CN118006826A - Thin-skin melon length gene CAPS mark and application thereof - Google Patents

Abstract

The invention discloses a thin-skin melon length gene CAPS marker and application thereof, wherein the CAPS marker adopts primer pairs CmFul-AluI-F and CmFul-AluI-R for amplification, and amplified fragments are subjected to AluI enzyme digestion, and 1 short-fruit thin-skin melon generates a strip with the length of 351 bp; the long fruit-shaped thin-skin melon produces 2 bands of 193bp and 158bp in length.

Description

Thin-skin melon length gene CAPS mark and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a thin-skin melon length gene CAPS marker and application thereof.

Background

Fruit quality and variety are important directions for current and future breeding. Fruit size and shape are not only important appearance quality traits, but also are a major manifestation of diversity. Fruit length is an important indicator affecting fruit size and fruit shape (Wang Chenhui et al, 2019). However, research on the genetic basis and molecular mechanisms of its formation remains relatively poor. Therefore, the molecular and regulatory mechanism of fruit length formation can be ascertained to further enhance the understanding and appreciation of fruit size and diversity formation. Compared with other fruits, the melon fruits are more abundant in diversity, and are ideal crops for researching the sizes and diversity of the fruits (Eiroshi et al.,2008;Latrasse et al, 2017).

Genetic studies on melon fruit size (length, width, shape) have been reported, and it is considered to belong to a complex quantitative trait, controlled by multiple genes. Although a large number of melon fruit lengths, fruit widths, fruit shape traits QTLs have been reported, there are few molecular markers for fine localization genes and development. In addition, the two melon subspecies, thick and thin, are independently domesticated, and different domestication mechanisms exist, meaning that they may be controlled by different genes during trait formation. The pro-positioned QTLs are mostly based on thick-skin melons or populations of thick-skin and thin-skin melons. However, related researches on melon types, namely muskmelon, which are specific to China and even southeast Asia countries are reported, so that the development of molecular markers related to traits for excavating and regulating related genes of the muskmelon fruits has important significance for further enriching understanding and understanding of people on the formation of fruit diversity and rapidly creating diverse germplasm resources.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a thin-skin melon length gene CAPS marker and application thereof.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

The CAPS marker adopts primer pairs CmFul-AluI-F and CmFul-AluI-R for amplification, and the amplified fragments are subjected to AluI digestion, so that 1 strip with the length of 351bp is produced by the short fruit-shaped muskmelon; the long fruit-shaped thin-skin melon generates 2 bands with the lengths of 193bp and 158 bp;

CmFul-AluI-F：CATATTTAACTTTCATCGATTGCTAGG

CmFul-AluI-R：GTAGCTCCTTGACTACTAAGTAACT。

Preferably, in the CAPS label, the reaction procedure for amplifying the CAPS label is as follows: 94 ℃ for 5min;95 ℃,10 s,60 ℃,10 s,72 ℃,10 s,45 cycles; 95 ℃, 5s,65 ℃, 1min,40 ℃ and 30s.

Preferably, in the CAPS label described above, the reaction system for amplifying the CAPS label is composed of, in 25 ul: 10Mmol/L forward primer 0.5ML, 10Mmol/L reverse primer 0.5ML, 100ng template DNA, 12.5ul of Kod One high-fidelity enzyme.

Preferably, in the CAPS label, the cleavage reaction system comprises, in 15 ul: 4ul of PCR product, 10 XBuffer 1.5ul, 0.5ul of restriction enzyme, and enzyme cutting at 37 ℃ for 1h.

Compared with the prior art, the invention has the following beneficial effects:

Fruit shape is not only an important appearance trait, but also directly related to yield. At present, in melon breeding, the traditional breeding is multipurpose, the selection of materials is needed to be carried out after melon is grown, the period is long, and the efficiency is low. The invention identifies a melon fruit length related gene, discovers that the allelic variation of the gene is obviously related to the melon fruit length, develops a molecular marker based on the gene, and has important significance for developing melon molecular marker assisted selection.

Drawings

FIG. 1 is a chart of a GWAS analysis of fruit length, fruit shape, ovary shape;

FIG. 2 is a diagram of a CmFUL homology gene evolution relationship analysis;

FIG. 3 is a graph showing gene expression level analysis of CmFUL in various tissues of melon;

FIG. 4 shows the gene expression level (a) and the difference (b) between fruits CmFUL of melon of different lengths;

FIG. 5 is a graph showing the association of CmFUL allelic variation with fruit length; and (3) injection: m5, M95 and M110 are short fruit germplasm, and M46, M953 and M982 are long fruit germplasm;

FIG. 6 is a CAPS primer design, wherein the green bold letters A and G represent SNP sites;

FIG. 7 is an electrophoretogram of typical melon species on CAPS molecular markers.

Detailed Description

Example 1:

1. Materials: 1175 parts of melon germplasm resources from the Zhengzhou fruit tree research institute of China academy of agricultural sciences are planted in the Henan Zhengzhou in spring 2015, 5 plants are planted in each part of the melon germplasm resources, tender leaves of seedlings are picked in the 1-heart period of 5 leaves of the seedlings, quick-frozen by liquid nitrogen and then stored in an ultralow-temperature refrigerator for standby use, and the melon germplasm resources are used for whole genome resequencing. Selecting 5 typical melon germplasm MS-146, MS-78, MS-101, MS-965 and MS-979 with different fruit lengths, taking fruit samples 15 days after pollination, quick-freezing the fruit samples in liquid nitrogen, and storing the fruit samples in an ultralow temperature refrigerator for later use for measuring the gene expression quantity. Melon germplasm 962 is planted in a field, and roots, stems, leaves, flowers and fruits in different development periods are taken for analysis of candidate gene expression patterns. And (5) planting all the materials, namely single vines and single melons, and normally managing.

The ovary shape is investigated in the flowering period, the fruit length and the fruit shape are phenotypically investigated in the fruit maturity period, and the data are recorded by referring to the description Specification and data Standard of melon germplasm resources.

2. Whole genome association analysis

The whole genome sequencing was performed on young leaves collected at one heart stage of five leaves, with an average sequencing depth of 5×. The sequencing data for each sample was first genotype filtered (MISSING DATA < = 40%, MAF > = 0.05) and then all phenotype files were digitized. Genome-wide association analysis of genotypes and phenotypes was performed under a mixed linear model using software EMMAX, covariates being the result of population structure stratification. The threshold is determined using a permutation test after the correlation analysis is complete. And the signal peak above the threshold line is the candidate region, and finally, the candidate genes are further screened by combining LD-decay and functional annotation information of the genes.

3. Gene expression analysis

To determine candidate gene expression patterns, fruit samples of candidate gene (MEO 3C 002050) at 0, 15, 20, 30 days after melon roots, stems, leaves, flowers and pollination were downloaded from the NCBI website (https:// www.ncbi.nlm.nih.gov/sra/.

QRT-PCR analysis was performed, and the relative expression level of the target gene was calculated by 2 ^–ΔCT method, and repeated 3 times. 20 μl reaction system at PCR amplification: 2 μl of cDNA; mix 10 μl; ddH ₂ O6 μl; the forward and reverse primers were 1. Mu.l each. The PCR amplification procedure was: 94 ℃ for 5min;95 ℃, 10s,60 ℃, 10s,72 ℃, 10s,45 cycles; 95 ℃, 5s,65 ℃, 1min,40 ℃ and 30s.

Primer sequence of target gene:

F-AGCAGCAGCAGCAGGATAGT；

R-AGGGTATCGGATCTGTCGTG。

Action primer sequence:

F：CCTGGTATCGCTGACCGTAT；

R：TACTGAGCGATGCAAGGATG。

4. Sequence amplification and cleavage reactions

The reaction system for PCR amplification was 25ul and consisted of the following components: forward primer (10 Mmol/L) 0.5ML, reverse primer (10 Mmol/L) 0.5ML, template DNA100 ng, kod One high-fidelity enzyme 12.5ul.

And (5) utilizing restriction enzyme AluI to cleave the PCR amplification product to obtain a cleavage product. The enzyme digestion system is 15ul, which comprises: 4ul of PCR product, 10 XBuffer 1.5ul, 0.5ul of restriction enzyme, and enzyme cutting at 37 ℃ for 1h. The digested product was separated by electrophoresis on a 2.5% agarose gel with 1XTBE buffer, and after electrophoresis for 40min at a constant pressure of 5V/cm, stained with GoldView nucleic acid stain, photographed on an ultraviolet gel imaging system and stored. Reagents for the assay, such as restriction enzymes, DNA polymerase, etc., were purchased from NEB.

Example 2 results and analysis of example 1

1. Whole genome association analysis

The MADS-box gene family is an important class of transcriptional regulatory factors that play an important role in plant growth and development and signaling (Smaczniak et al., 2012). In recent years, more and more MADS-box gene functions are revealed, and particularly in model plants such as Arabidopsis thaliana, tomato and the like, the MADS-box gene functions are found to be important regulating factors for flower organ formation and are involved in morphogenesis of other organs such as fruits. In cucurbitaceae crop cucumbers, the MADS-box gene CsFUL1 has also been shown to be involved in the regulation of cucumber fruit length, an important transcription factor inhibiting fruit elongation (Zhao et al, 2019). 62 MADS-box genes were identified in the melon genome, of which FRUITFULL-like type genes 2 (MELO 3C011409 and MELO3C 002050), were specifically expressed in flowers and fruits, and MELO3C002050 was expressed in a significantly higher amount than MELO3C011409 in the fruit growing period (Hao et al, 2016).

The 3 characters of fruit length, fruit shape and ovary shape are obviously related. We performed phenotypic evaluation of 1175 melon germplasm material for fruit length, fruit shape and ovary shape and resequenced them. When the whole genome association (GWAS) analysis was performed on the fruit length, fruit shape, and ovary shape traits, 1 significantly associated signal was identified at the same position on chromosome 12 of the genome and overlapped with the single fruit weight and fruit shape QTLs sites reported previously. Within the chromosome interval (25.38-25.84 Mb) where the 3 associated signals overlap, there are 1 FRUITFULL-like MADS-box family gene MELO3C002050 (temporarily named CmFUL). The gene contained 9 exons, with a-G single nucleotide variation found on exon 7 resulting in a valine-alanine (Val-Ala) variation (fig. 1).

2. Homology alignment analysis

The homologous genes of the MELO3C002050 genes on crops such as cucumber, arabidopsis thaliana, tobacco, tomato and the like are downloaded from NCBI database, and a phylogenetic tree (figure 2) is constructed by utilizing MEGA6.0, so that the sequence similarity of the MELO3C002050 and cucumber Csa1P039910 is up to 92.47%. While Csa1P039910 (CsFUL 1) has been shown to regulate cucumber fruit length (Zhao et al, 2019). Therefore, we speculate that MELO3C002050 may be a candidate gene for melon fruit length traits.

3. Analysis of candidate Gene expression level

In order to find the gene expression pattern of CmFUL (MELO 3C 002050), the prior study and the transcriptome data of the team are analyzed, and the expression level of the gene in the root, the stem and the leaf of muskmelon is very low, the gene is mainly expressed in female flowers and fruits, and the expression level after pollination is obviously higher than the later stage of fruit development (figure 3) and is consistent with the differentiation period of fruit cells. The results show that CmFUL has significantly higher expression level in melon fruits than other tissues and is mainly expressed in early fruit development.

To further understand the relationship between CmFUL allelic variations and fruit length, we analyzed the combination of early resequencing data and phenotypic data and found that CmFUL, ^G, was found to be predominantly present in the melon variety (Conomon) germplasm of the thin-skinned subspecies melon with longer fruits. Meanwhile, we analyze the relative expression amounts of CmFUL genes in fruits 15 days after pollination of 5 typical germplasm MS-146 (10 cm), MS-78 (12 cm), MS-101 (13 cm), MS-965 (23 cm) and MS-979 (46 cm), and found that the expression amount of CmFUL gene is related to the fruit length and has a negative correlation (figure 4).

CAPS marker development and validation

To verify the association of allelic variation of candidate gene CmFUL with fruit length, the full-length sequences of short fruit germplasm M5, M95, M110 and long fruit germplasm M46, M953, M982 clone CmFUL of muskmelon are selected respectively, and sequence comparison shows that the nucleotide sequences of the short fruit germplasm and the long fruit gene are different on the 7 th exon 25,235,043, the loci of 3 short fruit germplasm and 3 long fruit germplasm are A and G respectively, and the association of the allelic variation with the fruit length of muskmelon is initially verified.

Designing a primer pair comprising the SNP locus:

CmFul-AluI-F：CATATTTAACTTTCATCGATTGCTAGG

CmFul-AluI-R：GTAGCTCCTTGACTACTAAGTAACT

the amplified fragment length was 351bp. As shown in FIG. 6, FIG. 6 is a CAPS primer design drawing, and green bold letters A and G represent SNP sites.

Analysis by software SnapGene shows that the long-fruit melon material amplified sequence has a restriction enzyme AluI recognition and action site AG/CT, while the short-fruit melon material amplified sequence does not have the restriction enzyme cleavage site. Thus, a co-dominant CAPS marker was screened for successful differentiation between long and short fruit-shaped material genotypes by restriction enzyme AluI cleavage. After the primer amplification product is subjected to AluI enzyme digestion, the long and short fruit-shaped materials show enzyme digestion polymorphism. The short fruit-shaped material has no enzyme cutting site and is still 1 band with the length of 351 bp; the long fruit material produced 2 bands of 193bp and 158bp in length.

The CAPS molecular markers were verified by selecting 13 short fruit shapes (5, 23, 29, 33, 52, 71, 77, 85, 90, 94, 110, 113, 117) and 11 long fruit shapes (46, 953, 961, 963, 970, 973, 975, 977, 982, 987, 988) of typical melon seeds, respectively, and as shown in fig. 7, all short fruit materials had only 1 351bp band, 8 materials in 11 long fruit materials had 2 bands, and 3 had only 1 band. Overall, 21 phenotypes were consistent with genotype and 1 was not consistent in 24 validated materials (973), with a labeling accuracy of 95.8%, as shown in table 1.

TABLE 1

Claims (5)

1. The CAPS marker is characterized in that primer pairs CmFul-AluI-F and CmFul-AluI-R are adopted for amplification, and amplified fragments are subjected to AluI digestion, so that 1 strip with the length of 351bp is produced by the short fruit-shaped muskmelon; the long fruit-shaped thin-skin melon generates 2 bands with the lengths of 193bp and 158 bp;

CmFul-AluI-F：CATATTTAACTTTCATCGATTGCTAGG

CmFul-AluI-R：GTAGCTCCTTGACTACTAAGTAACT。

2. The CAPS tag of claim 1, wherein the reaction procedure for amplifying the CAPS tag is: 94 ℃ for 5min;95 ℃, 10s,60 ℃, 10s,72 ℃, 10s,45 cycles; 95 ℃, 5s,65 ℃, 1min,40 ℃ and 30s.

3. The CAPS tag of claim 1, wherein a reaction system for amplifying the CAPS tag consists of, in 25 ul: 10Mmol/L forward primer 0.5ML, 10Mmol/L reverse primer 0.5ML, 100ng template DNA, kod One Hi-Fi enzyme 12.5ul.

4. The CAPS tag of claim 1, wherein the cleavage reaction system comprises, in 15 ul: 4ul of PCR product, 10 XBuffer 1.5ul, 0.5ul of restriction enzyme, and enzyme cutting at 37 ℃ for 1h.

5. Use of a reagent for detecting the CAPS marker of the muskmelon length gene of claim 1 in molecular breeding of muskmelon length traits.