CN118086577B - Molecular marker of wheat biological rhythm clock gene TaPRR-A1 and application thereof - Google Patents
Molecular marker of wheat biological rhythm clock gene TaPRR-A1 and application thereofInfo
- Publication number
- CN118086577B CN118086577B CN202410517665.3A CN202410517665A CN118086577B CN 118086577 B CN118086577 B CN 118086577B CN 202410517665 A CN202410517665 A CN 202410517665A CN 118086577 B CN118086577 B CN 118086577B
- Authority
- CN
- China
- Prior art keywords
- taprr
- wheat
- molecular marker
- seq
- hapl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000209140 Triticum Species 0.000 title claims abstract description 52
- 235000021307 Triticum Nutrition 0.000 title claims abstract description 51
- 101150038243 CLOCK gene Proteins 0.000 title claims abstract description 31
- 239000003147 molecular marker Substances 0.000 title claims abstract description 27
- 230000033764 rhythmic process Effects 0.000 title claims abstract description 22
- 102000054766 genetic haplotypes Human genes 0.000 claims abstract description 15
- 241000196324 Embryophyta Species 0.000 claims abstract description 14
- 235000013339 cereals Nutrition 0.000 claims abstract description 4
- 239000012634 fragment Substances 0.000 claims description 7
- 108091081024 Start codon Proteins 0.000 claims description 4
- 108091008146 restriction endonucleases Proteins 0.000 claims description 4
- 230000029087 digestion Effects 0.000 claims 3
- 108090000623 proteins and genes Proteins 0.000 abstract description 8
- 230000006872 improvement Effects 0.000 abstract description 4
- 108090000790 Enzymes Proteins 0.000 abstract description 3
- 102000004190 Enzymes Human genes 0.000 abstract description 3
- 230000002068 genetic effect Effects 0.000 abstract description 3
- 108700028369 Alleles Proteins 0.000 abstract description 2
- 238000013459 approach Methods 0.000 abstract description 2
- 238000010353 genetic engineering Methods 0.000 abstract description 2
- 230000003321 amplification Effects 0.000 description 10
- 238000003199 nucleic acid amplification method Methods 0.000 description 10
- 238000012408 PCR amplification Methods 0.000 description 9
- 238000004925 denaturation Methods 0.000 description 6
- 230000036425 denaturation Effects 0.000 description 6
- 238000001976 enzyme digestion Methods 0.000 description 6
- 108020004414 DNA Proteins 0.000 description 5
- 238000009395 breeding Methods 0.000 description 5
- 230000001488 breeding effect Effects 0.000 description 5
- 238000000034 method Methods 0.000 description 5
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 4
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 4
- 238000011161 development Methods 0.000 description 4
- 230000018109 developmental process Effects 0.000 description 4
- 238000011144 upstream manufacturing Methods 0.000 description 4
- 238000000246 agarose gel electrophoresis Methods 0.000 description 3
- 238000010219 correlation analysis Methods 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 238000004153 renaturation Methods 0.000 description 3
- 239000000758 substrate Substances 0.000 description 3
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 241000209094 Oryza Species 0.000 description 2
- 235000007164 Oryza sativa Nutrition 0.000 description 2
- 238000001514 detection method Methods 0.000 description 2
- 238000001502 gel electrophoresis Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 235000009566 rice Nutrition 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 229910021642 ultra pure water Inorganic materials 0.000 description 2
- 239000012498 ultrapure water Substances 0.000 description 2
- 101100029173 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) SNP2 gene Proteins 0.000 description 1
- 101100094821 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) SMX2 gene Proteins 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- 244000098338 Triticum aestivum Species 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 238000012098 association analyses Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 238000003776 cleavage reaction Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007123 defense Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 230000010355 oscillation Effects 0.000 description 1
- 230000029553 photosynthesis Effects 0.000 description 1
- 238000010672 photosynthesis Methods 0.000 description 1
- 238000011084 recovery Methods 0.000 description 1
- 230000009467 reduction Effects 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 230000007017 scission Effects 0.000 description 1
- 238000005204 segregation Methods 0.000 description 1
- 239000000779 smoke Substances 0.000 description 1
- 230000017260 vegetative to reproductive phase transition of meristem Effects 0.000 description 1
Abstract
The invention discloses a molecular marker of a wheat biological rhythm clock gene TaPRR-A1 and application thereof, belonging to the field of plant variation and genetic engineering. The molecular marker is TaPRR-A1-SNP 1432, is obtained by amplifying a primary PCR primer shown in SEQ ID NO. 1 and SEQ ID NO. 2 and a secondary PCR primer shown in SEQ ID NO. 3 and SEQ ID NO. 4, and is obtained by cutting the molecular marker by EcoRV enzyme, if the molecular marker is cut into two bands, the haplotype of the TaPRR-A1 gene is Hapl a, otherwise, the haplotype is Hapl b. The invention discovers excellent alleles of TaPRR-A1 genes from natural wheat groups, develops related functional molecular markers for identifying the plant height, the spike length and the thousand grain weight of wheat, and provides gene resources and effective approaches for genetic improvement of wheat yield traits.
Description
Technical Field
The invention relates to a molecular marker and application thereof, in particular to a molecular marker of a wheat biological rhythm clock gene TaPRR-A1 and application thereof in identifying wheat yield traits, belonging to the technical field of plant variation and genetic engineering.
Background
Wheat is one of the most important food crops worldwide, and its yield and quality improvement are particularly important. The traditional wheat breeding workload is large, the cost is high, the period is long, and the wheat molecular marker assisted breeding technology can accurately and stably select target genes in early stage, so that the wheat breeding process is accelerated, and the breeding efficiency is improved.
The biological rhythm clock is a rhythm oscillation adaptation system of 24-hour periodicity of plants, and plays an important role in the growth and development of plants. Biological clocks are capable of regulating plant flowering, photosynthesis and biological and non-biological defense processes, which are critical to crop adaptability and yield formation. The biological rhythm clock gene OsPRR of rice positively regulates the yield of rice by influencing plant height, secondary branch and stem number, grain number per ear, seed setting rate and single plant weight. The development and utilization of the functions and molecular markers of the wheat biological rhythm clock gene TaPRR are not yet reported.
Disclosure of Invention
The invention aims to provide a molecular marker of a wheat biological rhythm clock gene TaPRR-A1 and application thereof, and aims to provide gene resources and effective ways for genetic improvement of wheat yield traits.
In order to achieve the above object, the present invention adopts the following technical scheme:
The molecular marker of the wheat biological rhythm clock gene TaPRR-A1 is TaPRR-A1-SNP 1432, is CAPS molecular marker, is amplified by a primary PCR primer shown in SEQ ID NO. 1 and SEQ ID NO. 2 and a secondary PCR primer shown in SEQ ID NO. 3 and SEQ ID NO. 4, is cut by restriction enzyme EcoRV, and if the CAPS molecular marker is cut into two bands, the haplotype of the wheat biological rhythm clock gene TaPRR-A1 is Hapl a, and if the CAPS molecular marker cannot be cut, the haplotype of the wheat biological rhythm clock gene TaPRR-A1 is Hapl b.
The use of the molecular marker TaPRR-A1-SNP 1432 of the aforementioned wheat biorhythmic clock gene TaPRR-A1 for identifying the yield traits of wheat, including plant height, spike length and thousand kernel weight, which are significantly reduced, significantly increased, and significantly increased for the Hapl a type, as compared to the Hapl b type, hapl a type is the excellent genotype of the wheat biorhythmic clock gene TaPRR-A1.
The invention has the advantages that: the invention discovers the excellent allele (Hapl a type) of the wheat biological rhythm clock gene TaPRR-A1 from the natural population of wheat, develops related functional molecular markers (TaPRR 59-A1-SNP 1432) for identifying the plant height, the spike length and the thousand grain weight of the wheat, and provides gene resources and effective approaches for genetic improvement of wheat yield traits.
Drawings
FIG. 1 is a schematic diagram showing variation of the wheat biorhythmic clock gene TaPRR-A1 gene region;
FIG. 2 is a graph showing the detection result of molecular marker gel electrophoresis of a part of wheat.
Detailed Description
The present invention will be described in detail with reference to the drawings and examples. The experimental methods used in the examples are conventional methods unless specifically indicated.
1. Acquisition of polymorphic site of wheat biorhythmic clock gene TaPRR-A1
The genome sequence of the wheat biological rhythm clock gene TaPRR-A1 is shown in SEQ ID NO. 15.
Specific primers are designed according to the genome sequence of the wheat biological rhythm clock gene TaPRR-A1 to carry out amplification sequencing. The designed specific primers are 5 pairs in total, and the specific primers are respectively: taPRR59-A1-1F/1R, taPRR59-A1-2F/2R, taPRR59-A1-3F/3R, taPRR59-A1-4F/4R, and TaPRR59-A1-5F/5R, the nucleotide sequences of each specific primer were as follows:
TaPRR59-A1-1F：TCCGTTCCCCTCTCTCCA（SEQ ID NO:5）
TaPRR59-A1-1R：CAGATCAATTTGAACAGCCAAA（SEQ ID NO:6）
TaPRR59-A1-2F：CTGTTCAAATTGATCTGCCAAA（SEQ ID NO:7）
TaPRR59-A1-2R：TTCATTCCCCATAACACACA（SEQ ID NO:8）
TaPRR59-A1-3F：AGTGTGTAACATGAGATGCCTTC（SEQ ID NO:9）
TaPRR59-A1-3R：CCAGTTACTTTAAATTCCCCTCT（SEQ ID NO:10）
TaPRR59-A1-4F：TCCAAGGCTACAACGGAACA（SEQ ID NO:11）
TaPRR59-A1-4R：GCAGTCTTCCCTTAGGTGCC（SEQ ID NO:12）
TaPRR59-A1-5F：GCGTGCGGAATGATGGAAAA（SEQ ID NO:13）
TaPRR59-A1-5R：TCCATACATGACAGACGGCG（SEQ ID NO:14）
The DNA of 30 parts of wheat material (all from the national germplasm resource pool) in Table 1 was PCR amplified using the above 5 pairs of specific primers (TaPRR-A1-1F/1R, taPRR-A1-2F/2R, taPRR-A1-3F/3R, taPRR-A1-4F/4R and TaPRR-A1-5F/5R), respectively.
The PCR amplification system was 50mL, and specifically: 2.0. Mu.L of DNA template, 2.0. Mu.L of upstream primer, 2.0. Mu.L of downstream primer, 25. Mu.L of 2 Xbuffer (Phanta Max Buffer), 1.0. Mu.L of dNTP mix (2.5. Mu.M each), 1.0mL of ultra-fidelity DNA Polymerase (Phanta Max Super-FIDELITY DNA Polymerase), 17.0. Mu.L of ultrapure water (ddH 2 O).
The common amplification procedure is adopted for amplification, and the steps are as follows: denaturation at 95℃for 3min; denaturation at 95℃for 40s, renaturation at 58℃for 40s, extension at 72℃for 2min,34 cycles; extending at 72 ℃ for 10min; and (5) finishing amplification and storing at 4 ℃.
TABLE 130 common wheat variety
After the PCR amplification is finished, the target fragment is subjected to gel cutting recovery, and the specific primers TaPRR A1-1F/1R, taPRR A1-2F/2R, taPRR A1-3F/3R, taPRR A1-4F/4R and TaPRR A1-5F/5R are used for respectively carrying out two-way first-generation sequencing on the recovered products.
The sequence analysis shows that the first intron region of the wheat biological rhythm clock gene TaPRR-A1 has 1 SNP site (SNP 4), and the region upstream of the gene start codon ATG has 3 SNP sites (SNP 1, SNP2 and SNP 3). As shown in FIG. 1, these 4 SNP sites have a co-segregation phenomenon, and constitute 2 haplotypes, taPRR-A1-Hapl a (hereinafter abbreviated as Hapl a) and TaPRR-A1-Hapl b (hereinafter abbreviated as Hapl b), respectively.
2. Development of molecular marker of wheat biorhythmic clock gene TaPRR-A1 and haplotype identification
1. Development of CAPS molecular markers
Two rounds of PCR primers were designed based on the SNP4 site (A/G, located 1432bp downstream of the initiation codon ATG) of the wheat biorhythmic clock gene TaPRR-A1, wherein:
the first round PCR primer is a genome specific primer, which is marked as TaPRR-59-A1-SNP 1432-1F/1R.
The second round of PCR primers specifically amplified a 583bp fragment containing SNP4, designated TaPRR-A1-SNP 1432-2F/2R.
The nucleotide sequences of TaPRR-A1-SNP 1432-1F/1R and TaPRR-A1-SNP 1432-2F/2R are specifically as follows:
TaPRR59-A1-SNP1432-1F：TCCGTTCCCCTCTCTCCA（SEQ ID NO:1）
TaPRR59-A1-SNP1432-1R：CAGATCAATTTGAACAGCCAAA（SEQ ID NO:2）
TaPRR59-A1-SNP1432-2F：GTGAACAAATGCCTATAAATGG（SEQ ID NO:3）
TaPRR59-A1-SNP1432-2R：CAGATCAATTTGAACAGCCAAA（SEQ ID NO:4）
The molecular marker corresponding to the above two rounds of PCR primers was designated TaPRR-A1-SNP 1432.
Since SNP4 is located in the recognition sequence (GATATC) of the restriction enzyme EcoRV, the base type of SNP4 can be judged from the cleavage band pattern of the PCR product, specifically:
If the PCR product can be cut into two bands, the base of the locus is A;
If the PCR product cannot be cut, the base at this site is G.
2. Identification of haplotypes
A natural population (Table 2) consisting of 280 parts of common hexaploid wheat is selected, and genotype identification is carried out on the natural population by utilizing the CAPS molecular marker TaPRR-A1-SNP 1432.
(1) First round PCR amplification
The primer TaPRR-A1-SNP 1432-1F/1R is used for carrying out the first round of PCR amplification on the DNA of the wheat variety to be detected.
The PCR amplification system was 10. Mu.L, and specifically: 0.4. Mu.L of DNA template, 0.4. Mu.L of upstream primer, 0.4. Mu.L of downstream primer, 5. Mu.L of 2 Xbuffer (Phanta Max Buffer), 0.2. Mu.L of dNTP mix (2.5 mM each), 0.2mL of ultra-fidelity DNA Polymerase (Phanta Max Super-FIDELITY DNA Polymerase), 3.4. Mu.L of ultra-pure water (ddH 2 O).
The common amplification procedure is adopted for amplification, and the steps are as follows: denaturation at 95℃for 3min; denaturation at 95℃for 40s, renaturation at 62℃for 40s, extension at 72℃for 2min,34 cycles; extending at 72 ℃ for 10min; and (5) finishing amplification and storing at 4 ℃.
The PCR products were detected by 1% agarose gel electrophoresis, and when a single target fragment (1761 bp) was obtained, a second round of PCR amplification was performed using the primary PCR product as a template.
(2) Second round PCR amplification
A second round of PCR amplification was performed using primer TaPRR-A1-SNP 1432-2F/2R and the primary PCR product as template.
The PCR amplification system was 10. Mu.L, and specifically: 0.4. Mu.L of DNA template, 0.4. Mu.L of upstream primer, 0.4. Mu.L of downstream primer, 5. Mu.L of 2 XGC Buffer, 1.6. Mu.L of dNTP mix (2.5 mM each), 0.1mL of LA Tap enzyme, 2.1. Mu.L of ddH 2 O.
The common amplification procedure is adopted for amplification, and the steps are as follows: denaturation at 95℃for 3min; denaturation at 95℃for 40s, renaturation at 58℃for 40s, extension at 72℃for 40s,34 cycles; extending at 72 ℃ for 10min; and (5) finishing amplification and storing at 4 ℃.
The PCR products were detected by 1.5% agarose gel electrophoresis, and when a single target fragment (583 bp) was obtained, the enzyme digestion reaction was performed using the secondary PCR product as a substrate.
(3) Enzyme digestion reaction
The restriction enzyme EcoRV is used for carrying out enzyme digestion reaction by taking the secondary PCR product as a substrate.
The enzyme digestion reaction system is 10 mu L, and specifically comprises: 3.0. Mu.L of substrate, 1.0. Mu.L of Buffer (rCutSmart ™ Buffer), 0.2. Mu.L of EcoRV enzyme, 5.8. Mu.L of ddH 2 O.
The cleaved products were detected by 2.0% agarose gel electrophoresis. If the enzyme digestion product is two bands with the sizes of 300bp and 283bp, the base of the site is A, and the haplotype of the wheat biological rhythm clock gene TaPRR-A1 is Hapl a; if the enzyme digestion product is a band with the size of 583bp, the base at the site is G, and the haplotype of the wheat biological rhythm clock gene TaPRR-A1 is Hapl b.
The molecular marker gel electrophoresis detection results of some of 280 common hexaploid wheat shown in table 2 are shown in fig. 2, and the molecular marker identification results of all wheat are shown in table 2.
TABLE 2 typing results of molecular marker TaPRR59-A1-SNP1432 in Natural populations
3. Correlation analysis of haplotypes and yield traits
The association analysis was performed on the phenotype data of the two haplotypes (Hapl a, hapl b) of the wheat biorhythm clock gene TaPRR-A1 and the three environments (smoke floor Zhifu region, laishan bath village, laishan waterfall valley) of the natural population for two years (2021, 2022) using the Tassel5.2 software GLM model.
The haplotype and yield trait correlation analysis results of wheat biorhythmic clock gene TaPRR-A1 are shown in Table 3.
TABLE 3 haplotype of wheat biorhythmic clock gene TaPRR-A1 and yield trait correlation analysis results
Note that: ** P <0.01, * P < 0.05.
As can be seen from table 3: compared with Hapl b types, hapl a types have significantly reduced plant height (P < 0.01), spike length (P < 0.05), average reduction ratio of 8.3 percent (plant height) and 5.8 percent (spike length) respectively, and Hapl a types have significantly increased thousand kernel weight (P < 0.01) and average increase ratio of 5.8 percent.
The result shows that Hapl a type is the excellent genotype of wheat biological rhythm clock gene TaPRR59-A1, and molecular marker TaPRR59-A1-SNP1432 can be applied to wheat breeding with excellent yield traits.
It should be noted that the above examples are only examples for clearly illustrating the present invention, and are not limiting to the embodiments of the present invention. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. Not all embodiments are exhaustive. Obvious changes and modifications which are extended by the technical proposal of the invention are still within the protection scope of the invention.
Claims (2)
1. The application of the molecular marker of the wheat biological rhythm clock gene TaPRR-59-A1 in identifying the plant height, spike length and thousand grain weight of wheat is characterized in that the molecular marker is TaPRR-A1-SNP 1432, is CAPS molecular marker, is obtained by amplifying a primary PCR primer shown in SEQ ID NO. 1 and SEQ ID NO. 2 and a secondary PCR primer shown in SEQ ID NO. 3 and SEQ ID NO. 4 to obtain a secondary PCR product, and then carrying out restriction enzyme EcoRV digestion, wherein the fragment length of the primary PCR product is 1761bp, the fragment length of the secondary PCR product is 583bp, if the digestion product is two bands, the sizes are 300bp and 283bp respectively, the corresponding haplotype of the wheat biological rhythm clock gene TaPRR-A1 at 1432bp downstream of an initiation codon ATG is Hapl a, if the digestion product is one band, the band size is still 583bp, the fragment length of the wheat biological rhythm clock gene TaPRR-A1 is corresponding to the haplotype Hapl b downstream of the initiation codon ATG of the 300 bp-283 bp.
2. The use of the molecular marker of wheat biorhythmic clock gene TaPRR-A1 according to claim 1 to identify wheat plant height, ear length and thousand kernel weight, wherein the plant height and ear length of type Hapl a are both significantly reduced and the thousand kernel weight is significantly increased relative to type Hapl b, and type Hapl a is the excellent genotype of wheat biorhythmic clock gene TaPRR 59-A1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410517665.3A CN118086577B (en) | 2024-04-28 | Molecular marker of wheat biological rhythm clock gene TaPRR-A1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410517665.3A CN118086577B (en) | 2024-04-28 | Molecular marker of wheat biological rhythm clock gene TaPRR-A1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN118086577A CN118086577A (en) | 2024-05-28 |
| CN118086577B true CN118086577B (en) | 2024-07-09 |
Family
ID=
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825639A (en) * | 2019-04-24 | 2019-05-31 | 鲁东大学 | Molecular labeling and its application with wheat grains per spike main effect QTL compact linkage |
| CN112442115A (en) * | 2020-12-08 | 2021-03-05 | 中国农业科学院作物科学研究所 | Application of wheat TaPRR95-B protein or coding gene thereof in regulating and controlling plant height |
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825639A (en) * | 2019-04-24 | 2019-05-31 | 鲁东大学 | Molecular labeling and its application with wheat grains per spike main effect QTL compact linkage |
| CN112442115A (en) * | 2020-12-08 | 2021-03-05 | 中国农业科学院作物科学研究所 | Application of wheat TaPRR95-B protein or coding gene thereof in regulating and controlling plant height |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110184381B (en) | SNP locus related to wheat small ear number per ear and application thereof | |
| CN109913572B (en) | Molecular marker tightly linked with spike length major QTL (quantitative trait locus) and application thereof | |
| CN116926233B (en) | Molecular marker of wheat TaHAL3-7B gene and application thereof | |
| CN110592097B (en) | Rice spike regulation gene, rice spike regulation mutant, molecular marker and application thereof | |
| CN108165653B (en) | InDel molecular marker for identifying pepper maturity and application thereof | |
| CN116377121B (en) | Molecular marker related to wheat flag leaf length and spike length and application thereof | |
| CN111321241B (en) | Molecular marker of wheat thousand-grain weight and grain length gene TaGS3-4A and application thereof | |
| CN113699268B (en) | Wheat thousand grain weight character related SNP site and application thereof | |
| CN109797242B (en) | Molecular marker and method for identifying wheat yield-related traits | |
| CN113621733B (en) | Wheat small ear number per ear and drought resistance character related SNP locus and application thereof | |
| CN117385098B (en) | Molecular marker related to wheat grain density and application thereof | |
| CN118086577B (en) | Molecular marker of wheat biological rhythm clock gene TaPRR-A1 and application thereof | |
| CN116103433B (en) | CAPS molecular marker for identifying rice spike length character and application thereof | |
| CN113699267B (en) | SNP locus related to wheat plant height traits and application thereof | |
| CN118086577A (en) | Molecular marker of wheat biological rhythm clock gene TaPRR-A1 and application thereof | |
| CN110628930A (en) | dCAPS molecular marker for identifying panicle length character of rice and application thereof | |
| CN112430681B (en) | Molecular marker for identifying wheat plant height and yield traits and application thereof | |
| CN114317807A (en) | Wheat thousand grain weight character related SNP site and application thereof | |
| CN118086578B (en) | Molecular marker of wheat biological rhythm clock gene TaPRR-B1 and application thereof | |
| CN110484651B (en) | Molecular marker in wheat yield related gene TaNRT2-6D and application thereof | |
| CN118086579B (en) | Molecular marker of wheat biological rhythm clock gene TaPRR-D1 and application thereof | |
| CN116024368B (en) | Molecular marker closely linked with soybean plant high-efficiency gene locus and application thereof | |
| AU2021104868A4 (en) | Spsb gene isoform 2 of sugarcane, identification method and use thereof | |
| CN118308523A (en) | Wheat SNP locus and multiple applications thereof | |
| Sun et al. | Characterisation of RNaseH-LTR sections of Ty1-copia retrotransposons in apple and fingerprinting of four apple clones by S-SAP analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |