CN106967663B

CN106967663B - Recombinant strain for preventing and treating crop diseases

Info

Publication number: CN106967663B
Application number: CN201710314232.8A
Authority: CN
Inventors: 王岩; 张晓华; 李慧
Original assignee: Ocean University of China
Current assignee: Ocean University of China
Priority date: 2017-05-06
Filing date: 2017-05-06
Publication date: 2020-08-14
Anticipated expiration: 2037-05-06
Also published as: CN106967663A

Abstract

The invention provides a recombinant strain for preventing and treating crop diseases, which is prepared into a biological agent with modified quorum sensing quenching protein MomL to prevent and treat a series of plant disease bacteria. The invention firstly provides a recombinant lysobacter enzymogenes, which carries a recombinant vector for recombining and expressing a quorum sensing quencher MomL gene, wherein the nucleotide sequence of a promoter of the recombinant vector is SEQ ID NO. 1; the modified quorum sensing quencher enzyme MomL41 has the amino acid sequence of SEQ ID NO. 4. The invention utilizes the constructed lysobacter enzymogenes of the recombinant expression quorum sensing quenching protein MomL and the reconstructed quorum sensing quenching protein MomL41 to prepare the plant disease control product, improves the inhibition effect on pathogenic bacteria of the plant bacterial soft rot, and is applied to the control of the plant bacterial soft rot.

Description

Recombinant strain for preventing and treating crop diseases

Technical Field

The invention belongs to the technical field of plant disease control, and particularly relates to a recombinant strain for controlling crop diseases.

Background introduction

Phytopathogens exist in different growth stages of various economic crops, and the pathogenicity of the phytopathogens seriously influences the growth and economic benefit of the crops. At present, the problem is mainly solved by using antibiotics to improve the disease resistance of crops. However, the use of antibiotics induces the emergence of resistant bacteria (Defoirdt et al.2011). And the drug remains in the plant body and causes environmental pollution. Novel environment-friendly disease control strategies require intensive research and wide application.

MomL is a quorum-sensing quenching enzyme belonging to the family of metallo-beta-lactamases. MomL has obvious pathogenic factor inhibiting and disease preventing capabilities, and can be used as a bio-control protein for modification and utilization. However, under normal culture conditions, the transcription expression level of the quorum sensing quenching enzyme is not high, which affects the wide application of the beneficial bacterial strains as biocontrol bacteria, so that the quorum sensing quenching enzyme is heterologously expressed in the beneficial bacteria, and the improvement of the expression level of the quorum sensing quenching enzyme of the beneficial bacteria becomes very important.

Lysobacter enzymogenes widely exists in soil and water environment, can secrete a series of extracellular enzymes and secondary metabolites with the activity of resisting plant fungi pathogenic bacteria, and is the most gram-negative bacterium with biological control potential in the lysobacter. In recent years, lysobacter enzymogenes has been widely used as a novel biological control agent for controlling crop diseases caused by fungi (Borasr et al 1993; Folman et al 2003); relatively, there are few reports of control of bacterial diseases in plants and no quorum-sensing quenching activity. In order to enlarge the prevention and control range of the lysobacter enzymogenes on the plant pathogenic bacteria, the lysobacter enzymogenes engineering strain with broader spectrum of bacteriostatic activity can be constructed by heterogeneously expressing the bacteriostatic protein MomL in the lysobacter enzymogenes engineering strain for preventing and controlling the plant bacterial diseases.

Disclosure of Invention

The invention aims to provide a recombinant strain for preventing and treating crop diseases, which is prepared into a biological agent with modified quorum sensing quenching protein MomL to prevent and treat a series of plant disease bacteria.

The invention firstly provides a recombinant lysobacter enzymogenes, which carries a recombinant vector for recombining and expressing a quorum sensing quencher MomL gene, wherein the nucleotide sequence of a promoter of the recombinant vector is SEQ ID NO. 1;

the quorum sensing quencher enzyme MomL has an amino acid sequence of SEQ ID NO. 2;

a gene for coding quorum sensing quencher enzyme MomL, and the nucleotide sequence of the gene is SEQ ID NO. 3;

the recombinant zymogenic lysobacter enzymogenes is used for preventing and treating plant diseases and preparing biological products for preventing and treating the plant diseases;

in another aspect, the invention provides a biological product for preventing and treating plant diseases, which comprises the recombinant lysobacter enzymogenes and the modified quorum sensing quencher MomL;

the modified quorum sensing quencher enzyme MomL41 has an amino acid sequence of SEQ ID NO. 4;

the nucleotide sequence of the gene for coding the modified quorum sensing quencher enzyme MomL41 is SEQ ID NO. 5.

The invention utilizes the constructed lysobacter enzymogenes of the recombinant expression quorum sensing quenching protein MomL and the reconstructed quorum sensing quenching protein MomL41 to prepare the plant disease control product, improves the inhibition effect on pathogenic bacteria of the plant bacterial soft rot, and is applied to the control of the plant bacterial soft rot.

Drawings

FIG. 1: the inhibition effect of MomL41 on Pcc pathogenic factor pectinase,

FIG. 2: the recombinant expression strain and Pcc are co-cultured to inhibit the expression of Pcc pectinase,

FIG. 3: analysis of the transcriptional influence of MomL41 on genes involved in pectinase production,

FIG. 4: ketoreductase Gene fragments and P_groELThe result of the double enzyme digestion gel electrophoresis detection is shown,

FIG. 5: a comparison graph of colony colors of LeMomL strain and wild strain,

FIG. 6: the degradation effect of the LeMomL strain on C6-SHL is shown,

FIG. 7: graph of the effect of the LeMomL strain on the survival rate of Pcc,

FIG. 8: the effect of LeMomL strain on inhibiting soft rot of Chinese cabbage caused by Pcc is shown.

Detailed Description

The stability of the MomL protein needs to be improved, and the enzyme activity is reduced quickly after the MomL protein is placed at room temperature for a period of time, so that the subsequent development and the wide application of the MomL protein are influenced. Thus, the applicants have engineered the MomL protein. The modified MomL protein has better stability.

The process of the present invention is further illustrated below with reference to examples. However, the examples are illustrative only and not limited thereto

Example 1: method for induction quenching of enzyme MomL in lysobacter enzymogenes through heterogenous expression population

Research shows that the exogenous quorum sensing quencher enzyme gene momL has the problem of low expression efficiency in terrestrial bacterium lysobacter enzymogenes. In order to solve the problem, the applicant analyzes the sequence groups of the genome of terrestrial bacterium lysobacter enzymogenes OH11 and the momL gene, and finally finds P with the nucleotide sequence of SEQ ID NO. 1_groELThe promoter enables the momL gene to have high expression capability and stability in lysobacter enzymogenes.

As can be seen from the whole Genome sequencing and gene annotation result of lysobacter enzymogenes OH11, the gene groEL and groES in the Genome are reversely co-transcribed, so that the promoter of the gene groEL is presumed to be positioned at the upstream of the coding region of the gene groES, the promoter is predicted online by Softberry and Berkeley Drosophila Genome Project (BDGP) to obtain a related sequence, wherein the SED ID NO of the promoter is KY863517, and the promoter sequence is as follows: CGATGCCTTTGTGCCAGATCGCCAGACCGGACCGAAAGGCGTCGGGCCTGAAAGCCCTCCCACTAGAGCCCCCAGGGTGAAGAGCCCTCCCACAACAGCTCCGGGGTCCGCGGGCTCTCCCAGCGCCGCCGGCCGGCCCCGCGGACCGACCGCTGTCACCGTTCCGATGCAGGATTCGTCGCGGCCCCCCTTGAAAGCCGTCCGAGGCGCCCTATCTCCGAACCAGTCCCGGCTTGCCGGGCGCTTTCGTCCCCGGCATTGGCACTCGCCGGGTGCGACTGCTAAAATTCCCGTTCTTTATCCACCAATTCAATTACTTACAGAGGTCGCC (SEQ ID NO: 1).

Lysobacter enzymogenes is widely used as a new biological control agent for controlling crop diseases caused by fungi; but without quorum-sensing quenched bacteriostatic activity. The engineering strain expands the control range of lysobacter enzymogenes on plant pathogenic bacteria, has broader-spectrum bacteriostatic activity, and can be used for controlling various plant bacterial diseases.

Example 2: construction of lysobacter enzymogenes overexpression vector pEX 18-W.

Selecting a key gene ketoreductase synthetic gene in a yellow pigment synthetic gene cluster in lysobacter enzymogenes as an integration site of a recombinant vector, and designing an upper Primer and a lower Primer of a gene fragment by using a software Primer Premier5 to respectively carry EcoRI and Kpn I restriction enzyme cutting sites, up: 5'-CGGAATTCTCCAGGGCGTGGTCAACA-3', respectively; down: 5'-GGGGTACCTCTGCTTGATCGCCTCCG-3', the target fragment was amplified using Prime STAR GxL DNA amplificase. The obtained amplification product and an over-expression vector pEX18 are subjected to EcoR I and Kpn I restriction enzyme digestion simultaneously, the amplification product after double enzyme digestion and the vector pEX18 after double enzyme digestion are placed at 16 ℃ for overnight connection, and finally the over-expression vector pEX18-W for producing lysobacter enzymogenes is constructed. The target gene in the overexpression vector pEX18-W is detected by using a double enzyme digestion detection method, and the size and the length of the target gene are shown to be consistent by a gel electrophoresis result. The results of gel electrophoresis are shown in FIG. 4.

Example 3: construction of lysobacter enzymogenes overexpression vector pEX 18-W-P.

The reported lysobacter enzymogenes native promoter is used for momL heterologous expression, and stable and efficient expression of protein cannot be achieved. Screening the promoter P by using prophase transcriptomics data_groEL. Comparing it with reported original promoter, finding P_groELA stable high expression of momL could be achieved (table 1). The specific method comprises the following steps: selecting a promoter at the front end of the original groEL gene of lysobacter enzymogenes as a promoter closely connected with the front end of an exogenous gene, designing an upper Primer and a lower Primer respectively with Kpn I restriction enzyme cutting sites and BamH I restriction enzyme cutting sites by using software Primer Premier5,

up：5’-GGGGTACCCGATGCCTTTGTGCCAG-3’；

down: 5'-CGGGATCCGGCGACCTCTGTAAGTAATTG-3', promoter fragment amplification was performed using Prime STAR DNA Amplifier enzyme. The obtained amplification product and an overexpression vector pEX18-W are subjected to Kpn I and BamH I restriction enzyme digestion simultaneously, and the double-restriction enzyme digested amplification product and the double-restriction enzyme digested vector pEX18-W are connected overnight at the temperature of 16 ℃ to construct an overexpression vector pEX 18-W-P. The ligation products were transferred to E.coli S17-1 competent cells by heat shock transformation at 42 ℃ and positive single clones were selected by LB plates supplemented with 25. mu.g/mL Gen. And detecting the target gene of the positive clone by using a double enzyme digestion detection method, wherein the size of the target gene is shown to be consistent with the length of the promoter fragment by using a gel electrophoresis result. The results of gel electrophoresis are shown in FIG. 4.

Example 4: construction of lysobacter enzymogenes overexpression vector pEX 18-W-P-momL.

Extracting oil-resistant triticum basilicum Th120 genome by using an atmosphere chloroform method as a template, designing upper and lower primers which respectively have BamH I and Xba I enzyme cutting sites and correspond to a momL gene by using software Primer Premier5, up: 5'-CGGGATCCAAAAAGGAAGCTGCAGAATCG-3', down: 5'-GCTCTAGATTGTAAATAGTTGGGTGCCTGG-3', PCR amplification was performed using Prime STAR DNA amplification enzyme. Subsequently, the purified amplification product and lysobacter enzymogenes overexpression vector pEX18-W-P are subjected to double enzyme digestion by using two restriction enzymes of BamH I and Xba I, and the target fragment with the sticky end and the linear vector are connected at 16 ℃ overnight to obtain the lysobacter enzymogenes overexpression vector pEX 18-W-P-momL.

Example 5: and (5) constructing an engineering strain LeMomL.

The ligation product obtained in example 2 was transferred to E.coli S17-1 competent cells by the method of transformation with a heat shock at 42 ℃ and positive monoclonals were selected by LB plate to which Gen 25. mu.g/mL was added to obtain the donor strain S17-1-pEX18-W-P-momL and cultured in LB medium containing Gen 25. mu.g/mL. Meanwhile, the recipient strain lysobacter enzymogenes is monoclonally inoculated in 1/10TSB culture medium containing 50 mu g/mL Kan for culture, when the OD values of the two bacterial liquids reach about 0.7, the bacteria are centrifuged at 13200rpm for 2 minutes, the bacteria are re-suspended by 100 mu L of LB culture medium after the supernatant is discarded, mixing zymogenic bacillus lytic suspension with S17-1-pEX 18-W-P-molmL bacterial suspension, culturing at 30 ℃ for 4 hours, coating the bacterial solution on an LB plate containing 100 mu g/mL Gen and 25 mu g/mL Kan, culturing the plate in an incubator at 30 ℃ for 2-4 days, after single bacteria grow out, selecting enough single clones to perform plate streaking, and finally obtaining a white recombinant strain LeMomL by taking the yellow-white color change as a screening marker, wherein the yellow-white color change of the colony is shown in the attached figure 5.

Example 6: promoter P_groELDetection of expression efficiency

For detecting promoter P_groELLevel of expression efficiency, the present invention relates to P_groELThe level of promoting transcription of gene momL and the promoter P with the strongest expression in the reported zymogen indigenous promoter_HSAFThe reported high expression promoter P_clpAnd another promoter P to be detected_qsecA comparison is made. The specific implementation method is to use a promoter P in an overexpression vector pEX18-W-P-momL_groELThe gene fragment sequences of (a) are respectively expressed by a promoter P_HSAF、P_clpAnd P_qsecThe over-expression vectors with different promoters are integrated into the genome of lysobacter enzymogenes OH11 through combined transformation respectively, target transformants are screened out through a yellow-white color screening method, the transcription levels of the recombinant lysobacter enzymogenes strains at different time points momL are detected by a real-time fluorescent quantitative PCR method, and the experimental results are shown in Table 1. P compared to other promoters tested_groELThe gene momL has been stimulated to transcribe at 12 hours, and the expression level is much higher than other promoters; at 60 hours, promoter P_groELStill maintain relatively high transcription initiation level, and at this time, promoter P_clpAnd P_qsecThe promoter gene has undetectable transcription level, and is therefore compared to other promoters P_groELHas higher expression efficiency, and is the promoter with the best effect of starting the expression of the exogenous gene.

Table 1: promoter expression efficiency Table

Example 7: detection of QQ enzyme activity of LeMomL engineering bacteria

QQ enzyme activity was detected by a plate method using a chromobacterium violaceum mutant strain CV026 as a reporter strain. Firstly, wild lysobacter enzymogenes, a recombinant strain LeMomL and a reporter strain CV026 are inoculated in an LB culture medium respectively for activation. And then inoculating 1mL of activated CV026 bacterial solution into 15mL of LB semisolid culture medium, uniformly mixing, pouring into an empty plate, and punching after the culture medium is solidified. Meanwhile, the diluted C6-SHL was added to a liquid medium containing lysobacter enzymogenes and LeMomL strain and reacted for 3 hours. Finally, 40 mul of lysobacter enzymogenes and LeMomL strain liquid are added into the holes, C6-SHL diluted in equal quantity is used as a control, the flat plate is placed at 28 ℃ for culturing for 24 hours, the degradation condition of the LeMomL strain to C6-SHL, which is inferred from the diameter of the purple pigment circle, is observed, and in addition, the invention carries out related experiments on the relation between the diameter of the purple pigment circle and the concentration of C6-SHL. The experimental results are shown in table 2 and fig. 6, which shows that the QQ enzyme MomL generated by the recombinant strain LeMomL can degrade the signal molecule C6-SHL, and the CV026 around the experimental sample has less content of the signal molecule C6-SHL which generates purple pigment due to deletion induction, so that the purple pigment ring generated around the experimental sample is smaller than that of wild strain lysobacter enzymogenes and the control group.

TABLE 2C 6-SHL concentration and pigment Ring size

Example 8: effect of LeMomL strain on survival of pectobacterium carotovorum subspecies (p. carotovorum subsp. carotovorum, Pcc).

Respectively inoculating wild lysobacter enzymogenes and LeMomL strain to LB culture medium for culture, and respectively culturing in logarithmic mode according to the ratio of 10:1 when the bacteria liquid reaches the same OD value (0.8-1.0)Long-term Pcc co-culture, using Pcc single-strain culture as control, shaking-culturing at 28 deg.C for 6 hr, diluting the bacterial liquid of experimental group and control group by 10⁵And (4) plating, placing the plate at 28 ℃ for culturing for 24 hours, checking the number of Pcc single colonies on the plate, calculating the survival rate of Pcc in the experimental group and the control group, and comparing the survival rate and the survival rate. The experimental results show that Pcc co-cultured with lysobacter enzymogenes and LeMomL strains showed that the survival rate of Pcc was reduced, but the latter decreased more significantly, as shown in FIG. 7.

Example 9: the LeMomL strain has the inhibition effect on Pcc expression of pathogenic factors.

Pcc is the main pathogenic bacteria of bacterial soft rot of plants, among which, the extracellular hydrolases are the most important pathogenic factors, including pectinase, protease and cellulase, etc., and pectinase is the most important pathogenic factor of the extracellular hydrolases, and this example takes pectinase as an example for illustration. Wild lysobacter enzymogenes and LeMomL strains are respectively inoculated in LB culture medium for culture, when the bacteria liquid reaches the same OD value (0.8-1.0), the bacteria liquid is respectively co-cultured with Pcc in logarithmic growth phase according to the proportion of 10:1, Pcc single bacteria culture is used as a control, and after shaking culture is carried out for 6 hours at 28 ℃, Pcc single colonies in the experimental group and the control group are counted according to the method of example 5. Meanwhile, 13000 Xg of the cultured bacterial solution is centrifuged for 10min at 4 ℃, and the supernatant is filtered and sterilized by a filter membrane with the aperture of 0.22 mu m to obtain a crude enzyme solution for the detection of the pectinase by a DNS method. 0.2g of polygalacturonic acid and 0.41g of anhydrous sodium acetate are dissolved in 100mL of deionized water to prepare a polygalacturonic acid solution, and the pH value is adjusted to 5.2 for later use. Adding 50 μ L of the crude enzyme solution into 450 μ L of polygalacturonic acid solution, mixing, reacting in water bath at 25 deg.C for 20min, taking out the reactant immediately after the reaction is finished, and cooling in crushed ice to terminate the reaction. In a 500. mu.L reaction system, 500. mu.L of DNS reagent was added, boiled for 5min for color development, cooled to room temperature, and centrifuged at 10,000rpm for 1 minute at 4 ℃ to remove insoluble matter. The samples were diluted three times to 3mL and the OD540 values of the experimental and control groups, respectively, were determined and the relative pectinase activity was expressed as the ratio of the number of OD540 to Pcc colonies.

Example 10: effect of LeMomL Strain on the infectivity of Pcc plants

Pcc can infect various hosts, including vegetables of Brassicaceae, Solanaceae, Leguminosae, Cucurbitaceae, etc., and cause economic crop loss. In this example, Pcc infected cabbage was used as an example to study the effect of LeMomL strain on the infectivity of Pcc plants. Firstly, respectively inoculating lysobacter enzymogenes and LeMomL strains to an LB culture medium for culture, and diluting the strain liquid when the strain liquid reaches the same OD value (0.8-1.0) so that the bacterial population is 10⁸cfu mL^-1. Meanwhile, Pcc was inoculated in LB medium for culture, and when the logarithmic phase was reached, the bacterial solution was diluted so that the bacterial population became 10⁶cfu mL^-1. Respectively mixing the diluted wild lysobacter enzymogenes and LeMomL strain liquid with the diluted Pcc strain liquid according to the ratio of 1:1 for later use. Then, selecting the same cabbage with similar shape, size and growth and development conditions, cleaning, naturally drying in an ultra-clean workbench, and spraying 70% ethanol for sterilization. After the ethanol is completely volatilized, a 1cm wound is cut at the center of the leaf by using a sterile blade, 10 mu L of mixed bacteria liquid is injected into the wound, and Pcc single bacteria culture liquid is used as a control. And finally, wetting the sterile filter paper sheet with 10mL of sterile water, placing the wetted sterile filter paper sheet and the leaves of the Chinese cabbage which are inoculated with the pathogenic bacteria into a freshness protection package for sealing, culturing at 28 ℃ for 48 hours, and observing the infection condition of the leaves of the Chinese cabbage. As shown in the attached figure 8, Pcc infects the leaf of Chinese cabbage after being co-cultured with lysobacter enzymogenes and LeMomL strain, the infectivity of Pcc is reduced, but the infectivity is obviously reduced compared with the former when co-cultured with the latter.

Example 11: construction of E.coli expression vector pET24a (+) -MomL41

The stability of the MomL protein needs to be improved, and the enzyme activity is reduced quickly after the MomL protein is placed at room temperature for a period of time, so that the subsequent development and the wide application of the MomL protein are influenced. Therefore, the applicants have modified the MomL protein (amino acid sequence SEQ ID NO:2, nucleotide sequence of the coding gene SEQ ID NO: 3). Specifically, the N end of the MomL protein is cut off, and the amino acid sequence of the modified MomL protein has better stability; the modified protein is named as MomL41, the amino acid sequence of the modified protein is SEQ ID NO. 4, and the nucleotide sequence of the coding gene is SEQ ID NO. 5.

The expression vector pET24a (+) was double-digested with EcoRI and XholI, and the digestion system (20. mu.l) was as follows:

reaction system 1: ddH₂Mu.l of O8, 8 mu.l of pET24a (+) plasmid DNA, 8 mu.l of EcoRI1 mu.l of XholI1 mu.l and 2 mu.l of 10 × HBuffer, carrying out PCR amplification on the target fragment, carrying out enzyme digestion on the upstream primer 5'-CGGAATTCAAGCTCTATGCTTTTAGC-3' and the downstream primer 5'-CCCTCGAGTTGTAAATAGTTGGGTG-3' by using the same two enzymes, carrying out enzyme digestion at 37 ℃ for 30min, respectively recovering two target fragments after electrophoresis, and connecting the two target fragments by using a DNA Ligation Kit in a connection system (10 mu.l) of Solutioni5 mu.l, 1.5 mu.l of DNA fragment, 1.1 mu.l of pET24a (+) vector, and ddH₂O2.4. mu.l. The Escherichia coli expression vector pET24a (+) -MomL41 can be obtained after 16-hour connection at 16 ℃ and is used for transforming Escherichia coli BL21(DE 3). The solubility of the MomL41 protein is very high, the proportion of soluble protein reaches more than 90% after ultrasonic disruption, compared with the wild-type protein MomL, the stability of the modified MomL41 is improved, and the protein activity is 2 times that of the wild-type protein after the modified MomL41 is placed for 3 days.

Example 12: inhibition effect of MomL41 protein on pectase of carrot pectobacterium carotovorum subspecies pathogenic factor

Pectobacterium carotovorum subsp. carotovorum Pcc is the main pathogenic bacterium of bacterial soft rot of plants, and pectinase is the most important pathogenic factor in extracellular hydrolases. In this example, MomL41, a purified recombinant protein, was added to Pcc bacteria solution, and the inhibition of pectinase expression in Pcc by MomL41 was examined.

Inoculating activated Pcc to 5ml of LB liquid culture medium according to the inoculation amount of 1%, adding 10 mul of purified recombinant protein MomL41, culturing at 28 ℃ for 12-16h, centrifuging at 4 ℃ for 10min, taking supernatant, filtering and sterilizing by using a filter membrane with the aperture of 0.22 mu m to obtain crude enzyme liquid for detection by a DNS method, adding 0.004g of polyuronic acid to 4ml, preparing 1mg/ml of polygalacturonic acid solution in acetic acid-sodium acetate buffer solution with the pH of 4.8, preheating at 48 ℃ for 5min, adding 2ml of polygalacturonic acid solution to 1ml of crude enzyme solution, shaking uniformly immediately, and accurately reacting in a water bath at 48 ℃ for 30miAnd n, simultaneously adding 1ml of the crude enzyme solution into the control group, immediately putting into boiling water to boil for 10min, cooling, and adding 2ml of polygalacturonic acid solution. After the reaction, 2ml DNS was added into the tube, boiled in boiling water bath for 5min to develop color, rapidly cooled in ice water bath, and OD was measured₅₄₀. Relative pectinase Activity as OD₅₄₀And OD₆₀₀The ratios of (a) to (b) indicate that three replicates were arranged for each experimental group. The experimental result is shown in figure 1, after adding the protein MomL41, the relative pectinase activity of Pcc is obviously reduced compared with that of the control group.

Example 13: inhibition of Pcc pectinase expression by co-culture of recombinant expression strain and Pcc

Inoculating Escherichia coli containing pET24-MomL41 into LB medium containing Kana (5. mu.g/ml), and culturing at 28 deg.C for 12-16 h; meanwhile, Pcc was inoculated into LB medium and cultured at 28 ℃ for 12-16 h. The cultured pET24-MomL41 and Pcc bacterial liquids were diluted to bacterial liquid concentration ratios of 1:1, 1:10 and 1:100 respectively with LB medium, and inoculated into LB medium with IPTG (0.5mM) for co-culture. After incubation at 28 ℃ for 12-16h, pectinase was assayed as described in example 1. The effect of MomL41 on pectinase expression during co-culture is shown in the attached figure 2, and two bacterial liquid concentration ratios are arranged in parallel from top to bottom in pET24-MomL 41: pcc the concentration ratio is 1:1, 1:10 and 1:100, the expression level of pectinase is reduced along with the increase of the concentration ratio of the bacteria liquid, the reducing galacturonic acid generated by pectinase hydrolysis is reduced, and the color reaction is less obvious.

Example 14: RT-PCR relative quantitative method for detecting influence of MomL41 on pectinase expression level

Pcc RNA was extracted. After Pcc was induced by 10 μ l of purified recombinant protein MomL41, RNA extraction was performed at the time of growth to logarithmic growth phase, while RNA extraction was performed in the same manner as for the control group without addition of protein MomL41, and E.Z.N.A. @ Bacterial RNA Kit was used for laboratory Bacterial RNA extraction. 1.5ml of the bacterial suspension was centrifuged at 5000 Xg for 5-10min at 4 ℃ in a 2ml Eppendorf tube. The supernatant was discarded, 100. mu.l of lysozyme was added to the precipitate, vortexed for 30s, incubated at 30 ℃ for 10min in a metal bath, and vortexed for 30s every 2 min. After incubation, 350. mu.l of buffer BRK and 25-40mg of glass grinding beads were added to the centrifuge tube and vortexed for 5min, followed by 5min centrifugation in 13000 Xg centrifuge. And (3) taking 400 mu l of the supernatant, adding 400 mu l of 70% ethanol into a new 1.5ml Eppendorf tube, sucking, uniformly mixing, adding into a HiBind RNA micro-column assembled with a 2ml collecting tube, centrifuging for 30-60s at 10000 Xg, and pouring out the liquid in the collecting tube. 300ul of RNA washing buffer I was added, and the mixture was centrifuged at 10000 Xg at room temperature for 30-60s, and the flow-through solution was discarded. Changing a new 2ml collecting pipe, adding 500ul RNA washing buffer solution I into the HiBind RNA microcolumn, centrifuging for 30-60s at 10000 Xg, discarding the flow-through solution, adding 500ul RNA washing buffer solution II, repeating the operation for 2 times, after the last centrifugation, pouring out the liquid in the collecting pipe, putting the empty collecting pipe back into the HiBind RNA microcolumn, and centrifuging for 2min at the room temperature of 1000 Xg. The Hibind RNA mini-column was loaded into a new 1.5Eppendorf tube, 30-50. mu.l DEPC water preheated at 70 ℃ was added to the column, allowed to stand at room temperature for 5min and centrifuged at 10000 Xg for 1 min.

The DNA in the sample RNA was removed before reverse transcription of Pcc RNA, and TaKaRa PrimeScript TM RT reagent kit was used in the DNA removal laboratory (10. mu.l reaction system) 5 × g DNAeraser Buffer 2.0. mu.l, g DNA Eraser 1.0. mu.l, Pcc RNA 5. mu.l, RNase Free H₂02.0 μ l. The reaction conditions are as follows: metal bath is carried out for 10min at 42 ℃, and the reaction product is stored at 4 ℃.

The reverse transcription of Pcc RNA into cDNA was carried out using TaKaRa PrimeScript TM RT reagent Kit the specific reaction system was 10. mu.l of the reaction solution of the previous step, 1.0. mu.l of PrimeScript RT Enzyme Mix I, 1.0. mu.l of RTPrimer Mix, 5 × PrimeScript buffer 24.0. mu.l of RNase Free H (20. mu.l reaction system)₂04.0 μ l. The reaction conditions are as follows: after being subjected to metal bath at 37 ℃ for 15min, the reaction was carried out at 85 ℃ for 5sec, and the reaction product was stored at 4 ℃.

In addition to the cDNA of the sample, a pair of primers used in the Eva Green method is more important in performing Real Time PCR. Pectinase exists in various forms (isozymes), 4 genes related to the pectinase are found out from Pcc genomes, upstream and downstream primer design is carried out by using biological software Primer5.0, and RT-PCR is carried out by using 16s rRNA as a reference gene. The designed 4 pairs of primers are respectively as follows: upstream primer (5'-GAATGCCAAAAACAGCCACAC-3') and downstream primer of Pectate lyase (pel1)(5'-GGATTTCAGCGACATCACCAA-3'), the upstream Primer (5'-AAGCCATCCACACCACACATC-3') and the downstream Primer (5'-GCCAGTTTATCCTTCACGCAC-3') of the platelet lyse 1precursor (pelp1), the upstream Primer (5'-GCAGTATGCCAACAACCAGA-3') and the downstream Primer (5'-GGATAAATAACCTTCCACCA-3') of the platelet digest (pelp2), the upstream Primer (5'-TATCCTGGCGTGCTTCTC-3') and the downstream Primer (5'-TCCTCTTTTCGCATTGTT-3') of the Regulator of the platelet lyse production (pnlr), the RT-PCR with TaKaRaPrimeScript TM RT reagent Kit was performed as follows (10. mu.l reaction system). Eva Green2 × qPCR Master Mix 5. mu.l, Forward Primer (10. mu.M) 0.3. mu.l, Reverse Primer (10. mu.M) 0.3. mu.l, template DNA ≦ 500ng/reaction, nucleic-free H ₂0 make up the reaction to 10. mu.l. The reaction conditions of the amplification curve were: pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 15sec, annealing at 55 ℃ for 30sec, and extension at 72 ℃ for 30sec for 35 cycles. After the reaction data are obtained, C of 4 genes is obtained_TValues relative gene expression analysis was performed by the 2- Δ Δ ct (livak) method. As shown in fig. 3, the variation of 4 genes in the experimental group is 1, and the expression levels of 3 genes in the control group are 2.4, 1.2, and 2.6 times of those of the experimental group except for the reduction of the expression level of the pnlr gene, and it is presumed that the pnlr control mode may be negative control.

Example 15: preparation and application of preparation containing beneficial bacteria LeMomL and bacteriostatic protein MomL41

LeMomL strain was inoculated in LB medium and cultured to make the bacterial solution OD 1.0. Diluting the bacterial liquid by 100 times, mixing 200 microliters of the diluted bacterial liquid with MomL41 protein with different concentrations, co-culturing with Pcc in a logarithmic growth phase, performing shake culture at 28 ℃ for 6 hours by using Pcc single bacterial culture as a control, and diluting the bacterial liquids of the experimental group and the control group by 10⁵After plating and culturing at 28 ℃ for 24 hours, Pcc single colonies on the plate are counted, and the survival rate of Pcc in the experimental group and the control group is calculated and compared for research. The experimental result shows that the mixed preparation of MomL41 protein and LeMomL has obviously enhanced inhibition effect on pathogenic bacteria Pcc, and the most effective proportion is found (Table 3).

Table 3: preparation and action analysis of preparation containing beneficial bacteria and bacteriostatic protein

The result shows that the engineering bacterium LeMomL not only retains the original biocontrol activity of lysobacter enzymogenes, but also has a novel biocontrol function based on quorum sensing quenching activity, and the engineering protein MomL41 is additionally added, so that the composition finally has good broad-spectrum antibacterial activity.

SEQUENCE LISTING

<110> China oceanic university

<120> a recombinant strain for crop disease control

<130>

<160>5

<170>PatentIn version 3.5

<210>1

<211>331

<212>DNA

<213>1

<400>1

cgatgccttt gtgccagatc gccagaccgg accgaaaggc gtcgggcctg aaagccctcc 60

cactagagcc cccagggtga agagccctcc cacaacagct ccggggtccg cgggctctcc 120

cagcgccgcc ggccggcccc gcggaccgac cgctgtcacc gttccgatgc aggattcgtc 180

gcggcccccc ttgaaagccg tccgaggcgc cctatctccg aaccagtccc ggcttgccgg 240

gcgctttcgt ccccggcatt ggcactcgcc gggtgcgact gctaaaattc ccgttcttta 300

tccaccaatt caattactta cagaggtcgc c 331

<210>2

<211>293

<212>PRT

<213>2

<400>2

Met Asn Met Lys Lys Leu Leu Val Leu Leu Leu Val Val Gly Ala Phe

1 5 10 15

Ser Cys Lys Gln Ala Lys Lys Glu Ala Ala Glu Ser Glu Thr Ala Val

20 25 30

Thr Glu Ala Ala Lys Pro Glu Ile Lys Leu Tyr Ala Phe Ser Gly Gly

35 40 45

Thr Val Asn Ala Asn Met Leu Glu Leu Phe Ser Gln Asp Thr Thr Tyr

50 55 60

Thr Gly Gln Ser Lys Glu Phe Ala Asp Ala Phe Tyr Val Ile Val His

65 70 75 80

Pro Lys Gly Thr Leu Met Trp Asp Ala Gly Leu Pro Glu Ser Leu Val

85 90 95

Gly Leu Pro Glu Pro Phe Thr Ser Pro Asp Gly Ala Phe Thr Val Ser

100 105 110

Arg Lys Asp Ser Val Ala Asn Gln Leu Ala Ser Ile Asp Met Thr Val

115 120 125

Asp Asp Ile Asp Phe Ile Ala Leu Ser His Thr His Phe Asp His Ile

130 135 140

Gly His Ala Asn Val Phe Ala Gly Ser Thr Trp Leu Val Gln Glu Lys

145 150 155 160

Glu Tyr Asp Phe Val Thr Ser Glu Asp Asn Gln Lys Ser Asn Pro Asp

165 170 175

Ile Tyr Asn Ser Ile Lys Glu Leu Thr Lys Val Lys Lys Ile Asn Gly

180 185 190

Asp Tyr Asp Val Phe Gly Asp Gly Ser Val Val Met Lys Phe Met Pro

195 200 205

Gly His Thr Pro Gly His Gln Val Leu Tyr Leu Asp Met Val Glu His

210 215 220

Gly Pro Leu Met Leu Ser Gly Asp Met Tyr His Phe Tyr Glu Asn Arg

225 230 235 240

Glu Phe Arg Arg Val Pro Ile Phe Asn Tyr Asp Val Ala Leu Thr Lys

245 250 255

Lys Ser Met Gly Glu Phe Glu Ala Phe Ala Glu Glu Lys Gly Ala Lys

260 265 270

Val Tyr Leu Gln His Ser Lys Glu Asp Phe Glu Lys Leu Pro Gln Ala

275 280 285

Pro Asn Tyr Leu Gln

290

<210>3

<211>882

<212>DNA

<213>3

<400>3

atgaatatga aaaagctact tgtactacta ttggttgttg gcgcattttc atgcaagcag 60

gccaaaaagg aagctgcaga atcggaaaca gcggtgaccg aggcagcaaa acccgagata 120

aagctctatg cttttagcgg aggtaccgta aatgccaata tgttggagct cttttcacag 180

gataccacgt acacgggtca gtccaaggaa tttgccgatg ctttttacgt catcgttcac 240

cccaagggca ctttgatgtg ggatgcaggt cttcccgaaa gcttggtggg tcttccagag 300

ccctttacat cacccgatgg ggcatttacc gtttcccgaa aagattccgt ggccaaccaa 360

ttggcaagta tcgacatgac tgttgatgat attgatttta tcgcattgtc ccatacccat 420

tttgatcata ttggccatgc gaacgtgttt gcagggtcca cgtggttggt acaggaaaag 480

gaatacgact ttgtgacaag cgaggacaac caaaagagca atccggacat ctacaattcc 540

attaaagagc ttaccaaagt gaagaaaatc aatggggatt acgatgtgtt cggggatgga 600

agtgtggtaa tgaaatttat gccaggccat acccctggcc atcaagtgtt gtacttggat 660

atggttgagc acggaccgtt gatgctttct ggggacatgt accattttta cgagaaccgg 720

gagttccgaa gagtgcccat ttttaattac gatgtggccc tcaccaagaa aagtatggga 780

gagtttgaag cttttgccga agaaaaaggg gcaaaagtgt atttgcaaca ctccaaggaa 840

gattttgaaa aactgcccca ggcacccaac tatttacaat aa 882

<210>4

<211>253

<212>PRT

<213>4

<400>4

Lys Leu Tyr Ala Phe Ser Gly Gly Thr Val Asn Ala Asn Met Leu Glu

1 5 10 15

Leu Phe Ser Gln Asp Thr Thr Tyr Thr Gly Gln Ser Lys Glu Phe Ala

20 25 30

Asp Ala Phe Tyr Val Ile Val His Pro Lys Gly Thr Leu Met Trp Asp

35 40 45

Ala Gly Leu Pro Glu Ser Leu Val Gly Leu Pro Glu Pro Phe Thr Ser

50 55 60

Pro Asp Gly Ala Phe Thr Val Ser Arg Lys Asp Ser Val Ala Asn Gln

65 70 75 80

Leu Ala Ser Ile Asp Met Thr Val Asp Asp Ile Asp Phe Ile Ala Leu

85 90 95

Ser His Thr His Phe Asp His Ile Gly His Ala Asn Val Phe Ala Gly

100 105 110

Ser Thr Trp Leu Val Gln Glu Lys Glu Tyr Asp Phe Val Thr Ser Glu

115 120 125

Asp Asn Gln Lys Ser Asn Pro Asp Ile Tyr Asn Ser Ile Lys Glu Leu

130 135 140

Thr Lys Val Lys Lys Ile Asn Gly Asp Tyr Asp Val Phe Gly Asp Gly

145 150 155 160

Ser Val Val Met Lys Phe Met Pro Gly His Thr Pro Gly His Gln Val

165 170 175

Leu Tyr Leu Asp Met Val Glu His Gly Pro Leu Met Leu Ser Gly Asp

180 185 190

Met Tyr His Phe Tyr Glu Asn Arg Glu Phe Arg Arg Val Pro Ile Phe

195 200 205

Asn Tyr Asp Val Ala Leu Thr Lys Lys Ser Met Gly Glu Phe Glu Ala

210 215 220

Phe Ala Glu Glu Lys Gly Ala Lys Val Tyr Leu Gln His Ser Lys Glu

225 230 235 240

Asp Phe Glu Lys Leu Pro Gln Ala Pro Asn Tyr Leu Gln

245 250

<210>5

<211>762

<212>DNA

<213>5

<400>5

aagctctatg cttttagcgg aggtaccgta aatgccaata tgttggagct cttttcacag 60

gataccacgt acacgggtca gtccaaggaa tttgccgatg ctttttacgt catcgttcac 120

cccaagggca ctttgatgtg ggatgcaggt cttcccgaaa gcttggtggg tcttccagag 180

ccctttacat cacccgatgg ggcatttacc gtttcccgaa aagattccgt ggccaaccaa 240

ttggcaagta tcgacatgac tgttgatgat attgatttta tcgcattgtc ccatacccat 300

tttgatcata ttggccatgc gaacgtgttt gcagggtcca cgtggttggt acaggaaaag 360

gaatacgact ttgtgacaag cgaggacaac caaaagagca atccggacat ctacaattcc 420

attaaagagc ttaccaaagt gaagaaaatc aatggggatt acgatgtgtt cggggatgga 480

agtgtggtaa tgaaatttat gccaggccat acccctggcc atcaagtgtt gtacttggat 540

atggttgagc acggaccgtt gatgctttct ggggacatgt accattttta cgagaaccgg 600

gagttccgaa gagtgcccat ttttaattac gatgtggccc tcaccaagaa aagtatggga 660

gagtttgaag cttttgccga agaaaaaggg gcaaaagtgt atttgcaaca ctccaaggaa 720

gattttgaaa aactgcccca ggcacccaac tatttacaat aa 762

Claims

1. A recombinant lysobacter enzymogenes carries a recombinant vector for recombining and expressing a quorum sensing quencher MomL gene, and the nucleotide sequence of a promoter of the recombinant vector is SEQ ID NO. 1.

2. The recombinant lysobacter enzymogenes of claim 1, wherein the quorum sensing quencher enzyme, MomL, has an amino acid sequence of SEQ ID NO. 2.

3. Use of the recombinant lysobacter enzymogenes according to claim 1 for plant disease control and for producing a biological product for plant disease control.