CN118109502A - Expression cloning of peanut transcription factor BHLH143 gene and application thereof - Google Patents

Abstract

The invention discloses expression cloning and application of a peanut transcription factor BHLH143 gene, which belong to the technical field of expression cloning of the BHLH143 gene, wherein the BHLH143 gene cloning is performed by cloning an exon sequence of a full-length coding region sequence of the BHLH143 gene between a promoter ATG and a terminator TAG from a peanut cDNA library by utilizing an in-vitro polymerase chain reaction technology; inserting the coding region sequence of the BHLH143 gene into a vector containing a green fluorescent protein reporter gene to obtain a BHLH143-GFP recombinant vector; the coding region sequence of the BHLH143 gene is 1062bp, and 353 amino acids (aa) are coded; the full-length nucleotide of the coding region of the BHLH143 gene is SEQ ID No.1 in the SEQUENCE table; the amino acid SEQUENCE of the BHLH143 gene is SEQUENCE LIST No.2 in the SEQUENCE LIST.

Description

Expression cloning of peanut transcription factor BHLH143 gene and application thereof

Technical Field

The invention relates to expression cloning of a BHLH143 gene, in particular to expression cloning of a peanut transcription factor BHLH143 gene and application thereof, and belongs to the technical field of expression cloning of the BHLH143 gene.

Background

In the growth and development process of peanut hypocotyls, transcription control factors are used as important genes to control the growth of seed hypocotyls so that peanut seeds germinate and come out of soil, and therefore the growth of the hypocotyls is crucial to the growth and development of crops.

In current-stage pattern plants, a large number of transcriptional regulators have been reported to be involved in the development of the hypocotyl, such as the family of transcription factors HY5, PIF, AHL, ERF, BHLH, etc., but the related biological studies and transcriptional regulation network of peanut hypocotyl growth are not clear.

BHLH transcription factors, basic helix-loop-helix (bHLH) proteins, are one of the superfamily of transcription factors that are widely found in plants, animals and fungi.

BHLH superfamily members contain 2 highly conserved and functionally distinct domains: basic region (basic region) and helix-loop-helix (HLH) region. The bHLH transcription factor family is one of the largest transcription factor families of plants, and a great deal of researches show that the transcription factor family is important for the normal growth and development of eukaryotes and participates in a plurality of biological processes.

227 BHLH gene family members in peanut, the size of the coded protein is between 90 and 1453aa, and almost all the coded protein is hydrophilic protein; the bHLH genes are distributed on 20 chromosomes of the peanut but are uneven, and the number of the bHLH genes is between 4 and 19; systematic evolution analysis of family members found that the peanut bHLH gene family could be subdivided into 12 subfamilies, with each subfamilies again containing 1-6 subgroups; analysis of conserved motifs indicates that most bHLH genes contain both Motif1 (HSIAERRRRERJNERLRALRSLVP) and Motif2 (DKASILGEAIEYVKELQEQVKKLEEE) conserved motifs, which together make up the bHLH conserved domain; the colinear analysis finds that when the bHLH gene family is formed by peanut heterotetraploid, the heteroploidy is generated, and most of homologous bHLH genes appear at corresponding positions of peanut A, B subgenomic groups; the expression pattern study of bHLH genes of peanuts with different skin colors shows that 12 genes are specifically up-regulated in black skin peanuts, 11 of which belong to the third subfamily and belong to the same subfamily as the several bHLH genes which are proved to be involved in regulating anthocyanin synthesis pathways in Arabidopsis thaliana. Peanut BHLH genes have also been reported to be involved in physiological processes that regulate seed size, but there are relatively few functional reports on BHLH genes in general. Under the condition of salt stress, the AhbHLH121 transcription factor which is induced to be expressed is directly combined with G/E-box on AhPOD, ahCAT and AhSOD gene promoters to regulate and control the expression of active oxygen response genes so as to enhance the active oxygen scavenging capacity and further improve the salt tolerance of peanut plants. Peanut BHLH-type transcription factors have been subjected to drought stress. Up to now, no report of BHLH143 gene in peanut has been found, and for this purpose, an expression clone of peanut transcription factor BHLH143 gene and its application are designed to solve the above-mentioned problems.

Disclosure of Invention

The invention mainly aims to provide an expression clone of a peanut transcription factor BHLH143 gene and application thereof.

The aim of the invention can be achieved by adopting the following technical scheme:

The expression cloning of the peanut transcription factor BHLH143 gene, and the BHLH143 gene cloning vector is to clone the full-length sequence of the BHLH143 gene from a peanut cDNA library by utilizing an in-vitro polymerase chain reaction technology;

inserting a coding region sequence (without a stop codon) of the BHLH143 gene into a vector containing a green fluorescent protein reporter gene to obtain a BHLH143-GFP recombinant vector;

The coding region sequence of the BHLH143 gene is 1062bp, and 353 amino acids (aa) are coded;

the full-length nucleotide of the coding region of the BHLH143 gene is SEQUENCE LISTNo.1 in the SEQUENCE table;

The amino acid SEQUENCE of the BHLH143 gene is SEQUENCE lisTN.2 in the SEQUENCE table.

Preferably, primers used for amplifying the full-length open reading frame of the BHLH143 gene are as follows:

BHLH143-F1：5’-ATGGTTAAGGATCATATGCCTTGG-3’

BHLH143-R1：5’-CTATGGCGGCGATGAGCCTTTGGT-3’；

The amplification conditions were: the full-length sequence in-vitro PCR amplification reaction system of the coding region comprises 50 mu L of peanut leaf cDNA template 2 mu L,2 mu L of front and back primers respectively, 25 mu L of 2× Taq PCR MasterMix II enzyme premix and 19 mu L of sterile water.

PCR reaction conditions: 94 ℃ for 3min;

94 ℃,30s,58 ℃,30s,72 ℃ for 1min (30 cycles);

72℃，5min；

preserving at 4 ℃.

Preferably, the cDNA vector is reverse transcribed to synthesize first strand cDNA using total RNA of peanut leaf as a template.

Preferably, the expression mode of the BHLH143 gene has expression difference in different tissues and cell types, and fluorescent quantitative real-time PCR verifies that the BHLH143 expression has tissue preference; the primer sequences used for fluorescent quantitative real-time PCR of BHLH143 gene are as follows:

BHLH143-F1 RT：5’-ATATGTATACAAGGACGAA-3’

BHLH143-R1 RT：5’-AGAGTGGCCTGTACTTGTTA-3’。

preferably, BHLH143 is located in the plant cell nucleus in fusion with the green fluorescent protein.

Preferably, the BHLH143 gene is introduced into a plant by a transgenic technique to inhibit elongation of the hypocotyl of the plant.

The beneficial technical effects of the invention are as follows:

The invention provides an expression clone of a peanut transcription factor BHLH143 gene and application thereof, discloses a test method for in-vitro cloning of a peanut transcription factor BHLH143 gene coding region sequence, discloses a method for detecting gene expression quantity of the peanut transcription factor BHLH143 gene in different tissues, discloses a method for positioning subcellular of the peanut transcription factor BHLH143 gene, and provides an important technical method reference for researching cloning expression of peanut BHLH type transcription factors.

The invention discloses a peanut transcription factor BHLH143 which is introduced into plants through a transgenic technology, so that the growth and development of hypocotyls of the plants can be regulated, the growth of the hypocotyls of the transgenic plants of the BHLH143 is inhibited, and transgenic plant hormone detection shows that the BHLH143 inhibits the content of cytokinins, promotes the increase of the content of jasmonic acid, and inhibits the elongation of the hypocotyls due to the reduction of the content of the cytokinins.

The invention clones the sequence of peanut BHLH143, identifies the expression mode of the gene on the tissue level and single cell level, and identifies the gene to have the function of regulating and controlling hypocotyl extension through transgenic verification.

Drawings

FIG. 1 is a graph showing the relative expression level of peanut BHLH143 gene in the original tissue transcriptome and the fluorescent quantitative PCR test.

FIG. 2 is a graph showing the gene expression level of BHLH143 in single cell maps of leaf, stalk, hypocotyl and root.

FIG. 3 is a graph showing the structure of peanut BHLH143 protein and subcellular localization.

FIG. 4 is a graph showing the inhibition of hypocotyl elongation by a BHLH143 transgenic overexpressing plant via the hormonal pathway.

Detailed Description

In order to make the technical solution of the present invention more clear and obvious to those skilled in the art, the present invention will be described in further detail with reference to examples and drawings, but the embodiments of the present invention are not limited thereto.

As shown in fig. 1-4;

Example 1 in vitro cloning of the peanut transcription factor BHLH143 gene;

Extracting total RNA of peanut leaves;

one week old young seedling of peanut variety Yue oil 1823, leaf blade 0.1g, liquid nitrogen frozen submerged into powder, and extracting total RNA of peanut with reference to RNAprep Pure plant total RNA extraction kit (Tiangen Biochemical technology Co., ltd.).

Reversely transcribing total RNA of peanut leaves to synthesize first-strand cDNA;

First strand cDNA was synthesized by reverse transcription using FIRST STRAND CDNA SYNTHESIS KIT kit (Toyo Shanghai Biotechnology Co., ltd.) using total RNA from peanut leaf as template.

RNA thermal denaturation, the reaction system is as follows:

Immediately after 5min at 65℃on ice.

Preparing a reaction solution:

Reverse transcription reaction

The reaction solution is evenly mixed and then reacted on a PCR instrument:

after the reaction was completed, the mixture was cooled on ice and stored in a refrigerator at 4 ℃.

Cloning of BHLH143 Gene

The specific Primer BHLH143, BHLH143-F1 was designed using Primer5 software: 5'-ATGGTTAAGGATCATATGCCTTGG-3', BHLH143-R1:5'-CTATGGCGGCGATGAGCCTTTGGT-3' amplification of the BHLH143 gene by PCR technique using cDNA as template. PCR reaction system:

PCR reaction conditions:

recovery of BHLH143 in vitro amplification PCR reaction product

And (3) recovering a PCR reaction product by using an E.Z.N.A.gel Extraction Kit (the biological engineering Co., ltd. In Guangzhou) and directly carrying out gene sequencing on the BHLH143 in-vitro amplification PCR reaction product by using a BHLH143-F1/R1 primer to obtain a BHLH143 coding region sequence.

EXAMPLE 2 analysis of tissue expression level of BHLH143 Gene

And (3) taking 0.1g of each of leaves, roots, stems and hypocotyl tissues of a large seedling of a peanut variety Yue oil 1823, freezing and submerging the leaves, roots, stems and hypocotyl tissues into powder by liquid nitrogen, extracting total RNA of each tissue of the peanut leaves, roots, stems and hypocotyl by referring to RNAprep Pure plant total RNA extraction kit (Tiangen Biochemical technology Co., ltd.), and carrying out reverse transcription to obtain a cDNA library.

The primer sequences used for real-time PCR were:

BHLH143-F1 RT：5’-ATATGTATACAAGGACGAA-3’

BHLH143-R1 RT：5’-AGAGTGGCCTGTACTTGTTA-3’

The fluorescent quantitative real-time PCR reaction conditions of the BHLH143 gene are as follows: PCR reactions were performed using the ABI StepOne Plus system using SYBR Premix ExTaq (TaKaRa, dai, china). cDNA obtained by reverse transcription of peanut root, stem, leaf and hypocotyl total RNA is used as a template to explore the expression condition of BHLH143 gene in different tissues of peanut. The fluorescence quantitative system reaction method and conditions were referred to SYBR Green kit (Tiangen Biochemical technologies Co., ltd.). Using 18S (18S-F: ATTCCTAGTAAGCGCGAGTCATCAG,18S-R: CAATGATCCTTCCGCAGGTTCAC) as the reference gene, each sample was repeated 3 times, and experimental data was analyzed by the 2-. DELTA.ct method and the reaction was 40 cycles. REAL TIME PCR reaction system (20. Mu.L), SYBR preMix Plus reaction solution (10. Mu.L), front and rear primers (0.6. Mu.L each), peanut leaf cDNA template (2. Mu.L), and sterile water (6.8. Mu.L). According to the results of the graph 1, the results of sequencing transcriptome data of the peanut BHLH143 gene show that the expression quantity of the BHLH143 in roots is higher, the expression quantity of hypocotyls and stems is not much different, but the expression quantity in leaves is the lowest; the fluorescent quantitative PCR verification shows that the part with the highest expression level of BHLH143 is root, and other tissues are lower than the expression level in the root.

Further, according to the result of fig. 2, the expression level of peanut BHLH143 is preferentially expressed in mesophyll cells in root single cell transcription, and the expression level of BHLH143 in peanut seedling tissue single cell map is higher than that of stems, hypocotyls and leaves through judgment of the number of expression cells, and BHLH143 is mainly expressed in vascular bundle tissues.

EXAMPLE 3 subcellular localization analysis of protein encoded by BHLH143 Gene

The full-length coding sequence of the gene BHLH143 without a stop codon is cloned to a vector pNA580 (p 35S-GFP), and the constructed plasmid is transformed into E.coli DH5 alpha, and a large-scale extraction plasmid DNA kit (Omega) is used to ensure the plasmid concentration of about 30 mug/. Mu.l. Arabidopsis leaves were cut into filaments, enzyme solution (1.5%Cellulase RS,0.75%Macerozyme R-10,0.6M mannitol,10mM MES,pH 5.7,10mM CaCl2and 0.1%BSA) was added for 5h, and washed twice with W5 (154mM NaCl,125mM CaCl2,5mM KCl,2mM MES,pH 5.7) and resuspended in MMG solution (0.4M mannitol,15mM MgCl2,4mM MES,pH 5.7). After addition of 10. Mu.l of BHLH143-GFP plasmid and 40% PEG4000 mediated co-transformation of Arabidopsis protoplast cells, 16h later were observed using a laser confocal microscope Carl Zeiss LSM 780. According to FIG. 3, characterized in that BHLH143 is fusion expressed with green fluorescent protein and localized in plant cell nuclei; BHLH143 is shown to have transcription factor properties and to be able to localize in the nucleus of cells and bind DNA sequences to perform biological functions.

EXAMPLE 4BHLH143 Gene-overexpressing plants inhibit hypocotyl elongation

A transgenic over-expression vector plasmid containing a 35S-BHLH143-Nos vector structure was constructed, the vector was transformed into the Pseudomonas strain EH105, and positive vector strains were selected by a medium containing kanamycin.

The inflorescence infection method is adopted to transform the arabidopsis: 1) Inoculating the activated agrobacterium liquid into LB liquid medium containing 50 mug/ml kanamycin, placing in a shaking table, shaking overnight at 28 ℃/180rpm, and culturing until OD=about 1.5; 2) Centrifuging at 5000rpm for 10min, collecting thalli, and pouring out supernatant in the centrifuge tube; 3) Re-suspending the bacteria by using a buffer solution prepared in advance, and adjusting the bacteria to OD=about 0.8 by using a spectrophotometer and using the buffer solution as a control; 4) And (3) pinching off flowers and fruits which are already bloomed from the previously cultured arabidopsis thaliana, inverting the flowers and fruits into a container containing agrobacterium tumefaciens, completely immersing the arabidopsis thaliana, infecting the arabidopsis thaliana for about 1min, placing the infected arabidopsis thaliana into a greenhouse, culturing the arabidopsis thaliana in a dark way for 24h, taking out the arabidopsis thaliana, and placing the arabidopsis thaliana into the greenhouse for normal culture. 5) PCR identification of transgenic Arabidopsis plants, and extraction of transgenic Arabidopsis DNA. Identification of transgenic Arabidopsis plants was performed using AHL 23-based primers of interest and hygromycin resistance selection marker primers. 6) Screening transgenic arabidopsis, recording a transgenic strain capable of amplifying a target band according to the primary identification of PCR, growing the arabidopsis for about 5 weeks, and starting harvesting seeds, wherein the obtained seeds become T0 generation. Sterilizing the harvested arabidopsis seeds with 70% ethanol for 1min, washing with a small amount of sterilized water, sterilizing with 70% ethanol for 1min, washing with sterilized water for 5 times, air-drying the seeds on sterilized absorbent paper, and spreading on MS solid medium containing 30g/L hygromycin. Vernalization was performed in a refrigerator at 4℃for 48 hours, followed by placing in an incubator at 24℃with 16h light/8 h darkness for culture and screening of positive plants. The individual plants were harvested and screened in the same manner until homozygous lines were obtained. 7) Extracting plant endogenous hormone. Taking out the biological sample stored at ultralow temperature, and grinding (30 Hz,1 min) to powder by a grinder; weighing 50mg of the ground sample, adding an appropriate amount of internal standard, and extracting with 1mL of methanol/water/formic acid (15:4:1, v/v/v); the extract was concentrated and reconstituted with 100 μl of 80% methanol/water solution, filtered with a 0.22 μm filter, and placed in a sample bottle for LC-MS/MS analysis. 8) Mass spectrometry detection conditions. The data acquisition instrument system mainly comprises ultra-high performance liquid chromatography (Ultra Performance Liquid Chromatography, UPLC) and tandem mass Spectrometry (TANDEM MASS Spectrometry, MS/MS) [86-93].

The liquid phase conditions mainly include [94]: 1) Chromatographic column: waters ACQUITY UPLC HSS T3C 18 column (1.8 μm,100 mm. Times.2.1 mm); 2) Mobile phase: phase a, ultrapure water (0.04% acetic acid added); phase B, acetonitrile (0.04% acetic acid added); 3) Gradient elution procedure: 0min A/B is 95:5 (V/V), 1.0min A/B is 95:5 (V/V), 8.0min is 5:95 (V/V), 9.0min is 5:95 (V/V), 9.1min is 95:5 (V/V), 12.0min is 95:5 (V/V); 4) The flow rate is 0.35mL/min; column temperature 40 ℃; the sample injection amount was 2. Mu.L. The mass spectrum conditions mainly comprise: electrospray ion source (Electrospray Ionization, ESI) temperature 550 ℃, mass spectral voltage 5500V in positive ion mode, mass spectral voltage-4500V in negative ion mode, and Gas Curtain (curtaingas, CUR) 35psi. In Q-Trap 6500+, each ion pair is scan detected based on an optimized declustering voltage (declustering potential, DP) and Collision Energy (CE).

According to the results of FIG. 4, the transgenic plants were significantly shorter in hypocotyl than wild type plants in the over-expressed plants of peanut BHLH143 gene (FIGS. 4A-B); BHLH143 was shown to inhibit plant hypocotyl elongation. Meanwhile, the hormone result detection shows that the over-expression of the BHLH143 can inhibit the development of hypocotyls by promoting the increase of the jasmonic acid content and inhibiting the synthesis of cytokinins (figures 4C-D), and the BHLH143 can regulate the growth of the hypocotyls of the plant through a hormone pathway.

The above description is merely a further embodiment of the present invention, but the protection scope of the present invention is not limited thereto, and any person skilled in the art will be able to apply equivalents and modifications according to the technical solution and the concept of the present invention within the scope of the present invention disclosed in the present invention.

Claims (6)

1. An expression clone of a peanut transcription factor BHLH143 gene is characterized in that: the BHLH143 gene cloning vector is prepared through cloning the full length coding region sequence of BHLH143 gene from peanut cDNA library via in vitro polymerase chain reaction and the exon sequence between the initiation codon ATG and the termination codon TAG;

Inserting the coding region sequence of the BHLH143 gene into a vector containing a green fluorescent protein reporter gene to obtain a BHLH143-GFP recombinant vector;

the coding region sequence of the BHLH143 gene is 1062bp, and 353 amino acids are coded;

the full-length nucleotide of the coding region of the BHLH143 gene is SEQUENCE LISTNo.1 in the SEQUENCE table;

The amino acid SEQUENCE of the BHLH143 gene is SEQUENCE lisTN.2 in the SEQUENCE table.

2. The expression clone of a peanut transcription factor BHLH143 gene according to claim 1, wherein: the primers used for amplifying the full-length open reading frame of the BHLH143 gene are as follows:

BHLH143-F1：5’-ATGGTTAAGGATCATATGCCTTGG-3’；

BHLH143-R1：5’-CTATGGCGGCGATGAGCCTTTGGT-3’。

3. The expression clone of a peanut transcription factor BHLH143 gene according to claim 2, wherein: the cDNA carrier is used for synthesizing first-strand cDNA by reverse transcription by taking total RNA of peanut leaves as a template.

4. The expression clone of a peanut transcription factor BHLH143 gene according to claim 3, wherein: the expression mode of the BHLH143 gene has expression difference in different tissues and cell types, and fluorescent quantitative real-time PCR verifies that the BHLH143 expression has tissue preference; the primer sequences used for fluorescent quantitative real-time PCR of BHLH143 gene are as follows:

BHLH143-F1 RT：5’-ATATGTATACAAGGACGAA-3’；

BHLH143-R1 RT：5’-AGAGTGGCCTGTACTTGTTA-3’。

5. the expression clone of a peanut transcription factor BHLH143 gene of claim 4 wherein: BHLH143 was expressed in fusion with green fluorescent protein and localized in the plant cell nucleus.

6. The use of the expression clone of the peanut transcription factor BHLH143 gene according to claim 5, wherein: the BHLH143 gene is introduced into plants through transgenic technology to inhibit the elongation of hypocotyls of the plants.