CN118086578B - Molecular marker of wheat biological rhythm clock gene TaPRR-B1 and application thereof - Google Patents
Molecular marker of wheat biological rhythm clock gene TaPRR-B1 and application thereof Download PDFInfo
- Publication number
- CN118086578B CN118086578B CN202410517666.8A CN202410517666A CN118086578B CN 118086578 B CN118086578 B CN 118086578B CN 202410517666 A CN202410517666 A CN 202410517666A CN 118086578 B CN118086578 B CN 118086578B
- Authority
- CN
- China
- Prior art keywords
- taprr
- wheat
- hapl
- seq
- snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000209140 Triticum Species 0.000 title claims abstract description 76
- 235000021307 Triticum Nutrition 0.000 title claims abstract description 76
- 101150038243 CLOCK gene Proteins 0.000 title claims abstract description 37
- 239000003147 molecular marker Substances 0.000 title claims abstract description 24
- 230000033764 rhythmic process Effects 0.000 title claims abstract description 21
- 235000013339 cereals Nutrition 0.000 claims abstract description 29
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 9
- 102000054766 genetic haplotypes Human genes 0.000 claims description 19
- 101100029173 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) SNP2 gene Proteins 0.000 claims description 15
- 101100094821 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) SMX2 gene Proteins 0.000 claims description 15
- 101100236128 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) LSM2 gene Proteins 0.000 claims description 10
- 108091008146 restriction endonucleases Proteins 0.000 claims description 5
- 238000001917 fluorescence detection Methods 0.000 claims description 4
- 239000003550 marker Substances 0.000 claims description 2
- 241000196324 Embryophyta Species 0.000 abstract description 5
- 230000002068 genetic effect Effects 0.000 abstract description 3
- 230000006872 improvement Effects 0.000 abstract description 3
- 238000010353 genetic engineering Methods 0.000 abstract description 2
- 238000012408 PCR amplification Methods 0.000 description 11
- 230000003321 amplification Effects 0.000 description 10
- 238000003199 nucleic acid amplification method Methods 0.000 description 10
- 238000004925 denaturation Methods 0.000 description 8
- 230000036425 denaturation Effects 0.000 description 8
- 238000001514 detection method Methods 0.000 description 7
- 108020004414 DNA Proteins 0.000 description 6
- 238000001976 enzyme digestion Methods 0.000 description 6
- 238000011161 development Methods 0.000 description 5
- 230000018109 developmental process Effects 0.000 description 5
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 4
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 4
- 108090000790 Enzymes Proteins 0.000 description 4
- 102000004190 Enzymes Human genes 0.000 description 4
- 238000009395 breeding Methods 0.000 description 4
- 230000001488 breeding effect Effects 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 4
- 238000010219 correlation analysis Methods 0.000 description 4
- 239000000463 material Substances 0.000 description 4
- 238000000034 method Methods 0.000 description 4
- 108091028043 Nucleic acid sequence Proteins 0.000 description 3
- 238000000137 annealing Methods 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 239000000499 gel Substances 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 238000004153 renaturation Methods 0.000 description 3
- 239000000758 substrate Substances 0.000 description 3
- 238000011144 upstream manufacturing Methods 0.000 description 3
- 108091081024 Start codon Proteins 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 238000001502 gel electrophoresis Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 229920002401 polyacrylamide Polymers 0.000 description 2
- 238000003752 polymerase chain reaction Methods 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 229910021642 ultra pure water Inorganic materials 0.000 description 2
- 239000012498 ultrapure water Substances 0.000 description 2
- HRPVXLWXLXDGHG-UHFFFAOYSA-N Acrylamide Chemical compound NC(=O)C=C HRPVXLWXLXDGHG-UHFFFAOYSA-N 0.000 description 1
- 108700028369 Alleles Proteins 0.000 description 1
- 101000690100 Homo sapiens U1 small nuclear ribonucleoprotein 70 kDa Proteins 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- 244000098338 Triticum aestivum Species 0.000 description 1
- 102100024121 U1 small nuclear ribonucleoprotein 70 kDa Human genes 0.000 description 1
- XSQUKJJJFZCRTK-UHFFFAOYSA-N Urea Chemical compound NC(N)=O XSQUKJJJFZCRTK-UHFFFAOYSA-N 0.000 description 1
- 230000009418 agronomic effect Effects 0.000 description 1
- 238000007844 allele-specific PCR Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 239000004202 carbamide Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007123 defense Effects 0.000 description 1
- 239000008367 deionised water Substances 0.000 description 1
- 229910021641 deionized water Inorganic materials 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000006870 function Effects 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- -1 methylene acrylamide Chemical compound 0.000 description 1
- 230000029553 photosynthesis Effects 0.000 description 1
- 238000010672 photosynthesis Methods 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 238000011084 recovery Methods 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 239000000779 smoke Substances 0.000 description 1
- 238000005728 strengthening Methods 0.000 description 1
- 230000017260 vegetative to reproductive phase transition of meristem Effects 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker of a wheat biological rhythm clock gene TaPRR-B1 and application thereof, belonging to the field of plant variation and genetic engineering. The molecular markers are TaPRR-B1-SNP 3701 and TaPRR-B1-SNP 4996, the former is amplified by a forward primer shown in SEQ ID NO. 1 and SEQ ID NO. 2 and a reverse primer shown in SEQ ID NO. 3, and the latter is amplified by a primary PCR primer shown in SEQ ID NO. 4 and SEQ ID NO. 5 and a secondary PCR primer shown in SEQ ID NO. 6 and SEQ ID NO. 7. The invention has the advantages that: related functional molecular markers for identifying the grain length, grain width and grain density of wheat are developed, and gene resources and effective ways are provided for genetic improvement of wheat yield traits.
Description
Technical Field
The invention relates to a molecular marker and application thereof, in particular to a molecular marker of a wheat biological rhythm clock gene TaPRR-B1 and application thereof in identifying wheat yield traits, belonging to the fields of plant variation and genetic engineering.
Background
Wheat is one of the most important grain crops worldwide, and has great significance in strengthening cultivation of new varieties and improving wheat yield. With the development of molecular biology, bioinformatics and the like, the molecular marker assisted selection technology is widely applied to wheat breeding. The wheat molecular marker assisted breeding technology can accurately and stably select target genes in early stage, so that the wheat breeding process is accelerated, and the breeding efficiency is improved.
The biological clock system is a time service mechanism inside plant cells and mainly comprises 3 main parts of signal input, a core oscillator and signal output. Biological rhythms regulate plant flowering, photosynthesis, biological and abiotic defenses, and the like, which are critical to crop adaptability and yield formation. Important agronomic traits such as the heading date, plant height and the like of the wheat are reported to be influenced by partial members of the PRR family of the wheat biological clock. The development and utilization of the functions and molecular markers of the wheat biological rhythm clock gene TaPRR are not yet reported.
Disclosure of Invention
The invention aims to provide a molecular marker of a wheat biological rhythm clock gene TaPRR-B1 and application thereof, and aims to provide gene resources and effective ways for genetic improvement of wheat yield traits.
In order to achieve the above object, the present invention adopts the following technical scheme:
Molecular markers of wheat biorhythmic clock gene TaPRR-B1, which are TaPRR-B1-SNP 3701 and TaPRR-B1-SNP 4996, wherein:
The TaPRR-B1-SNP 3701 is a KASP mark, and is obtained by amplifying two forward primers shown in SEQ ID NO. 1 and SEQ ID NO. 2 and one reverse primer shown in SEQ ID NO. 3, wherein the 5' ends of the two forward primers shown in SEQ ID NO. 1 and SEQ ID NO. 2 are respectively combined with a FAM fluorescent group and a HEX fluorescent group, after fluorescence detection, if a fluorescent signal is blue, the base of the wheat biological clock gene TaPRR-B1 at a SNP2 site is G, and if the fluorescent signal is red, the base of the wheat biological clock gene TaPRR-B1 at the SNP2 site is A;
The TaPRR-B1-SNP 4996 is a CAPS marker, which is obtained by amplifying a primary PCR primer shown in SEQ ID NO. 4 and SEQ ID NO. 5 and a secondary PCR primer shown in SEQ ID NO. 6 and SEQ ID NO. 7, and after the CAPS molecular marker is subjected to restriction enzyme MseI, if the CAPS molecular marker is cut into two bands, the base of the wheat biological rhythm clock gene TaPRR59-B1 at the SNP3 site is T, and if the CAPS molecular marker cannot be cut, the base of the wheat biological rhythm clock gene TaPRR-B1 at the SNP3 site is C;
if SNP2 locus base is G, SNP locus base is C, the haplotype of wheat biological rhythm clock gene TaPRR-59-B1 is Hapl a;
If SNP2 locus base is G, SNP locus base is T, the haplotype of wheat biological rhythm clock gene TaPRR-59-B1 is Hapl B;
If SNP2 site base is A, SNP site base is C, the haplotype of wheat biological rhythm clock gene TaPRR-59-B1 is Hapl C.
The use of the aforementioned molecular markers TaPRR-B1-SNP 3701 and TaPRR-59-B1-SNP 4996 of the wheat biorhythmic clock gene TaPRR-B1 for identifying wheat yield traits, including grain length, grain width and grain density, of type Hapl c wheat grain length significantly increased compared to type Hapl a and type Hapl B; wheat grain width of types Hapl a and Hapl c increased significantly compared to type Hapl b; the grain density of wheat of type Hapl b increased significantly compared to type Hapl a, the grain density difference of wheat of types Hapl c and Hapl a was not significant; the Hapl c type is an excellent haplotype of the wheat TaPRR59-B1 gene.
The invention has the advantages that: the invention discovers the excellent natural allele (Hapl c type) of the wheat biological rhythm clock gene TaPRR-B1 from the natural population of wheat, develops related functional molecular markers (TaPRR 59-B1-SNP3701 and TaPRR-B1-SNP 4996) for identifying the grain length, grain width and grain density of the wheat, and provides gene resources and effective ways for genetic improvement of wheat yield traits.
Drawings
FIG. 1 is a schematic diagram showing variation of the wheat biorhythmic clock gene TaPRR-B1 gene region;
FIG. 2 is a graph showing the fluorescence detection result of molecular marker TaPRR-B1-SNP 3701 in a portion of wheat;
FIG. 3 is a graph showing the detection result of molecular marker TaPRR-B1-SNP 4996 by gel electrophoresis in a portion of wheat.
Detailed Description
The present invention will be described in detail with reference to the drawings and examples. The experimental methods used in the examples are conventional methods unless specifically indicated.
1. Acquisition of polymorphic site of wheat biorhythmic clock gene TaPRR-B1
The genome sequence of the wheat biological rhythm clock gene TaPRR-B1 is shown in SEQ ID NO. 16.
Specific primers are designed according to the genome sequence of the wheat biological rhythm clock gene TaPRR-B1 to carry out amplification sequencing. The total of 4 pairs of designed specific primers are respectively: taPRR59-B1-1F/1R, taPRR59-B1-2F/2R, taPRR59-B1-3F/3R, and TaPRR-B1-4F/4R, the nucleotide sequences of each specific primer were as follows:
TaPRR59-B1-1F：CCTCTCCCCCTCTCCTCT（SEQ ID NO:8）
TaPRR59-B1-1R：CCGATGTGGCAAACAATTAAGA（SEQ ID NO:9）
TaPRR59-B1-2F：CGCACACCCTGTAAACTGAGAA（SEQ ID NO:10）
TaPRR59-B1-2R：ATTTCAATTTCACTTGCTTGGT（SEQ ID NO:11）
TaPRR59-B1-3F：TGTTATGGGGAATGGATGATA（SEQ ID NO:12）
TaPRR59-B1-3R：GTTCATGTGAGGGCAAAGTT（SEQ ID NO:13）
TaPRR59-B1-4F：CCCTGAGCAACACTGGTTAGTT（SEQ ID NO:14）
TaPRR59-B1-4R：TCATCAAAATGAATAAAAGGGGA（SEQ ID NO:15）
The DNA of 30 parts of wheat material (all from the national germplasm resource pool) in Table 1 was PCR amplified using the 4 pairs of specific primers (TaPRR-B1-1F/1R, taPRR-B1-2F/2R, taPRR-59-B1-3F/3R and TaPRR-59-B1-4F/4R) described above, respectively.
The PCR amplification system was 50mL, and specifically: 2.0. Mu.L of DNA template, 2.0. Mu.L of upstream primer, 2.0. Mu.L of downstream primer, 25. Mu.L of 2 Xbuffer (Phanta Max Buffer), 1.0. Mu.L of dNTP mix (2.5 mM each), 1.0mL of ultra-fidelity DNA Polymerase (Phanta Max Super-FIDELITY DNA Polymerase), 17.0. Mu.L of ultra-pure water (ddH 2 O).
The common amplification procedure is adopted for amplification, and the steps are as follows: denaturation at 95℃for 3min; denaturation at 95℃for 40s, renaturation at 58℃for 40s, extension at 72℃for 2min,34 cycles; extending at 72 ℃ for 10min; and (5) finishing amplification and storing at 4 ℃.
TABLE 1 30 common wheat variety
After the PCR amplification is finished, the target fragment is subjected to gel cutting recovery, and the specific primers TaPRR-B1-1F/1R, taPRR-B1-2F/2R, taPRR-B1-3F/3R and TaPRR-B1-4F/4R are used for respectively carrying out two-way first-generation sequencing on the recovered products.
Through sequence analysis, 3 SNP loci are found in the gene region sequence of the wheat biological rhythm clock gene TaPRR-B1, and the 3 SNP loci are respectively positioned in a second intron region (SNP 1 locus), a third intron region (SNP 2 locus) and a sixth intron region (SNP 3 locus), wherein the SNP1 locus and the SNP2 locus have a co-separation phenomenon. As shown in FIG. 1, the 3 SNP loci together form 3 haplotypes, which are TaPRR-B1-Hapl a (hereinafter abbreviated as Hapl a), taPRR-B1-Hapl B (hereinafter abbreviated as Hapl B) and TaPRR-B1-Hapl c (hereinafter abbreviated as Hapl c), respectively.
2. Development of molecular marker of wheat biorhythmic clock gene TaPRR-B1 and haplotype identification
1. Development of SNP2 site KASP molecular markers
Three primers were designed for SNP2 locus (A/G, 3701bp downstream of the initiation codon ATG) of wheat biorhythmic clock gene TaPRR-B1, and KASP (Kompetitive Allele-SPECIFIC PCR, KASP) molecular markers were developed. The three primers include two forward primers and one reverse primer, wherein the two forward primers are respectively marked as TaPRR-B1-SNP 3701-G and TaPRR-B1-SNP 3701-A, the reverse primer is marked as TaPRR-B1-SNP 3701-Common, and the developed KASP molecular marker is marked as TaPRR-B1-SNP 3701. The nucleotide sequences of the three primers are specifically as follows:
TaPRR59-B1-SNP3701-G：
GAAGGTGACCAAGTTCATGCTCACTGATTTGGTTGTGCAAGATAAC（SEQ ID NO：1）；
TaPRR59-B1-SNP3701-A：
GAAGGTCGGAGTCAACGGATTGCACTGATTTGGTTGTGCAAGATAAT（SEQ ID NO：2）；
TaPRR59-B1-SNP3701-Common：
GGCCTAGTTACACCTCAGAAAGCTA（SEQ ID NO：3）。
In order to detect the PCR amplified product by a fluorescence reader, a FAM fluorophore was attached to the 5 'end of forward primer TaPRR-B1-SNP 3701-G, and a HEX fluorophore was attached to the 5' end of forward primer TaPRR-B1-SNP 3701-A.
2. Identification of SNP2 locus genotype
A natural population (Table 2) composed of 287 parts of common hexaploid wheat is selected, and genotyping is carried out on the natural population by using the KASP molecular marker TaPRR-B1-SNP 3701.
(1) Preparation of PCR amplification System
The PCR amplification system was 10. Mu.L, and specifically: 0.2. Mu.L of forward primer TaPRR-B1-SNP 3701-G (concentration 10. Mu.M), 0.2. Mu.L of forward primer TaPRR-B1-SNP 3701-A (concentration 10. Mu.M), 0.4. Mu.L of reverse primer TaPRR-B1-SNP 3701-Common (concentration 10. Mu.M), 5. Mu.L of 2 XPCR premix, 2. Mu.L of DNA template (concentration 50-200 ng/. Mu.L), 4.2. Mu.L of deionized water (ddH 2 O).
(2) PCR amplification procedure
The PCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 20s, annealing at 65 ℃ for 40s, circulation for 10 times, wherein the annealing and extending temperature is reduced by 0.6 ℃ each time, denaturation at 95 ℃ for 20s, annealing and extending at 55 ℃ for 40s, circulation for 30, heat preservation at 10 ℃ and waiting for collecting fluorescent signals.
Scanning detection of fluorescence intensity was performed on a Araya fluorescence reader, and the data was analyzed and read in SNPVIEWER software.
The result shows that SNP3701-G site specific primer is connected with FAM fluorescent group, and in KASP detection result, the color is blue, and the base reading is G; SNP3701-A site specific primer is connected with HEX fluorescent group, red in KASP detection result, and base reading is A. The NTC control was black.
The fluorescence detection results of part of the 287 parts of common hexaploid wheat are shown in FIG. 2.
3. Development of SNP3 site CAPS molecular markers
Two rounds of PCR primers were designed based on the SNP3 locus (C/T, 4996bp downstream of the initiation codon ATG) of wheat biorhythmic clock gene TaPRR-B1, wherein the first round of PCR primers was genome-specific primers, primers were designated TaPRR-B1-SNP 4996-1F/1R, and the second round of PCR primers was specific amplified 190bp minifragments containing SNP3 locus, primers were designated TaPRR-B1-SNP 4996-2F/2R.
Nucleotide sequences of TaPRR-B1-SNP 4996-1F/1R and TaPRR-B1-SNP 4996-2F/2R are specifically as follows:
TaPRR59-B1-SNP4996-1F：TGTTATGGGGAATGGATGATA（SEQ ID NO：4）
TaPRR59-B1-SNP4996-1R：GTTCATGTGAGGGCAAAGTT（SEQ ID NO：5）
TaPRR59-B1-SNP4996-2F：TTGATCCAAATAATTTTGGCTTGG（SEQ ID NO：6）
TaPRR59-B1-SNP4996-2R：ATGGCTCTATTCTTTTATTACCA（SEQ ID NO：7）
the molecular marker corresponding to the above two rounds of PCR primers was designated TaPRR-B1-SNP 4996.
Since the SNP3 site is located in the recognition sequence (TTAA) of the restriction enzyme MseI, the base type can be judged according to the restriction enzyme banding pattern of the PCR product. Specific:
If the PCR product can be cut, the base of the locus is T;
If the PCR product cannot be cut, the base at this site is C.
4. Identification of SNP3 locus genotype
Selecting 287 parts of natural population (Table 2) composed of common hexaploid wheat, and carrying out genotype identification on the natural population by utilizing the CAPS molecular marker TaPRR-B1-SNP 4996.
(1) First round PCR amplification
The primer TaPRR-B1-SNP 4996-1F/1R is used for carrying out the first round of PCR amplification on the DNA of the wheat variety to be detected.
The PCR amplification system was 10. Mu.L, and specifically: 0.4. Mu.L of DNA template, 0.4. Mu.L of upstream primer, 0.4. Mu.L of downstream primer, 5. Mu.L of 2 Xbuffer (Phanta Max Buffer), 0.2. Mu.L of dNTP mix (2.5 mM each), 0.2mL of ultra-fidelity DNA Polymerase (Phanta Max Super-FIDELITY DNA Polymerase), 3.4. Mu.L of ultra-pure water (ddH 2 O).
The common amplification procedure is adopted for amplification, and the steps are as follows: denaturation at 95℃for 3min; denaturation at 95℃for 40s, renaturation at 56℃for 40s, extension at 72℃for 2min,34 cycles; extending at 72 ℃ for 10min; and (5) finishing amplification and storing at 4 ℃.
The PCR products were detected by 1% agarose gel electrophoresis, and when a single target fragment (1689 bp) was obtained, a second round of PCR amplification was performed using the primary PCR product as a template.
(2) Second round PCR amplification
A second round of PCR amplification was performed using the primer TaPRR-B1-SNP 4996-2F/2R and the primary PCR product as template.
The PCR amplification system was 10. Mu.L, and specifically: 0.4. Mu.L of DNA template, 0.4. Mu.L of upstream primer, 0.4. Mu.L of downstream primer, 5. Mu.L of 2 XGC Buffer, 1.6. Mu.L of dNTP mix (2.5 mM each), 0.1mL of LA Tap enzyme, 2.1. Mu.L of ddH 2 O.
The common amplification procedure is adopted for amplification, and the steps are as follows: denaturation at 95℃for 3min; denaturation at 95℃for 40s, renaturation at 55℃for 40s, extension at 72℃for 40s,34 cycles; extending at 72 ℃ for 10min; and (5) finishing amplification and storing at 4 ℃.
The PCR products were detected by 2% agarose gel electrophoresis, and when a single target fragment (190 bp) was obtained, the enzyme digestion reaction was performed using the secondary PCR products as substrates.
(3) Enzyme digestion reaction
And (3) carrying out enzyme digestion reaction by using a restriction enzyme MseI and taking a secondary PCR product as a substrate.
The enzyme digestion reaction system is 10 mu L, and specifically comprises: 3.0. Mu.L of substrate, 1.0. Mu.L of Buffer (rCutSmart ™ Buffer), 0.2. Mu.L of MseI enzyme, 5.8. Mu.L of ddH 2 O.
The enzyme digestion products are detected by 5% modified polyacrylamide gel (each 100mL polyacrylamide gel solution contains 4.75g acrylamide, 0.25g methylene acrylamide and 45g urea), and the base types are judged according to enzyme digestion bands of the PCR products, specifically:
If the PCR product can be cut by MseI enzyme (147 bp), the base of the locus is T;
if the PCR product cannot be cleaved by MseI enzyme (190 bp), the base at this position is C.
The detection result of partial wheat gel electrophoresis in 287 parts of common hexaploid wheat is shown in FIG. 3.
5. Haplotype identification
According to the haplotype typing situation shown in fig. 1, the haplotype of 287 parts of natural population materials is classified by combining the detection result of the SNP3 site CAPS molecular marker and the detection result of the SNP2 site KASP molecular marker of 287 parts of natural population materials, and the typing results are shown in Table 2.
TABLE 2 haplotype typing results of biorhythmic clock Gene TaPRR-B1 in wheat Natural population
/>
/>
/>
3. Correlation analysis of haplotypes and yield traits
Correlation analysis was performed using the general linear model (generalized linear model, GLM) of GAPIT packages of R language, in combination with the haplotype data of the biorhythmic clock gene TaPRR59-B1 of 287 parts of natural population material and the phenotype data of 3 environmental conditions (E1: shandong Weifang in 2020; E2: hebei Shijiku in 2021; E3: shandong smoke table in 2022) grain length, grain width and grain density. The R language lme package was used to calculate the best linear unbiased estimates (best linear unbiased estimator, BLUE) for each trait in 3 environments.
The haplotype and yield trait correlation analysis results of wheat biorhythmic clock gene TaPRR-B1 are shown in Table 3.
TABLE 3 haplotype of wheat biorhythmic clock gene TaPRR-B1 and yield trait correlation analysis results
/>
/>
Different lowercase letters represent significant differences (P < 0.05).
As can be seen from table 3: the average grain length of wheat of type Hapl c increased significantly by 2.18% and 3.46% compared to Hapl a and Hapl b types; wheat grain width of types Hapl a and Hapl c increased significantly on average by 2.83% and 3.77% compared to Hapl b types; the average grain density of Hapl b type was significantly increased by 3.93% compared to Hapl a type, and the difference in grain densities of Hapl c type and Hapl a type was not significant.
Therefore, from the viewpoint of wheat grain shape, hapl c type is an excellent haplotype of wheat TaPRR59-B1 gene.
It should be noted that the above examples are only examples for clearly illustrating the present invention, and are not limiting to the embodiments of the present invention. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. Not all embodiments are exhaustive. Obvious changes and modifications which are extended by the technical proposal of the invention are still within the protection scope of the invention.
Claims (2)
1. Use of a molecular marker of the wheat biorhythmic clock gene TaPRR-B1 for identifying a wheat yield trait, wherein the molecular markers are TaPRR-B1-SNP 3701 and TaPRR-B1-SNP 4996, wherein:
The TaPRR-B1-SNP 3701 is a KASP mark, and is obtained by amplifying two forward primers shown in SEQ ID NO. 1 and SEQ ID NO. 2 and one reverse primer shown in SEQ ID NO. 3, wherein the 5' ends of the two forward primers shown in SEQ ID NO. 1 and SEQ ID NO. 2 are respectively combined with a FAM fluorescent group and a HEX fluorescent group, after fluorescence detection, if a fluorescent signal is blue, the base of the wheat biological clock gene TaPRR-B1 at a SNP2 site is G, and if the fluorescent signal is red, the base of the wheat biological clock gene TaPRR-B1 at the SNP2 site is A;
The TaPRR-B1-SNP 4996 is a CAPS marker, which is obtained by amplifying a primary PCR primer shown in SEQ ID NO. 4 and SEQ ID NO. 5 and a secondary PCR primer shown in SEQ ID NO. 6 and SEQ ID NO. 7, and after the CAPS molecular marker is subjected to restriction enzyme MseI, if the CAPS molecular marker is cut into two bands, the base of the wheat biological rhythm clock gene TaPRR59-B1 at the SNP3 site is T, and if the CAPS molecular marker cannot be cut, the base of the wheat biological rhythm clock gene TaPRR-B1 at the SNP3 site is C;
if SNP2 locus base is G, SNP locus base is C, the haplotype of wheat biological rhythm clock gene TaPRR-59-B1 is Hapl a;
If SNP2 locus base is G, SNP locus base is T, the haplotype of wheat biological rhythm clock gene TaPRR-59-B1 is Hapl B;
if SNP2 locus base is A, SNP locus base is C, the haplotype of wheat biological rhythm clock gene TaPRR-59-B1 is Hapl C;
the yield traits are grain length, grain width and grain density.
2. The use of the molecular markers TaPRR-B1-SNP 3701 and TaPRR-B1-SNP 4996 of the wheat biorhythmic clock gene TaPRR-B1 of claim 1 to identify wheat yield traits that are significantly increased for wheat grain length of type Hapl c compared to types Hapl a and Hapl B; wheat grain width of types Hapl a and Hapl c increased significantly compared to type Hapl b; the grain density of wheat of type Hapl b increased significantly compared to type Hapl a, the grain density difference of wheat of types Hapl c and Hapl a was not significant; the Hapl c type is an excellent haplotype of the wheat TaPRR59-B1 gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410517666.8A CN118086578B (en) | 2024-04-28 | 2024-04-28 | Molecular marker of wheat biological rhythm clock gene TaPRR-B1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410517666.8A CN118086578B (en) | 2024-04-28 | 2024-04-28 | Molecular marker of wheat biological rhythm clock gene TaPRR-B1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN118086578A CN118086578A (en) | 2024-05-28 |
| CN118086578B true CN118086578B (en) | 2024-06-25 |
Family
ID=91165659
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410517666.8A Active CN118086578B (en) | 2024-04-28 | 2024-04-28 | Molecular marker of wheat biological rhythm clock gene TaPRR-B1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN118086578B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112280893A (en) * | 2020-12-16 | 2021-01-29 | 鲁东大学 | Molecular marker of wheat yield related gene TaD11-2A and application thereof |
| CN112779350A (en) * | 2021-02-07 | 2021-05-11 | 四川农业大学 | Molecular marker closely linked with wheat spikelet grain number QTLQGns |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1593657A (en) * | 2004-07-09 | 2005-03-16 | 长春天坛生物制药有限公司 | Production method of freeze dried chickenpox attenuated live vaccine and products therefrom |
| CN110101864A (en) * | 2019-05-31 | 2019-08-09 | 辽宁茂康源生物科技有限公司 | The protective agent of serum-free Antirabic Vaccine a kind of and its application |
| CN116926233B (en) * | 2023-09-13 | 2023-12-12 | 鲁东大学 | Molecular marker of wheat TaHAL3-7B gene and application thereof |
-
2024
- 2024-04-28 CN CN202410517666.8A patent/CN118086578B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112280893A (en) * | 2020-12-16 | 2021-01-29 | 鲁东大学 | Molecular marker of wheat yield related gene TaD11-2A and application thereof |
| CN112779350A (en) * | 2021-02-07 | 2021-05-11 | 四川农业大学 | Molecular marker closely linked with wheat spikelet grain number QTLQGns |
Also Published As
| Publication number | Publication date |
|---|---|
| CN118086578A (en) | 2024-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109913572B (en) | Molecular marker tightly linked with spike length major QTL (quantitative trait locus) and application thereof | |
| CN116926233B (en) | Molecular marker of wheat TaHAL3-7B gene and application thereof | |
| CN113981048A (en) | Primer composition, kit and method for detecting micro-haplotype locus based on next-generation sequencing technology and application thereof | |
| CN109797242B (en) | Molecular marker and method for identifying wheat yield-related traits | |
| CN109234423B (en) | Application of soybean molecular marker and polymorphism thereof in identification of soybean branch number traits | |
| CN111850161A (en) | Sand-melt aegilops 7SshChromosome specific molecular marker and application thereof | |
| CN111575400A (en) | Wheat stripe rust resistant QTL molecular marker IWB12253 and application thereof | |
| CN113699268B (en) | Wheat thousand grain weight character related SNP site and application thereof | |
| CN111961753B (en) | SNP (Single nucleotide polymorphism) marker related to resistance gene of pepper and tomato leaf blight virus, and specific primer and application thereof | |
| CN102747070A (en) | Two CAPs markers tightly linked with muskmelon anti-powdery mildew gene Pm-AN and its application method | |
| CN109207631A (en) | A kind of Gene For Resistance To Rice Bacterial Blight xa5 specific molecular marker and its application | |
| CN116103433B (en) | CAPS molecular marker for identifying rice spike length character and application thereof | |
| CN118086578B (en) | Molecular marker of wheat biological rhythm clock gene TaPRR-B1 and application thereof | |
| CN114480718B (en) | Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit | |
| CN113699267B (en) | SNP locus related to wheat plant height traits and application thereof | |
| CN112159862B (en) | SNP marker linked with cucumber mosaic virus resistance gene cmv as well as kit and method thereof | |
| CN112430681B (en) | Molecular marker for identifying wheat plant height and yield traits and application thereof | |
| CN110358855B (en) | SNP (Single nucleotide polymorphism) marker 5-156 of pepper phytophthora disease resistance gene as well as specific primer and application thereof | |
| CN114317807A (en) | Wheat thousand grain weight character related SNP site and application thereof | |
| CN118086579B (en) | Molecular marker of wheat biological rhythm clock gene TaPRR-D1 and application thereof | |
| CN111635957A (en) | Molecular marker for detecting wheat stripe rust resistance QTL and application of molecular marker in disease-resistant breeding | |
| CN118086577B (en) | Molecular marker of wheat biological rhythm clock gene TaPRR-A1 and application thereof | |
| CN113308566B (en) | Primer and application of InDel molecular marker related to soybean main stem node number | |
| CN116732230B (en) | Rice nitrogen efficient InDel molecular marker GRF4M1 and application thereof | |
| CN113637790B (en) | KASP molecular marker of stripe rust resistance gene YrAS2388R, primer, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |