the seed liquid culture medium is light pink, requiring 48h, inoculating the monascus purpureus seed liquid into 50mL of liquid fermentation culture medium for culturing at 10% of the inoculation amount, culturing at 30 ℃ and 150r/min for 48h, and then changing the temperature to 25 ℃ to continue culturing until the 15 th d.

Respectively collecting 2d fermentation broth, 5d fermentation broth, 8d fermentation broth, 12d fermentation broth and 15d fermentation broth of Monascus purpureus, placing in a 2mL centrifuge tube, centrifuging at 12000r/min for 10min, removing supernatant, re-suspending with sterilized ultrapure water, repeating for three to four times, removing residual water as much as possible in the last step, and storing in a refrigerator at-80 deg.C.

(II) extraction of total RNA of monascus

The method comprises the following specific steps:

1. adding 475 mul SL and 25 mul beta-mercaptoethanol into a 2mL centrifuge tube, taking 2 tubes of monascus thallus stored in a refrigerator at the temperature of-80 ℃, quickly freezing the monascus thallus in a sterilized mortar by using liquid nitrogen, quickly grinding the monascus thallus into powder, taking the powder into the 2mL centrifuge tube filled with SL solution, immediately and uniformly mixing the powder by vortex oscillation, and centrifuging the powder at 12000rpm for 2 min;

2. sucking 500 mu L of supernatant into a filter column CS, centrifuging, and taking 400 mu L of filtrate into an empty centrifuge tube;

3. adding 160 μ L of anhydrous ethanol, transferring the mixture to adsorption column CR3, centrifuging at 12000rpm for 15sec, and discarding the filtrate;

4. adding 350 μ L deproteinizing solution RW1 into adsorption column CR3, centrifuging at 12000rpm for 15sec, and discarding the filtrate;

5. preparing DNase I working solution: adding 140 μ LRDD solution into 20 μ LDNase I, sucking, mixing, adding 80 μ L of the mixed solution into the center of adsorption column CR3, and standing for 15 min;

6. adding 350 μ L deproteinized solution RW1 into adsorption column CR3, centrifuging, and removing filtrate;

7. adding 500 μ L of rinsing solution RW into the adsorption column CR3, centrifuging, and discarding the filtrate;

8. repeating the step 7 once;

9. centrifuging for 2min, placing adsorption column CR3 in an empty centrifuge tube, and collecting 35 μ L of RNase-Free ddH₂Adding O to the center of the CR3 adsorption column membrane, standing for 2min, and centrifuging at 12000rpm for 1min to obtain filtrate as the extracted RNA;

(III) RNA quality detection

1. The RNA concentration detection is carried out by using a nucleic acid quantifier, and the method comprises the following specific steps: sampling 1 mu L of RNA into a detection hole to obtain the concentration of the RNA;

2. the integrity of RNA is detected by electrophoresis, and the method comprises the following specific steps:

(1) spotting 1 mu L of 10X Loading Buffer sample Buffer solution on the sealing film, sucking 3 mu LRNA samples to mix with the Buffer solution, sucking, beating and uniformly mixing, and spotting;

(2) the voltage of the electrophoresis apparatus is 150V, and the time is 15 min; detecting RNA integrity by gel imager;

(IV) reverse transcription of cDNA

(1) The mixture was prepared according to the removal system of the following table, centrifuged for 3sec, and then reacted in a PCR instrument under reaction conditions: at 42 ℃ for 3 min; taking out and placing on ice for later use;

TABLE gDNA removal reaction System

(2) Preparing a mixed solution according to the system shown in the table below, sucking, beating and uniformly mixing for later use;

reverse transcription reaction system

(3) Taking 10 mu L of the mixed solution prepared in the step (2), adding the mixed solution into the reaction system in the step (1), and centrifuging for a short time;

(4) incubating at 42 deg.C for 15min, and then incubating at 95 deg.C for 3min to obtain cDNA solution, and storing at-20 deg.C;

(V) primer design

Designing a primer according to the monascus comp51725_ c0 gene sequence; the primers and sequences are as follows:

(VI) construction of overexpression vector

Selecting two single enzyme cutting sites on two overexpression vectors which are pBC-hygro, and connecting the amplified comp51725_ c0 target genes by double enzyme cutting to construct an overexpression plasmid pBC-hygro-comp51725_ c 0;

(1) amplification of comp51725_ c4 Gene

Designing PCR primers according to a comp51725_ c0 gene sequence obtained by monascus transcriptome, and amplifying a comp51725_ c0 gene by using cDNA of purple monascus as a template; the PCR reaction system and the PCR reaction conditions of the comp51725_ c0 gene are as follows:

PCR reaction system of comp51725_ c0 gene

PCR reaction system	Volume (μ L)
		PrimeSTAR Max Premix(2X)	12.5
comp51725_c0-F	1
		comp51725_c0-R	1
cDNA	1
		ddH2O	9.5
Total volume	25

The PCR reaction conditions were as follows:

1)95℃for 5min；

2)94℃for 30sec；

3)55℃for 30sec；

4)72℃for 10sec；

5)GOTO2，30more times；

6)72℃for 10min；

7)4℃，forever；

(2) purification and recovery of PCR product

The method comprises the following specific steps:

1. adding 500 mul DB into each 100 mul PCR system, and fully and uniformly mixing; (if the system is less than 100 μ L, the amount of the solution can be made up to 100 μ L by double distilled water);

2. transferring the solution obtained in the step into an adsorption column AC, standing at room temperature for 1min, centrifuging at 12,000rpm for 30-60sec, and discarding the filtrate;

3. adding 700 mul of rinsing liquid WB, centrifuging at 12,000rpm for 1min, and discarding the waste liquid;

4. adding 500 μ L of rinsing liquid WB, centrifuging at 12,000rpm for 1min, and discarding the waste liquid;

5. centrifuging the empty column for 2 min;

6. placing the adsorption column AC in a new centrifuge tube, adding 40 μ L of elution buffer EB heated in water bath at 65 deg.C in advance into the center of the adsorption membrane, standing at room temperature for 2min, and centrifuging at 12,000rpm for 1 min;

(3) double digestion of the PCR product of comp51725_ c0 gene and pBC-Hygro plasmid

Double enzyme digestion system

The enzyme digestion reaction conditions are as follows: at 37 ℃ for 2 h; purifying and recovering the enzyme digestion product;

(4) ligation of PCR product of comp51725_ c0 gene with pBC-Hygro plasmid

The method comprises the following steps:

1. preparing the comp51725_ c0 fragment and the pBC-Hygro plasmid into 4.5 mu L of solution according to the ratio of 3:1, placing the solution in a water bath at 65 ℃ for 2-3min, and then placing the solution on ice for later use;

2. adding 4.5 mu LSolutionI into the mixed solution, and reacting for 30min at 16 ℃;

3. adding 1 mu of LSolutionII into the reaction solution, and storing in a refrigerator at the temperature of-20 ℃;

(5) transformation of recombinant plasmids

1. Gently pumping 5 μ L of the ligation product into 50 μ L of competent cells, gently flicking with hand, mixing, and ice-cooling for 30 min;

heat shock in water bath at 2.42 deg.C for 90sec, and immediately cooling on ice for 5 min;

3. adding 1mL LB liquid culture medium, shaking at 200rpm and 37 deg.C, culturing for 60min to recover thallus;

4. appropriately concentrating the cultured bacterial liquid, coating 200 mu L of the bacterial liquid on an LB solid culture medium containing 34 mu g/mL chloramphenicol, carrying out inverted culture at 37 ℃ for 12-16h, selecting a single colony, inoculating the single colony in an LB liquid culture medium, carrying out shake culture at 200rpm at 37 ℃ for 14h, and extracting recombinant plasmids;

(6) recombinant plasmid validation

1. And (3) electrophoresis detection: taking 5 mu L of recombinant plasmid to carry out electrophoresis detection on 1% agarose gel;

2. and (3) double enzyme digestion verification: performing double enzyme digestion verification on the recombinant plasmid with the size of the band conforming to the expected size by using QuickCutXbaI and QuickCutClaI; if the enzyme digestion product after double enzyme digestion has two strips, and the sizes of the strips are respectively consistent with the sizes of the fragments obtained after plasmid enzyme digestion and target fragment gene enzyme digestion, the success of the construction of the recombinant plasmid is proved;

(VII) overexpression plasmid transformation

(1) Preparation of monascus protoplast

1. Inoculating monascus M1 on 4 PDA plate culture media, and culturing in a constant temperature incubator at 30 ℃ for 4 d;

2. adding 10mL of sterile water on each plate, and scraping the surfaces of the thalli by using an inoculating loop to release spores to prepare spore suspension;

3. coating 200 μ L spore suspension on sterilized and oven-dried PDA plate, coating to dryness, and culturing at 30 deg.C for 30-40 hr;

4. the pale pink mycelium from the glassine paper was scraped with an inoculating loop and placed on a mira cloth monolayer with 50mL MgSO₄Filtering and washing the solution;

5. transferring the mycelium into 50mL of lyase liquid subjected to filtration sterilization, carrying out enzymolysis for 2.5-3h at 30 ℃ and 60rpm, and then carrying out single-layer filtration by mira cloth;

6. centrifuging the filtrate at 4 deg.C and 7000rpm for 5min, and removing the supernatant;

7. then filtering for 2 times by using 1.2mol/L sorbitol solution (centrifuging, removing supernatant), adding the sorbitol solution to resuspend the protoplast, and placing on ice for later use;

(2) monascus hygromycin tolerant concentration screening

100 μ L of monascus M1 competent cell suspension was pipetted and plated on PDA plates at a gradient of hygromycin B: 0. 5, 10, 15, 20, 25 μ g/mL, incubated at 30 ℃ to determine the optimal inhibitory concentration of hygromycin B on the growth of M1;

(3) electroporation transformation of protoplasts

1. Centrifuging the protoplast suspended in sorbitol solution at 7000rpm for 5min, sucking the supernatant as completely as possible, adding 1mL of electric shock conversion solution, sucking, beating, mixing, and centrifuging to remove the supernatant; adding 220 μ L of electric shock conversion solution, sucking, beating and mixing;

2. taking two sterilized new 1.5mL centrifuge tubes, adding 70 μ L of electric shock transformed cells respectively, adding 1 μ g plasmid into one tube, sucking, beating, mixing, and ice-cooling for 15 min;

3. transferring all the solution in the centrifuge tube in the previous step into a precooled electric shock conversion cup, immediately adding 900 mu L of precooled resuscitation liquid culture medium after electric shock, sucking, pumping and uniformly mixing;

4. transferring the liquid in the electric shock transformation cup into a 1.5mL sterile centrifuge tube, and carrying out ice bath for 10 min;

5. placing the centrifuge tube into an empty culture dish, and culturing for 2h at 30 ℃ and 100 rpm;

6. spreading 100 μ L on PDA plate, and culturing at 30 deg.C for 6-7 d.

The sequence of the comp51725_ c0 gene is as follows:

GGGTCGGATGGGGCAGGAGCTGGAGAAGCCGGAGAATCCATGAATAAAGCAAAAGCTGGGTCTGATTCGTCGATGTCAATTCCGGAATCAACACTGCTCATACCAGAATCTTCGTTCGACTCCTCGACTACAGGGGGCAACTCAAGGCAAGGCACCTCTTCTTTGGTTTCCATGCTGTATGAGCCAACAAAATCCAACGACTTTCCAGAAAAAACTTCAGTATCAACAGCCGGCCCTTGTGGCACATCTAATACCGCAAAGATAGGCGTGTTGTCATAGTTTATGTCAATTCCCGAGTTCCAACCTGCAGTGGTCATATCCACGGAGGACATTTCAACTTGTTGGCTTGGGACGATCACCATGCCAACTTGGGAGTTCTGTTGCATTTGGATCTCTTGAGAGTTGAGGTTCGTGTTCACATCCTTAGTGGCTTCAGTTTGTACTGGCTGCCGCGCCACGGTTGGGGGATGCGGTTCTTGCTGCTGAGGTAGCCGTGGCTGAACCTGAGGAGCCTGAGACGTAGTAGGTGGCGGCGGAGGGAGTCCAGAGACACTCAGCTCGTCCAAGAACGTAGAAAACTGGGGCGATGACAAGAGCAGTCTGACTAAATCCGTAAGACGGCCGTTTTCCTCCTGGAGAGCGCGGTTCCGAAGACGGAGATCATGGGCTTCTGTTGTTTTAGCGGTAACCTCACTTTCAAGCTGGGTTATGTATTCCTTTCGTCGTGAACGGAAAGCGCTCGCAGACACCTTATTTCGAAGCT

the invention has the beneficial effects that:

the invention successfully clones the comp51725_ C0 gene in the monascus purpureus M1 strain, verifies the existence of the gene, connects the gene with an overexpression plasmid pBC-Hygro, and introduces the gene into the monascus purpureus M1 strain to successfully construct an overexpression engineering strain C6.

By comparing the secondary metabolite yield, the dry weight of the mycelia, the mycelium morphology and other related physiological indexes of the C6 strain and the M1 strain which over-express the comp51725_ C0 gene, the fact that the over-expression of the comp51725_ C0 gene which down-regulates the gene reduces the yield of Monacolin K in monascus and changes the mycelium morphology to a certain extent is found, but the influence on monascus pigment and the biomass of the mycelia is not large.

The RT-qPCR technology is used for detecting the gene expression change conditions of the two strains, and the over-expression of the comp51725_ c0 gene changes the expression conditions of genes on a part of Monacolin K synthetic gene cluster, wherein the mokA, mokB, mokE, mokF and mokH genes are obviously inhibited at the later stage of fermentation, and the expression quantity of the mokA, mokC, mokD, mokE, mokF and mokH genes at 15d of fermentation is obviously reduced, so that the yield of Moncolin K is reduced. Therefore, the down-regulated gene comp51725_ c0 has a certain degree of regulation effect on genes related to Monacolin K synthesis.

Description of the drawings:

FIG. 1 is a schematic diagram of the construction of pBC-hygro-comp51725_ c0 plasmid.

FIG. 2 is the electrophoresis picture of the PCR product of comp51725_ c0 gene. Lane 1: DL2,000DNA Marker; lanes 2, 3: PCR amplification product of comp51725_ c0 gene.

FIG. 3 is the alignment of the recombinant plasmid and the comp51725_ c0 gene sequence.

FIG. 4 shows double digestion of recombinant plasmid. Lane 1: DL10,000DNA Marker; lane 2: pBC-Hygro/Quick Cut Xba I + Quick Cut Cla I; lane 3: pBC-Hygro-comp51725_ c0/Quick Cut Xba I + Quickcut Cla I.

FIG. 5 is a recombinant plasmid PCR validation. Lane 1: DL2000 DNA Marker; lane 2: pBC-Hygro plasmid PCR products; lane 3: recombinant plasmid PCR products.

FIG. 6 is the concentration of hygromycin B resistance by Monascus M1 strain.

FIG. 7 shows the results of screening of the plasmid-introduced strains. First row: m1 strain into which plasmids are introduced; a second row: m1 strain.

FIG. 8 is a Monacolin K production analysis on day 12 of Monacolin fermentation by recombinant plasmid-introduced Monascus fermentation.

FIG. 9 is a PCR electrophoresis of hygromycin gene from strain C6. Lane 1: DL2000 DNA Marker; lane 2: blank control; lane 3: m1 strain; lanes 4, 5: strain C6.

FIG. 10 is a comparison of Monacolin K production by strain C6 and strain M1.

FIG. 11 shows the color number detection of monascus pigment of strain C6. A: red pigment of red yeast rice; b: monascus orange pigment; c: monascus yellow pigment

FIG. 12 shows the dry weight measurements of the cells of strains C6 and M1.

FIG. 13 is a scanning electron micrograph of the C6 strain and the M1 strain at different magnifications. A: m1 strain 20000 ×; b: c6 strain 20000 ×; c: m1 strain 5000 ×; d: c6 strain 5000 x.

FIG. 14 is transcript amount analysis of mokA-mokI gene of C6 and M1 strains

The specific implementation mode is as follows:

example 1

This example specifically provides a method for constructing a monascus purpureus comp51725_ c0 gene overexpression strain, which is performed according to the following experimental method.

1. Experimental Material

1.1 Experimental strains and plasmid vectors

Wild type Monascus purpureus M1 strain deposited by laboratory; escherichia coli DH 5. alpha. E.coli competent cells purchased from Tiangen Biochemical (Beijing) Ltd; pBC-Hygro plasmid from Wuhan vast Ling Bio.

1.2 reagents and materials

PDA, PDB, LB broth, 10 XTAE, 1 XPBS, glucose, soybean meal, NaNO₃、MgSO₄.7H₂O, Lysozyme, Snailase, Cellulase, hygromycin, chloramphenicol, independent filter, 0.22 μm filter, disposable syringe, peptone, KH₂PO₄、ZnSO₄.7H₂O, etc. from Beijing pinellia science and technology development, Inc.; the SuperRealPreMix Plus (SYBR Green) kit, the FastQuant cDNA first strand synthesis kit and the RNAprep pure polysaccharide polyphenol plant total RNA extraction kit are purchased from Tiangen Biochemical technology (Beijing) Co., Ltd; QuickCutCla I, QuickCutXba I, PrimeSTAR MaxDNA Polymerase, DNA marker from TaKaRa; methanol, ethanol, glycerol, and the like are purchased from Beijing chemical plants; the high-purity plasmid miniprep kit and the multifunctional DNA purification and recovery kit are purchased from Beijing Baitacg biotechnology limited.

1.3 instruments

The main instruments are shown in table 1.

TABLE 1 Main Instrument

1.4 culture Medium and antibiotics

Plate medium (g/L): 37 g of PDA and 7.5g of agar.

Liquid seed medium (g/L): 30g of glucose, 70g of glycerol, 15g of soybean meal, 10g of peptone and KH₂PO₄ 2g，NaNO₃ 2g，MgSO₄.7H₂O 1g。

Liquid fermentation medium (g/L): 90g of glycerol, ZnSO₄.7H₂O2 g, rice flour 20g, KH₂PO₄2.5g, peptone 10g, NaNO₃5g，MgSO₄.7H₂O 1g。

The antibiotics and the concentrations used are shown in table 2.

TABLE 2 antibiotics and concentrations used

2 method of experiment

2.1 Strain culture

Culturing the monascus purpureus M1 strain on a PDA solid culture medium, activating for 2 generations, wherein each generation is 3-4d, then inoculating the monascus purpureus M1 strain into a liquid seed culture medium, culturing at 30 ℃ and 200r/min until the seed liquid culture medium is light pink, and taking about 48h, inoculating the monascus purpureus seed liquid into 50mL of liquid fermentation culture medium for culturing at 10% of the inoculum size, culturing at 30 ℃ and 150r/min for 48h, and then changing the temperature to 25 ℃ to continue culturing until the 15 d.

Respectively collecting 2d fermentation broth, 5d fermentation broth, 8d fermentation broth, 12d fermentation broth and 15d fermentation broth of Monascus purpureus, placing in a 2mL centrifuge tube, centrifuging at 12000r/min for 10min, removing supernatant, re-suspending with sterilized ultrapure water, repeating for three to four times, removing residual water as much as possible in the last step, and storing in a refrigerator at-80 deg.C.

2.2 extraction of Total RNA from Monascus purpureus

The method comprises the following specific steps:

1. adding 475 mul SL and 25 mul beta-mercaptoethanol into a 2mL centrifuge tube, taking 2 tubes of monascus thallus stored in a refrigerator at the temperature of-80 ℃, quickly freezing the monascus thallus in a sterilized mortar by using liquid nitrogen, quickly grinding the monascus thallus into powder, taking the powder into the 2mL centrifuge tube filled with SL solution, immediately and uniformly mixing the powder by vortex oscillation, and centrifuging the powder at 12000rpm for 2 min;

2. sucking 500 mu L of supernatant into a filter column CS, centrifuging, and taking 400 mu L of filtrate into an empty centrifuge tube;

3. adding 160 μ L of anhydrous ethanol, transferring the mixture to adsorption column CR3, centrifuging at 12000rpm for 15sec, and discarding the filtrate;

4. adding 350 μ L deproteinizing solution RW1 into adsorption column CR3, centrifuging at 12000rpm for 15sec, and discarding the filtrate;

5. preparing DNase I working solution: adding 140 μ LRDD solution into 20 μ LDNase I, sucking, mixing, adding 80 μ L of the mixed solution into the center of adsorption column CR3, and standing for 15 min;

6. adding 350 μ L deproteinized solution RW1 into adsorption column CR3, centrifuging, and removing filtrate;

7. adding 500 μ L of rinsing solution RW into the adsorption column CR3, centrifuging, and discarding the filtrate;

8. repeating the step 7 once;

9. centrifuging for 2min, placing adsorption column CR3 in an empty centrifuge tube, and collecting 35 μ L of RNase-Free ddH₂Adding O to the center of the CR3 adsorption column membrane, standing for 2min, and centrifuging at 12000rpm for 1min to obtain filtrate as the extracted RNA.

2.3 RNA quality detection

1. The RNA concentration detection is carried out by using a nucleic acid quantifier, and the method comprises the following specific steps: 1 mu L of RNA is sampled and spotted in a detection hole to obtain the concentration of the RNA.

2. The integrity of RNA is detected by electrophoresis, and the method comprises the following specific steps:

(1) spotting 1 μ L of 10X Loading Buffer solution on the sealing film, sucking 3 μ LRNA sample, mixing with the Buffer solution, sucking, mixing well, and spotting.

(2) The voltage of the electrophoresis apparatus is 150V, and the time is 15 min. RNA integrity was checked by gel imager.

2.4 reverse transcription of cDNA

The experimental procedure was as follows:

1. the mixture was prepared according to the removal system of table 3, centrifuged for 3sec, and then reacted in a PCR instrument under reaction conditions: 42 ℃ for 3 min. Taking out and placing on ice for later use.

TABLE 3 gDNA removal reaction System

2. Preparing a mixed solution according to the system in the table 4, sucking, beating and mixing uniformly for later use.

TABLE 4 reverse transcription reaction System

And (3) adding 10 mu L of the mixed solution prepared in the step (2) into the reaction system in the step (1), and centrifuging for a short time.

Incubating at 42 deg.C for 15min, and then incubating at 95 deg.C for 3min to obtain cDNA solution, and storing at-20 deg.C.

2.5 design of Gene primers for purposes

Primers were designed based on the conserved regions based on the comp51725_ c0 gene sequence obtained from monascus transcriptome, see table 5, and the primers were synthesized from huada gene.

TABLE 5 comp51725_ c0 gene amplification primers

2.6 overexpression vector construction

2.6.1 construction of overexpression plasmids

In this example, pBC-hygro is used as an overexpression vector, and the amplified comp51725_ c0 target genes are connected by double enzyme digestion to construct a plasmid for overexpression pBC-hygro-comp51725_ c0, wherein the construction scheme of the plasmid is shown in FIG. 1.

2.6.2 amplification of comp51725_ c0 Gene

PCR primers are designed according to the comp51725_ c0 gene sequence obtained by monascus transcriptome, and the comp51725_ c0 gene is amplified by taking cDNA of monascus purpureus M1 stored in a laboratory as a template. The PCR reaction system and the PCR reaction conditions of the comp51725_ c0 gene are shown in Table 6:

TABLE 6 PCR reaction System for comp51725_ c0 Gene

The PCR reaction conditions were as follows:

1)95℃for 5min

2)94℃for 30sec

3)55℃for 30sec

4)72℃for 10sec

5)GOTO2，30more times

6)72℃for 10min

7)4℃，forever

2.6.3 PCR product purification and recovery

The method comprises the following specific steps:

1. add 500. mu.L of DB per 100. mu.L of PCR system and mix well. (if the system is less than 100. mu.L, the amount of the solution can be made up to 100. mu.L by double distilled water).

2. Transferring the solution obtained in the above step to an adsorption column AC, standing at room temperature for 1min, centrifuging at 12,000rpm for 30-60sec, and discarding the filtrate.

3. 700. mu.L of the rinsing solution WB was added, and the mixture was centrifuged at 12,000rpm for 1min, and the waste solution was discarded.

4. Add 500. mu.L of the rinsing solution WB, centrifuge at 12,000rpm for 1min, discard the waste solution.

5. The column was centrifuged for 2 min.

6. The adsorption column AC was placed in a new centrifuge tube, 40. mu.L of elution buffer EB heated in advance in a water bath at 65 ℃ was dropped into the center of the adsorption membrane, allowed to stand at room temperature for 2min, and centrifuged at 12,000rpm for 1 min.

2.6.4 double digestion of PCR product of comp51725_ c0 gene with pBC-Hygro plasmid

The double cleavage system is shown in Table 7.

TABLE 7 double enzyme digestion System

The enzyme digestion reaction conditions are as follows: at 37 ℃ for 2 h;

the product of the digestion is purified and recovered, the procedure is the same as 2.6.2.

2.6.5 ligation of PCR product from comp51725_ c0 Gene to pBC-Hygro plasmid

The experimental procedure was as follows:

1. the comp51725_ c0 fragment and pBC-Hygro plasmid were mixed in a ratio of 3:1 (or 5:1) to prepare a 4.5. mu.L solution, which was placed in a 65 ℃ water bath for 2-3min and then on ice for further use.

2. To the mixture was added 4.5. mu.L of lsoluteioni I, and the reaction was carried out at 16 ℃ for 30 min.

3. To the reaction solution, 1. mu.L of LSolutionII was added and stored in a refrigerator at-20 ℃.

2.6.6 transformation of recombinant plasmids

The ligation products were transformed into E.coli DH 5. alpha. competence, as follows:

1. gently pumping 5 μ L of ligation product into 50 μ L of competent cells, gently flicking with hand, mixing well, and ice-cooling for 30 min.

Heat shock in a water bath at 2.42 ℃ for 90sec and immediately cooling on ice for 5 min.

3. Adding 1mL LB liquid medium, shaking at 200rpm and 37 deg.C, culturing for 60min, and recovering thallus.

4. And (3) properly concentrating the cultured bacterial liquid, taking 200 mu L of the bacterial liquid, coating the bacterial liquid on an LB solid culture medium containing 34 mu g/mL of chloramphenicol, carrying out inverted culture at 37 ℃ for 12-16h, selecting a single colony, inoculating the single colony in an LB liquid culture medium, carrying out shake culture at 200rpm at 37 ℃ for 14h, and extracting the recombinant plasmid.

2.6.7 verification of recombinant plasmids

1. And (3) electrophoresis detection: 5 μ L of the recombinant plasmid was detected by electrophoresis on 1% agarose gel.

2. And (3) double enzyme digestion verification: performing double enzyme digestion verification on the recombinant plasmid with the size of the band conforming to the expected size by using QuickCutXbaI and QuickCutClaI; if the enzyme digestion product after double enzyme digestion has two bands, and the sizes of the bands are respectively consistent with the sizes of the fragments obtained after plasmid enzyme digestion and target fragment gene enzyme digestion, the success of the construction of the recombinant plasmid is proved.

2.7 overexpression plasmid transformation

2.7.1 Monascus protoplast preparation

1. Monascus purpureus M1 was inoculated onto 4 PDA plate media and cultured in 30 ℃ incubator for 4 days.

2.10 mL of sterile water was added to each plate, and the surface of the cells was gently scraped with an inoculating loop to release spores, thereby preparing a spore suspension.

3. Coating 200 μ L spore suspension on sterilized and oven-dried PDA plate, spreading to dryness, and culturing at 30 deg.C for 30-40 hr.

4. The pale pink mycelium from the glassine paper was scraped with an inoculating loop and placed on a mira cloth monolayer with 50mL MgSO₄And filtering and washing the solution.

5. The mycelia were transferred to 50mL of filter sterilized lyase solution, subjected to enzymatic hydrolysis at 30 ℃ and 60rpm for 2.5-3h, and then subjected to monolayer filtration using mira cloth.

6. The filtrate was centrifuged at 7000rpm for 5min at 4 ℃ and the supernatant was discarded.

7. Then, the protoplasts were resuspended in 1.2mol/L sorbitol solution 2 times (centrifugation, removal of supernatant) and the protoplasts were resuspended in sorbitol solution and placed on ice until use.

2.7.2 Monascus hygromycin resistance concentration screening

100 μ L of monascus M1 competent cell suspension was pipetted and plated on PDA plates at a gradient of hygromycin B: 0. 5, 10, 15, 20, 25. mu.g/mL, incubated at 30 ℃ to determine the optimal inhibitory concentration of hygromycin B on the growth of M1.

2.7.3 electroporation transformation of protoplasts

1. Centrifuging the protoplast suspended in sorbitol solution at 7000rpm for 5min, sucking the supernatant as completely as possible, adding 1mL of electric shock conversion solution, sucking, beating, mixing, and centrifuging to remove the supernatant; then 220 mul of electric shock conversion solution is added, sucked, beaten and mixed evenly.

2. Two sterilized new 1.5mL centrifuge tubes were added with 70. mu.L each of the cells transformed by electric shock, and 1. mu.g of plasmid was added to one tube, pipetted and mixed well, and ice-cooled for 15 min.

3. And (3) transferring all the solution in the centrifuge tube in the previous step into a precooled electric shock conversion cup, immediately adding 900 mu L of precooled resuscitation liquid culture medium after electric shock, sucking, pumping and uniformly mixing.

4. The liquid in the electroporation cuvette was transferred to a 1.5mL sterile centrifuge tube and ice-cooled for 10 min.

5. The centrifuge tubes were placed in an empty petri dish and incubated at 30 ℃ for 2h at 100 rpm.

6. Spreading 100 μ L on PDA plate, and culturing at 30 deg.C for 6-7 d.

2.8 verification of overexpression strains

And (4) continuously passaging the transformants obtained by screening to screen stably inherited transformants. The overexpression strains were verified as follows:

1. and (3) verifying secondary metabolites by detecting the yield of Monacolin K and the monascus pigment color value in the monascus transformants.

2. And (4) gene level verification, namely amplifying the hygro gene by using the cDNA of the transformant as a template. If the target strain can amplify hygro gene, but the control strain M1 can not, the over-expression plasmid is proved to be introduced into monascus, and the success of constructing comp51725_ c0 gene over-expression strain is preliminarily proved. The PCR reaction system and conditions for hygromycin gene amplification are shown in Table 8:

TABLE 8 PCR reaction System for hygromycin Gene

The PCR reaction conditions were as follows:

1)96℃for 5min

2)96℃for 20sec

3)54-64℃for 30sec

4)72℃for 1min

5)GOTO 1，10more times

6)96℃for 20sec

7)54℃for 30sec

8)72℃for 1min

9)GOTO 6，30moretimes

10)72℃for 10min

11)4℃，forever

2.9 analysis of transcript amount of Monacolin K Synthesis-related Gene

1. Collecting and treating thallus: placing the fermentation liquor of Monascus purpureus of 2d, 5d, 8d, 12d and 15d in a 2mL centrifuge tube, centrifuging at 12000rpm for 10min, discarding the supernatant, washing with sterilized water, resuspending for four times, completely absorbing water, extracting RNA according to the method of 2.3.2, and reverse transcribing to cDNA.

2. Design and synthesis of primers: a primer is designed by utilizing Beacon Designer8 software, a Monacolin K key genome sequence is synthesized according to monascus of an NCBI website, nine genome sequences of mokA, mokB, mokC, mokD, mokE, mokF, mokG, mokH and mokI, an internal reference gene GAPDH and a comp51725_ c0 gene sequence are selected, a specific primer is designed and shown in Table 9, and the primer is synthesized by Huada gene company.

TABLE 9 primer sequences for Key genes

3. Quantitative fluorescence analysis

A reaction system is designed according to the instructions of a SuperReal fluorescent quantitative premixed reagent enhanced (SYBR Green) kit of Tiangen Biochemical technology (Beijing) Co., Ltd and amplification is carried out. The operation method comprises the following steps:

(1) the reaction system was prepared on ice using a Realtime PCR reaction system as shown in Table 10:

TABLE 10 fluorescent quantitative PCR reaction System

(2) Adopting a three-step PCR program reaction, wherein the Real time PCR reaction conditions are as follows:

1)95℃for 15min

2)95℃for 10sec

3)52℃for 20sec

4)72℃for 30sec

5)GOTO2，40more times

6)Melt Curve 65℃to 95℃:Increment 0.5℃5sec

(3) the reaction tube is covered, the reaction tube is placed in a fluorescent quantitative PCR instrument after short-time centrifugation, and the reaction is started according to a set program.

2.10 detection of Monacolin K

Sample pretreatment: taking 5mL of fermentation liquor, adding 15mL of 75% methanol, performing ultrasonic extraction for 30min, and standing for 4-5 h.

Detection of Monacolin K^[68]: detecting the content of Monacolin K in the fermentation liquor by using HPLC, wherein the content of Monacolin K in the fermentation liquor is detected by using a chromatographic column: InertsilODS-3C 18(150 mm. times.4.6 mm. times.5 μm), mobile phase: methanol: 0.1% phosphoric acid ═ 3:1, the total flow rate is 1mL/min, the detector is an ultraviolet detector (PDA), the detection temperature is 30 ℃, the detection wavelength is 237nm, and the sample injection amount is 10 mu L.

2.11 Monascus pigment color number detection

Sample pretreatment: taking 5mL of fermentation liquor, adding 15mL of 70% ethanol, and centrifuging for 15min in a thermostatic water bath at 60 ℃ for 1h at 4000 rpm.

And (3) detection of color value: the absorbance at 505, 448 and 410nm was measured with an ultraviolet spectrophotometer.

Quantitative formula: red yeast pigment color value (U/mL) is equal to light absorption value multiplied by dilution multiple

2.12 determination of Biomass

Measurement of cell biomass: the biomass of the bacteria is measured by a dry weight method. And (3) placing 5mL of fermentation liquor on double-layer lens wiping paper for filtering, washing with sterilized water for 3 times, and drying to constant weight to obtain the dry weight of the mycelia.

Biomass (g/L) dry matter mass/volume of fermentation broth

2.13 mycelium morphology assay

The monascus fermentation broth cultured for 8 days is centrifuged at 12000rpm for 5min, the supernatant is discarded, 2.5% glutaraldehyde solution (diluted by 1 × PBS buffer solution) is added, the mixture is blown and stirred evenly, and the mixture is kept stand at normal temperature for 12 h. The cells were rinsed twice with 0.1M phosphate buffer, resuspended twice and centrifuged, and the supernatant discarded. Resuspend sequentially with ethanol solutions of different concentrations (30%, 50%, 70%, 80%, 90%, 100%), stand 10min for each concentration, centrifuge at 12000rpm for 5min, discard the supernatant, and repeat twice for each concentration. Cells were ethanol-substituted with isoamyl acetate and ethanol (v: v ═ 1:1) and pure isoamyl acetate solutions, respectively, and after standing still in each solvent for 10min, they were centrifuged at 12000rpm for 5min, and the supernatant was discarded. Finally, adding hexamethyldisilazane into the centrifuge tube, wherein the dosage of hexamethyldisilazane is slightly more than that of the sample. Plugging the pipe orifice with absorbent cotton, drying in an oven at 60 deg.C until the sample is powdered, and storing in room temperature drying place^[70]。

3 results and analysis

3.1 amplification of comp51725_ c0 Gene

The results of electrophoretic analysis of the comp51725_ c0 gene fragment amplified by PCR using the cDNA of monascus M1 as a template and comp51725_ c0-F and comp51725_ c0-R as upstream and downstream primers are shown in FIG. 2. After PCR amplification, a single band with the size of about 720bp is obtained, which is consistent with the expectation.

3.2 validation of recombinant plasmids

After the recombinant plasmid is constructed, the sequencing result of the recombinant plasmid bacterial liquid is completely compared with the original sequence of the comp51725_ c0 gene, the comparison result is shown in figure 3, the similarity reaches 97.21 percent, and the successful insertion of the target gene in the pBC-hygro plasmid is proved.

The recombinant plasmid was verified by double digestion with QuickCutXba I and QuickCutCla I. As shown in FIG. 4, two target fragments of about 6800bp and about 720bp were obtained by double digestion, which was consistent with the expectation.

Performing PCR verification on the recombinant plasmid, and performing PCR verification by respectively using the pBC-Hygro plasmid and the recombinant plasmid as templates, wherein the result is shown in FIG. 5, and the pBC-Hygro plasmid cannot amplify the target gene; the recombinant plasmid can amplify target genes, and the success of over-expression plasmid construction is proved.

3.3 concentration screening of Monascus M1 Strain for hygromycin B

100 μ L of monascus M1 strain spore suspension was spread on hygromycin B resistant plates with different concentration gradients of 0, 5, 10, 15, 20 and 25 μ g/mL to screen for optimal inhibitory concentrations. As a result, as shown in FIG. 6, the number of colonies of the Monascus M1 strain gradually decreased with the increase in hygromycin B concentration, and almost sterile colonies grew when the hygromycin B concentration was 25. mu.g/mL. Therefore, a hygromycin B concentration of 25. mu.g/mL was chosen as the screening inhibitory concentration.

3.4 introduction of recombinant plasmid and selection of transformant

And (3) introducing the successfully constructed over-expression plasmid into the monascus protoplast by using an electric shock transformation method, and selecting a transformant according to the result of 2.3 hygromycin B concentration screening. As a result, as shown in FIG. 7, the larger the concentration of hygromycin B, the smaller the number of colonies of the wild-type M1 strain and the plasmid-introduced M1 strain; when the hygromycin B concentration was 10. mu.g/mL, a significant difference in the number of colonies was observed between the two strains, and a significantly greater number of colonies was obtained for the M1 strain after plasmid introduction. Finally, colonies on the resistant plates were randomly picked at hygromycin B concentrations of 20. mu.g/mL and 25. mu.g/mL to obtain hygromycin B-resistant transformants. Transformants were uploaded on hygromycin B resistant PDA plates for 5 generations, followed by fermentation culture to 12d, and the transformants were tested for the yield of Monacolin K, the yield of monascorubin, and the hygromycin B genome.

3.5 detection of the yield of Monacolin K in the transformant Strain

After the recombinant plasmid is introduced into the monascus competent cells, the thalli are subjected to recovery culture and screened by a hygromycin plate, 14 single colonies are randomly selected on the hygromycin plate and named as C1-C14. After subculture, 12 genetically stable strains, namely C1, C2, C3, C6, C7, C8, C9, C10, C11, C12, C13 and C14, are obtained from the C1-C14 strain, and after 12-strain transformants are subjected to fermentation culture for 12 days, the Monacolin K content in the monascus fermentation broth is detected by HPLC (high performance liquid chromatography), as shown in FIG. 8, the Monacolin K yield of the C6 strain is the lowest, and is reduced by 45.9% compared with the original M1 strain. And selecting the C6 strain as a target strain, and performing PCR verification on the hygromycin B genome.

3.6 PCR validation of hygromycin Gene of over-expressed Strain C6

PCR verification of hygromycin gene is carried out on the C6 strain, RNA of monascus M1 strain and RNA of C6 strain are extracted respectively, and then the RNA is reversely transcribed into cDNA. And carrying out hygromycin gene amplification by using cDNA as a template and Hygro-F and Hygro-R as primers. As shown in FIG. 9, the C6 strain amplified a band around 500bp and was consistent with the expected size, while the wild type monascus M1 could not be amplified, indicating that the C6 strain successfully introduced the over-expression plasmid and the over-expression strain was successfully constructed.

3.7 Monacolin K production assay for overexpressing Strain C6

Monacolin K yield detection is carried out on monascus introduced with recombinant plasmids through HPLC, and Monacolin K yield of 5 th, 8 th, 12 th and 15 th strains is detected through fermentation culture of the C6 strain, as shown in figure 10, the Monacolin K yield of the 12 th 12d C6 strain is reduced by 29.6% compared with that of the M1 strain, and the Monacolin K yield of the 15 th 15d C6 strain is reduced by 34.1% compared with that of the M1 strain.

3.8 Monascus pigment color number detection of overexpression Strain C6

Monascus introduced with the recombinant plasmid is subjected to monascus red pigment, orange pigment and yellow pigment color value detection, the C6 strain is subjected to fermentation culture, and the 5 th, 8 th, 12 th and 15 th monascus pigment color values are detected, as shown in figure 11, the 5 th, 8 th and 12 th color values of the C6 strain are not obviously changed with the M1 strain, the 15 th pigment color value is slightly lower than the M1 strain, and the color values of the three pigments are respectively reduced by 21.7%, 23.5% and 26.1% compared with the M1 strain.

3.9 detection of the Biomass of the overexpressing Strain C6

The effect of over-expression of the comp51725_ C0 gene on the growth of monascus mycelium was investigated by comparing the differences in dry weight of mycelium between the C6 strain and the M1 strain on different days of fermentation. As shown in FIG. 12, the mycelium changes were consistent between the C6 strain and the M1 strain, and the differences were not obvious.

3.10 detection of microscopic cell morphology of the overexpression Strain C6

The morphology difference of the mycelium of the C6 strain and the mycelium of the M1 strain is detected by a scanning electron microscope, the result is shown in figure 13, and the comparison of the C and D shows that the mycelium of the C6 strain has more folds compared with the M1 strain; as can be seen from a comparison of the graphs A and B, the degree of sagging, the number of particles and the degree of wrinkling of the mycelium of the C6 strain were significantly greater than those of the M1 strain. Therefore, it is speculated that the over-expression of the comp51725_ c0 gene may cause the change of the morphology of the monascus mycelium, thereby influencing the yield of secondary metabolites in the fermentation broth.

3.11 detection of Gene transcript amount

The RT-qPCR technology is utilized to detect the expression amount of the comp51725_ C0 gene and the 9-segment gene (i.e. mokA-mokI gene) on the Monacolin K synthetic gene cluster in the C6 strain and the wild M1 strain, the experimental result is shown in FIG. 14, and the expression amount of the comp51725_ C0 gene of the C6 strain in the 2d fermentation stage is 4.7 times of that of the M1 strain. In addition, the result of RT-qPCR also shows that the over-expression of the comp51725_ c0 gene also influences the expression amount of partial genes on the Monacolin K synthetic gene cluster. Wherein, the expression amount of the mokA, mokB, mokC, mokD, mokE, mokF and mokI genes in the C6 strain is obviously improved compared with that of the M1 strain in the 2 nd fermentation period, and the expression amount of the mokA, mokC, mokD, mokE and mokF genes is obviously inhibited compared with that of the M1 strain in the 15 th fermentation period. The expression level of the mokG gene is not changed obviously. The expression level of the mokE gene in the C6 strain is obviously improved in the 2d, and the expression levels in the 5d, 8d, 12d and 15d are obviously reduced.

Sequence listing

<110> Beijing university of Industrial and commercial

<120> construction method of purple monascus comp51725_ c0 gene overexpression strain

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gctctagaat ccatgaataa agcaaaag 28

<210> 2

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaaataaggt gtctgcgagc atcgatgg 28

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atcgttatgt ttatcggcac t 21

<210> 4

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tggcgacctc gtattgg 17

Claims (1)

1. The method for constructing the purple monascus comp51725_ c0 gene overexpression strain is characterized by comprising the following steps:

(I) culture of bacterial species

Culturing the monascus purpureus M1 strain on a PDA solid culture medium, activating for 2 generations, wherein each generation is 3-4d, then inoculating the monascus purpureus M1 strain into a liquid seed culture medium, culturing at 30 ℃ and 200r/min until the seed liquid culture medium is light pink, requiring 48h, inoculating the monascus purpureus seed liquid into 50mL of liquid fermentation culture medium for culturing at 10% of the inoculation amount, culturing at 30 ℃ and 150r/min for 48h, and then changing the temperature to 25 ℃ to continue culturing until the 15 th d.

Respectively collecting 2d fermentation broth, 5d fermentation broth, 8d fermentation broth, 12d fermentation broth and 15d fermentation broth of Monascus purpureus, placing in a 2mL centrifuge tube, centrifuging at 12000r/min for 10min, removing supernatant, re-suspending with sterilized ultrapure water, repeating for three to four times, removing residual water as much as possible in the last step, and storing in a refrigerator at-80 deg.C.

(II) extraction of total RNA of monascus

The method comprises the following specific steps:

1. adding 475 mul SL and 25 mul beta-mercaptoethanol into a 2mL centrifuge tube, taking 2 tubes of monascus thallus stored in a refrigerator at the temperature of-80 ℃, quickly freezing the monascus thallus in a sterilized mortar by using liquid nitrogen, quickly grinding the monascus thallus into powder, taking the powder into the 2mL centrifuge tube filled with SL solution, immediately and uniformly mixing the powder by vortex oscillation, and centrifuging the powder at 12000rpm for 2 min;

2. sucking 500 mu L of supernatant into a filter column CS, centrifuging, and taking 400 mu L of filtrate into an empty centrifuge tube;

3. adding 160 μ L of anhydrous ethanol, transferring the mixture to adsorption column CR3, centrifuging at 12000rpm for 15sec, and discarding the filtrate;

4. adding 350 μ L deproteinizing solution RW1 into adsorption column CR3, centrifuging at 12000rpm for 15sec, and discarding the filtrate;

5. preparing DNase I working solution: adding 140 μ LRDD solution into 20 μ LDNase I, sucking, mixing, adding 80 μ L of the mixed solution into the center of adsorption column CR3, and standing for 15 min;

6. adding 350 μ L deproteinized solution RW1 into adsorption column CR3, centrifuging, and removing filtrate;

7. adding 500 μ L of rinsing solution RW into the adsorption column CR3, centrifuging, and discarding the filtrate;

8. repeating the step 7 once;

9. centrifuging for 2min, placing adsorption column CR3 in an empty centrifuge tube, and collecting 35 μ L of RNase-Free ddH₂Adding O to the center of the CR3 adsorption column membrane, standing for 2min, and centrifuging at 12000rpm for 1min to obtain filtrate as the extracted RNA;

(III) RNA quality detection

1. The RNA concentration detection is carried out by using a nucleic acid quantifier, and the method comprises the following specific steps: sampling 1 mu L of RNA into a detection hole to obtain the concentration of the RNA;

2. the integrity of RNA is detected by electrophoresis, and the method comprises the following specific steps:

(1) spotting 1 mu L of 10X Loading Buffer sample Buffer solution on the sealing film, sucking 3 mu LRNA samples to mix with the Buffer solution, sucking, beating and uniformly mixing, and spotting;

(2) the voltage of the electrophoresis apparatus is 150V, and the time is 15 min; detecting RNA integrity by gel imager;

(IV) reverse transcription of cDNA

(1) The mixture was prepared according to the removal system of the following table, centrifuged for 3sec, and then reacted in a PCR instrument under reaction conditions: at 42 ℃ for 3 min; taking out and placing on ice for later use;

TABLE gDNA removal reaction System

(2) Preparing a mixed solution according to the system shown in the table below, sucking, beating and uniformly mixing for later use;

reverse transcription reaction system

(3) Taking 10 mu L of the mixed solution prepared in the step (2), adding the mixed solution into the reaction system in the step (1), and centrifuging for a short time;

(4) incubating at 42 deg.C for 15min, and then incubating at 95 deg.C for 3min to obtain cDNA solution, and storing at-20 deg.C;

(V) primer design

Designing a primer according to a monascus comp50904_ c0 gene sequence; the primers and sequences are as follows:

(VI) construction of overexpression vector

Selecting two single enzyme cutting sites on two overexpression vectors which are pBC-hygro, and connecting the amplified comp51725_ c0 target genes by double enzyme cutting to construct an overexpression plasmid pBC-hygro-comp51725_ c 0;

(1) amplification of comp51725_ c4 Gene

Designing PCR primers according to a comp51725_ c0 gene sequence obtained by monascus transcriptome, and amplifying a comp51725_ c0 gene by using cDNA of purple monascus as a template; the PCR reaction system and the PCR reaction conditions of the comp51725_ c0 gene are as follows:

PCR reaction system of comp51725_ c0 gene

PCR reaction system Volume (μ L) PrimeSTAR Max Premix(2X) 12.5 comp51725_c0-F 1 comp51725_c0-R 1 cDNA 1 ddH₂O 9.5 Total volume 25

The PCR reaction conditions were as follows:

1)95℃for 5min；

2)94℃for 30sec；

3)55℃for 30sec；

4)72℃for 10sec；

5)GOTO2，30more times；

6)72℃for 10min；

7)4℃，forever；

(2) purification and recovery of PCR product

The method comprises the following specific steps:

1. adding 500 mul DB into each 100 mul PCR system, and fully and uniformly mixing; (if the system is less than 100 μ L, the amount of the solution can be made up to 100 μ L by double distilled water);

2. transferring the solution obtained in the step into an adsorption column AC, standing at room temperature for 1min, centrifuging at 12,000rpm for 30-60sec, and discarding the filtrate;

3. adding 700 mul of rinsing liquid WB, centrifuging at 12,000rpm for 1min, and discarding the waste liquid;

4. adding 500 μ L of rinsing liquid WB, centrifuging at 12,000rpm for 1min, and discarding the waste liquid;

5. centrifuging the empty column for 2 min;

6. placing the adsorption column AC in a new centrifuge tube, adding 40 μ L of elution buffer EB heated in water bath at 65 deg.C in advance into the center of the adsorption membrane, standing at room temperature for 2min, and centrifuging at 12,000rpm for 1 min;

(3) double digestion of the PCR product of comp51725_ c0 gene and pBC-Hygro plasmid

Double enzyme digestion system

The enzyme digestion reaction conditions are as follows: at 37 ℃ for 2 h; purifying and recovering the enzyme digestion product;

(4) ligation of PCR product of comp51725_ c0 gene with pBC-Hygro plasmid

The method comprises the following steps:

1. preparing the comp51725_ c0 fragment and the pBC-Hygro plasmid into 4.5 mu L of solution according to the ratio of 3:1, placing the solution in a water bath at 65 ℃ for 2-3min, and then placing the solution on ice for later use;

2. adding 4.5 mu LSolutionI into the mixed solution, and reacting for 30min at 16 ℃;

3. adding 1 mu of LSolutionII into the reaction solution, and storing in a refrigerator at the temperature of-20 ℃;

(5) transformation of recombinant plasmids

1. Gently pumping 5 μ L of the ligation product into 50 μ L of competent cells, gently flicking with hand, mixing, and ice-cooling for 30 min;

heat shock in water bath at 2.42 deg.C for 90sec, and immediately cooling on ice for 5 min;

3. adding 1mL LB liquid culture medium, shaking at 200rpm and 37 deg.C, culturing for 60min to recover thallus;

4. appropriately concentrating the cultured bacterial liquid, coating 200 mu L of the bacterial liquid on an LB solid culture medium containing 34 mu g/mL chloramphenicol, carrying out inverted culture at 37 ℃ for 12-16h, selecting a single colony, inoculating the single colony in an LB liquid culture medium, carrying out shake culture at 200rpm at 37 ℃ for 14h, and extracting recombinant plasmids;

(6) recombinant plasmid validation

1. And (3) electrophoresis detection: taking 5 mu L of recombinant plasmid to carry out electrophoresis detection on 1% agarose gel;

2. and (3) double enzyme digestion verification: performing double enzyme digestion verification on the recombinant plasmid with the size of the band conforming to the expected size by using QuickCutXbaI and QuickCutClaI; if the enzyme digestion product after double enzyme digestion has two strips, and the sizes of the strips are respectively consistent with the sizes of the fragments obtained after plasmid enzyme digestion and target fragment gene enzyme digestion, the success of the construction of the recombinant plasmid is proved;

(VII) overexpression plasmid transformation

(1) Preparation of monascus protoplast

1. Inoculating monascus M1 on 4 PDA plate culture media, and culturing in a constant temperature incubator at 30 ℃ for 4 d;

2. adding 10mL of sterile water on each plate, and scraping the surfaces of the thalli by using an inoculating loop to release spores to prepare spore suspension;

3. coating 200 μ L spore suspension on sterilized and oven-dried PDA plate, coating to dryness, and culturing at 30 deg.C for 30-40 hr;

4. the pale pink mycelium from the glassine paper was scraped with an inoculating loop and placed on a mira cloth monolayer with 50mL MgSO₄Filtering and washing the solution;

5. transferring the mycelium into 50mL of lyase liquid subjected to filtration sterilization, carrying out enzymolysis for 2.5-3h at 30 ℃ and 60rpm, and then carrying out single-layer filtration by mira cloth;

6. centrifuging the filtrate at 4 deg.C and 7000rpm for 5min, and removing the supernatant;

7. then filtering for 2 times by using 1.2mol/L sorbitol solution (centrifuging, removing supernatant), adding the sorbitol solution to resuspend the protoplast, and placing on ice for later use;

(2) monascus hygromycin tolerant concentration screening

100 μ L of monascus M1 competent cell suspension was pipetted and plated on PDA plates at a gradient of hygromycin B: 0. 5, 10, 15, 20, 25 μ g/mL, incubated at 30 ℃ to determine the optimal inhibitory concentration of hygromycin B on the growth of M1;

(3) electroporation transformation of protoplasts

1. Centrifuging the protoplast suspended in sorbitol solution at 7000rpm for 5min, sucking the supernatant as completely as possible, adding 1mL of electric shock conversion solution, sucking, beating, mixing, and centrifuging to remove the supernatant; adding 220 μ L of electric shock conversion solution, sucking, beating and mixing;

2. taking two sterilized new 1.5mL centrifuge tubes, adding 70 μ L of electric shock transformed cells respectively, adding 1 μ g plasmid into one tube, sucking, beating, mixing, and ice-cooling for 15 min;

3. transferring all the solution in the centrifuge tube in the previous step into a precooled electric shock conversion cup, immediately adding 900 mu L of precooled resuscitation liquid culture medium after electric shock, sucking, pumping and uniformly mixing;

4. transferring the liquid in the electric shock transformation cup into a 1.5mL sterile centrifuge tube, and carrying out ice bath for 10 min;

5. placing the centrifuge tube into an empty culture dish, and culturing for 2h at 30 ℃ and 100 rpm;

6. spreading 100 μ L on PDA plate, and culturing at 30 deg.C for 6-7 d.