CN117903954A - Morchella esculenta strain KS5 and cultivation method thereof - Google Patents

Abstract

The invention relates to the technical field of edible fungus cultivation, in particular to a Morchella esculenta strain KS5 and a cultivation method thereof. The strain is preserved in China general microbiological culture collection center (CGMCC No. 40978) at the date of 2023, 11 and 13, and the preservation address is the No. 3 West Song No. 1 of the Korean region beichen of Beijing city. After the strain KS5 provided by the invention is cultivated, the average acre yield is up to 842.92 kg/acre, the highest acre yield is 916.29 kg/acre, and the acre yield is far higher than that of the existing Morchella esculenta; meanwhile, the fruiting temperature range of the strain is wide (6-24 ℃), the culturable region of Morchella is enlarged, fruiting is neat, the property is good, and the strain has strong stress resistance.

Description

Morchella esculenta strain KS5 and cultivation method thereof

Technical Field

The invention relates to the technical field of edible fungus cultivation, in particular to a Morchella esculenta strain KS5 and a cultivation method thereof.

Background

Morchella (Morchella esculenta) is a rare edible and medicinal fungus belonging to ascomycota (Ascomycota), pantoea (Pezizomycetes), pantoea (Pezizales) and Morchelidae (Morchellaceae), has rich nutrition and unique flavor, has various effects of enhancing immunity, resisting fatigue and virus, resisting tumor, strengthening spleen and stomach, and has important research and development values in the aspects of food, medicine, health care, and the like.

In recent years, the market demand for Morchella is increasing, and there are a plurality of problems in the Morchella industry, wherein the limit of the Morchella cultivar in China is one of the main problems, and at present, the main cultivars are only 3 species of Morchella (Morchella sextelata), morchella eximia (Morchella eximia) and Morchella terrae (Morchella importuna). The Morchella esculenta has high yield but poor stress resistance; the Morchella esculenta has strong stress resistance, but lower yield; morchella conica is the earliest variety of Morchella conica, but the planting area is smaller and smaller due to strain degradation. The yield of the Morchella esculenta is high, so that the planting area of the Morchella esculenta is far more than that of other two varieties.

It was found that Morchella contains 2 mating type genes (MAT 1-1 and MAT 1-2), and that the simultaneous presence of these 2 mating type genes may be a necessary condition for the production of fruiting bodies. However, at present, a tissue separation method is often adopted to obtain Morchella strains, but Morchella cell nuclei are easy to migrate unevenly in the tissue separation and subculture process, so that a certain genotype in the strain is reduced or deleted, and the yield is reduced or even the Morchella strain is disabled.

Disclosure of Invention

Aiming at the technical problems, the invention provides the seven-sister morchella strain KS5 and the cultivation method thereof, wherein the fruiting temperature of the seven-sister morchella strain KS5 is 6-24 ℃, the fruiting is neat, the properties are good, the yield is high, and the stress resistance is strong.

In order to achieve the aim of the invention, the invention adopts the following technical scheme:

In a first aspect, the present invention provides a Morchella esculenta (Morchella eximia) strain KS5, which is deposited in China general microbiological culture Collection center (CGMCC) at a deposition number of CGMCC No.40978 and at a deposition address of Ganyang region beichen, west-way No.1, no. 3 in Beijing city, at 11-13 days of 2023.

Crossbreeding is a common breeding method, and a parent with more advantages, advantages and disadvantages complementation and required properties is selected for hybridization to obtain a hybrid individual meeting specific requirements. Based on the crossbreeding technology, the inventor selects high-quality Morchella monogenic strains for hybridization, genotype detection is carried out on the hybridosome, and finally, strain KS5 which can ensure stable yield, high yield and high quality is screened out through fruiting test.

In a second aspect, the present invention provides a method for preparing a mother strain and a stock strain of the strain KS5, comprising the steps of:

Preparing a culture medium, sterilizing, inoculating the strain KS5 into a first culture dish filled with the culture medium under aseptic conditions, and culturing to obtain a mother strain of the strain KS 5; after the hypha in the first culture dish grows to be full, under the aseptic condition, taking a bacterial cake, transferring the bacterial cake into a second culture medium, and culturing to obtain the stock strain KS 5.

The preparation method of the parent strain and the stock strain of the strain KS5 provided by the invention can be used for obtaining the parent strain and the stock strain by culturing only using a culture medium without a strain culture material, and has the advantages of simple steps and greatly shortened preparation time of the stock strain.

Preferably, the culture medium is PDA culture medium, and the formula composition of 20wt% potato, 2wt% glucose and 1.2wt% agar can be selected, and the pH is natural.

Preferably, the sterilization conditions are sterilization at 115 ℃ for 30 minutes.

Preferably, the culture temperature of the mother seeds and the stock seeds is 12-14 ℃.

In a third aspect, the present invention provides a method for preparing cultivars of the strain KS5, specifically: preparing a culture medium, filling the culture medium into a culture bag, sterilizing at 121 ℃, inoculating the stock strain of the strain KS5, and culturing at 12-14 ℃ until the bag is full of the stock strain to obtain the culture strain of the strain KS 5.

The preparation method of the cultivar provided by the invention can ensure that the stock can normally grow and reproduce under the conditions provided by the method, is simple to operate, and is easy to realize industrialization.

With reference to the third aspect, the cultivation medium comprises 30wt% to 40wt% of a cultivation material and 60wt% to 70wt% of water; wherein the culture material comprises 50 to 70 weight percent of wheat grains, 10 to 25 weight percent of bran, 15 to 35 weight percent of corncob, 0.5 to 1 weight percent of gypsum and 0.5 to 1 weight percent of quicklime.

Preferably, the cultivation medium comprises 40wt% of the cultivation material and 60wt% of water; wherein the culture medium comprises 58wt% of wheat grains, 12wt% of bran, 28wt% of corncob, 1wt% of gypsum and 1wt% of quicklime.

In a fourth aspect, the present invention provides a cultivation method of the strain KS5, comprising the steps of:

s1, uniformly furrow-sowing or broadcasting the crushed cultivars on the surface of a furrow bed according to the sowing amount of 150-250 kg/mu, and covering soil for 2-3 cm;

S2, placing nutrition bags according to the standard of 2600-3000 bags/mu when hyphae germinated on the surface of the bed become white 7-15 days after sowing;

s3, covering a mulch film with holes, and controlling the air temperature below 15 ℃;

S4, mushroom forcing and fruiting management are carried out, and the normal growth of young mushrooms is ensured.

The cultivation method of the strain KS5 provided by the invention can ensure that hyphae thrive and grow, fruiting is neat, and the obtained Morchella has good shape and strong stress resistance.

Preferably, the seed sowing amount of the cultivars is 200 kg/mu.

With reference to the fourth aspect, in step S2, the nutrition bag contains 35wt% to 40wt% of nutrients and 60wt% to 65wt% of water; wherein the nutrient substances comprise 45-55wt% of wheat grains, 10-20wt% of bran, 15-35wt% of corncob, 0.5-1wt% of gypsum and 0.5-1wt% of quicklime.

Preferably, the placing space of the nutrition bags can be 25-35 cm, a way of placing at intervals is adopted, one side of the nutrition bags is cut for 2 times, the cut is downward and buckled on the surface of a bed where mycelia are fully grown, and the mycelia of Morchella esculenta fully contact with nutrient substances in the nutrition bags by slightly compacting with force.

Illustratively, the mushroom forcing is specifically that when the weight of the nutrition bag is obviously reduced, the mushroom forcing is carried out by watering, and the primordium is found after watering for 1-3 days.

With reference to the fourth aspect, in step S4, the fruiting management specifically includes: the humidity of the air in the greenhouse is kept between 85RH and 95RH, the temperature is between 6 and 24 ℃, and ventilation is carried out for 30 to 60 minutes each day.

In a fifth aspect, the invention provides an application of the strain KS5 in Morchella cultivation production. The strain KS5 provided by the invention is applied to cultivation production of Morchella, can greatly improve the mu yield of Morchella esculenta, and has wide application prospect.

The beneficial effects of the invention are as follows: according to the invention, a strain KS5 of Morchella esculenta (Morchella eximia) is obtained through screening by utilizing a hybridization breeding technology, the average mu yield of the strain can reach 842.92 kg/mu, the highest mu yield is 916.29 kg/mu, and the mu yield is far higher than that of the existing Morchella esculenta; meanwhile, the fruiting temperature range of the strain is wide (6-24 ℃), the culturable region of Morchella is enlarged, fruiting is neat, the property is good, and the strain has strong stress resistance.

Drawings

FIG. 1 shows the morphology of the strain KS5 obtained in example 5 of the present invention, wherein (a) is a photograph of the obtained strain and (b) is a photograph of a longitudinal section of the strain;

FIG. 2 is a photograph of the result of electrophoresis detection corresponding to the primer sequence No. 12 in example 2 of the present invention, wherein M represents DL2000plas molecular marker, and the bands are 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp in order from top to bottom; YD1 is the original parent strain, Y87 is the MT1-1 single genotype hybridization parent strain, Y83 is the MT1-2 single genotype hybridization parent strain, KS5 is the hybridization strain of Y83 xY 87;

FIG. 3 is a photograph showing the result of electrophoresis detection corresponding to the primer sequence No. 50 in example 2 of the present invention, wherein M represents DL2000plas molecular marker, and the bands are 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp in order from top to bottom; YD1 is the original parent strain, Y87 is the MT1-1 single genotype hybridization parent strain, Y83 is the MT1-2 single genotype hybridization parent strain, KS5 is the hybridization strain of Y83 xY 87;

FIG. 4 is a photograph of a strain KS5 of example 5 of the present invention after fruiting;

FIG. 5 is a photograph showing the experiment of the strain KS5 in the experimental example of the present invention against the parent strains Y83 and Y87 for hybridization.

Detailed Description

The present invention will be described in further detail with reference to specific embodiments in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

In the following examples, the original parent strain used was YD1, which was obtained by gifting by others.

The PDA solid medium is adopted in the following examples, and the specific preparation method is as follows:

Cutting 200g of potato into pieces, putting into boiling water, boiling for 30min, filtering, adding 20g of glucose and 12g of agar, adding distilled water to 1000mL, stirring and heating until the agar is dissolved, subpackaging into 500mL triangular bottles, subpackaging into 250-300 mL bottles, and sterilizing at 115 ℃ for 30 min.

Unless otherwise indicated, the test procedures used in the examples below were all conventional in the art, and the reagents and media used were all those commonly used in the art.

Example 1

The embodiment of the invention provides a separation and screening method of a Morchella esculenta strain KS5, which specifically comprises the following steps:

1. Acquisition of isolated strains of monospora

Introducing YD1 test tube seed for cultivation to obtain mature Morchella fruit body, selecting good fruit body and collecting ascospores, taking appropriate amount of sterile water for stepwise dilution to obtain spore suspension with concentration of 10 ^-3～10^-1, taking 100 μl, coating on PDA solid culture medium with a coater, culturing at 20deg.C in dark, selecting 98 strains of fast germination and strong growth, taking mycelium tip with a 5mm puncher, inoculating into PDA solid culture medium, and culturing.

2. Determination of hypha growth Rate at different temperatures

After 98 strains obtained by screening grow on a culture dish, a puncher is used for taking a 5mm fungus cake at the edge of the culture dish, the fungus cake is inoculated to the center of the culture dish containing 20mL of PDA solid culture medium, the culture is respectively carried out at 12.5 ℃ and 25 ℃, the diameter of hypha of each strain is respectively measured when the strain is cultured for two days, and the hypha growth speed is calculated.

3. Mating identification

3.1 Genomic DNA extraction

0.1G of each of the above strains (98 strains in total) was weighed and ground in liquid nitrogen, and genomic DNA was extracted with a kit, and the specific method was described in the "plant genomic DNA extraction kit (centrifugal column type)" of Tiangen Biotech (Beijing) Co., ltd.

Primers MAT1-1-1TF/R (sequence shown as SEQ ID NO. 1) and MAT1-2-1TF/R (sequence shown as SEQ ID NO. 2) were designed according to literature.

3.2 PCR amplification

The 20. Mu.L system was used for amplification using the extracted genomic DNA as a template, wherein 2X TAQ PCR MASTER Mix 10. Mu.L of each primer was 0.5. Mu.L, 20ng of DNA template, and 20. Mu.L of ddH2O were filled in. The PCR amplification conditions were initial denaturation at 94℃for 3min, denaturation at 94℃for 30s, annealing at 60℃for 15s, extension at 72℃for 30s,35 cycles, and extension at 72℃for 5min.

3.3 Electrophoresis detection

And (3) carrying out electrophoresis detection on the PCR amplification product by adopting 1% agarose gel, and obtaining a single specific band.

4. Pairing and screening of single genotype high quality strains

6 MAT1-1 genotype strains and 6 MAT1-2 genotype strains are selected according to the calculated hypha growth speed and mating type at different temperatures. The screened total 12 monogenic strains are paired in pairs respectively, 3-5 days after antagonistic lines are generated, 5mm bacterial cakes are taken on the antagonistic lines and transferred to a PDA solid culture medium, the strains with fast hypha growth speed and strong growth vigor are respectively cultured at 12.5 ℃ and 25 ℃, gametophyte genotypes are identified, and 7 double-genotype strains are obtained.

5. Cultivation and screening

The 7 strains obtained were subjected to cultivation experiments, and by comparing the yield, quality and stress resistance of each strain, one target strain KS5 was obtained, the hybrid parent strains of which were Y87 (MAT 1-1 genotype) and Y83 (MAT 1-2 genotype).

The obtained strain KS5 has long fungus cover, short fungus handle, uneasy breaking, regular fruiting and high yield, and belongs to high-quality strains.

Example 2

The embodiment of the invention provides an identification method of a Morchella esculenta strain KS5, which specifically comprises the following steps:

1. morphology observations of Strain KS5

The KS5 strain fruiting body is single-born and a small amount of clusters are clustered. The fungus cover is nearly cylindrical, the top is blunt and round, the longitudinal edges are obvious and dense, and the color is green brown to grey brown; the length of the fungus cover is 90.09 +/-9.80 mm, the width of the fungus cover is 48.24+/-6.09 mm, the length/width of the fungus cover is 1.88+/-0.13, and the thickness of the fungus cover is 10.3+/-1.00 mm. The length of the fungus handle is 22.6 plus or minus 3.43mm, the diameter is 23.31 plus or minus 4.25mm, the color is white, the concave of the junction of the fungus cover and the fungus handle is obvious, and the longitudinal section of the fungus handle is rectangular. As shown in fig. 1.

2. ITS authentication

2.1 Genomic DNA extraction

0.1G of mycelium of strain KS5 was weighed and ground in liquid nitrogen, and genomic DNA was extracted with a kit, and the specific method was described in "plant genomic DNA extraction kit (centrifugal column type) of Tiangen Biochemical technology (Beijing)" instruction manual.

2.2 PCR amplification

The fungus ITS sequence universal primer ITS1 (the sequence is shown as SEQ ID NO. 3) is adopted to amplify the genome DNA extracted as a template. Wherein, PCR amplification was performed using a 50. Mu.L system in which 2X TAQ PCR MASTER Mix 25. Mu.L each of the primers was 1. Mu.L, 40ng of DNA template, and ddH2O was filled to 50. Mu.L. PCR amplification conditions: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 40s, renaturation at 52 ℃ for 1min, extension at 72 ℃ for 1min, total 35 cycles, heat preservation at 72 ℃ for 5min and preservation at 4 ℃.

2.3 Sequencing

The PCR products were detected by 0.8% agarose gel electrophoresis, and single specific bands were obtained by electrophoresis detection. And then the PCR product is sent to a biological engineering (Shanghai) stock company for sequencing, the ITS sequence obtained by sequencing is shown as SEQ ID NO.4, specifically AATTTTTTTATTAATCTCTTTAATAAGGGCAGCCGAGGGGCCAACCAGGGCTAGTAGCTTTACGTTGTTGAACGTCCTGGAACGGACCCGGAGCCGCCCCCATCTAAACACTCTGCGTACCCATCCCACCTTGCTTCCCCCGGCCATCCGCTGGGGGGAGGAACAACAACCAAAACTCTTTGTGAAGAAACAGACGTCAGAATCATAACAAAAAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTGATTACTATCGTTGGGGGGTATTGGCCTACTGGGAAAGCGATTTGGCAATTGCCTTCCCACTGTCCTAAATACACTTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGAATACCGTTCTCCACACGCCGATGGCAAACCGGTCGCAGTTGCGGGCGTAAATTGGAGCCCTCTTCAGGACCCTCGTGGCCTAGCATCCACCATACACATTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAAGCGGAGGAA., and homologous DNA sequence searching and alignment are carried out by using BLAST tool software in GenBank, and the result shows that KS5 belongs to ascomycota, pantoea, morchelidae, morchella and Morchella esculenta (Morchella eximia).

The obtained Morchella esculenta (Morchella eximia) strain KS5 is preserved in China general microbiological culture Collection center (CGMCC No. 40978) at 11 and 13 days of 2023, and the preservation address is beichen XILU No. 1, 3 of the Korean region of Beijing city.

3. ISSR identification

The authenticity analysis of the strain KS5 is carried out according to the edible fungus strain authenticity identification ISSR method (NY/T1730-2009) and the existing literature reports of the agricultural industry standard of the people's republic of China. The specific identification method comprises the following steps:

3.1 genomic DNA extraction

The genomic DNA used in the experiment is extracted by using a CTAB method, and the specific method is as follows:

① 0.2g of mycelium of strain KS5 was taken, placed in a mortar, and sufficiently ground into powder in liquid nitrogen.

② Rapidly transferring mycelium powder into a 1.5mL centrifuge tube, adding 800 mu L of CTAB extraction buffer preheated at 65 ℃, uniformly mixing, placing in a water bath at 65 ℃ for 40-60 min, and gently mixing once every 15-20 min.

③ The cleaved DNA was added with 500. Mu.L of chloroform/isoamyl alcohol (24:1), gently mixed, allowed to stand for 15min, and centrifuged at 4℃for x12000rpmx min.

④ Transferring the supernatant to a new 1.5mL centrifuge tube, adding the pre-cooled isopropanol with the equal volume of-20 ℃, slowly and uniformly mixing, and then vigorously mixing to enable the DNA to be agglomerated overnight at-20 ℃.

⑤ The precipitated DNA was centrifuged at 4℃for x12000rpmx min.

⑥ The supernatant was removed and the pellet was washed with 500. Mu.L of 75% ethanol, centrifuged at 4℃for x12000rpmx min, washed again and centrifuged at 4℃for x12000rpmx min.

⑦ Centrifuge at 4℃for x3000rpmx min, remove ethanol by complete evaporation, dissolve in 100. Mu.L ddH ₂ O and leave to dissolve at 4 ℃.

The K5800 ultramicro spectrophotometer measures the concentration and purity of DNA.

3.2 PCR amplification

The total volume of the PCR reaction was 20. Mu.L, containing 1. Mu.L of template DNA, 1. Mu.L of primer, 10. Mu. L TAQ PCR MASTER Mix, 8. Mu.Ldd H ₂ O. The following cycles were performed on a PCR amplification instrument: initial denaturation at 95℃for 5min, then denaturation at 95℃for 15s, renaturation at 5℃for 15s and extension at 72℃for 20s, which are lower than the Tm of the primers, for 35 cycles, extension at 72℃for 5min and preservation at 4 ℃.

From the 50 primers, 10 primers with obvious amplification and good polymorphism are selected, and the sequences and numbers of the primers are shown in Table 1.

TABLE 1

3.3 Electrophoresis detection

The PCR amplified products were electrophoretically detected using 1% agarose gel: taking 4 mu L of PCR amplified product sample, switching on a power supply for electrophoresis, and stopping electrophoresis when bromophenol blue is about 1cm away from the front edge of the gel by 120V voltage. Gel observation and photography were performed on a gel imager.

FIGS. 2 and 3 are photographs showing the results of electrophoresis detection corresponding to the primer sequences numbered 12 and 50 in Table 1, respectively, and it is understood that the strain KS5 and its hybrid parent strain Y87 (MAT 1-1 genotype), Y83 (MAT 1-2 genotype) and the original parent strain YD1 all belong to different strains.

Example 3

The embodiment provides a method for preparing a mother strain and a stock strain of a strain KS5, which comprises the following steps:

Preparing a PDA solid culture medium according to the method, sterilizing for 30 minutes at 115 ℃, and inoculating the strain KS5 into the culture medium for culturing under the aseptic condition to obtain a mother strain of the strain KS 5; after the culture dish is full of the mycelia of the mother strain, under aseptic conditions, transferring a 5mm fungus cake into another culture medium for culture to obtain the stock strain KS 5.

Wherein, the formula of the PDA culture medium is as follows: 20wt% of potato, 2wt% of glucose and 1.2wt% of agar, and the pH is natural. The culture temperature of the mother strain and the stock strain is 12-14 ℃.

Example 4

The embodiment provides a preparation method of cultivars of bacterial strain KS5, which comprises the following steps:

Preparing a cultivation medium: the formula comprises 40wt% of culture material and 60wt% of water, wherein the culture material comprises 58wt% of wheat grains, 12wt% of bran, 28wt% of corncob, 1wt% of gypsum and 1wt% of quicklime, and the wheat grains and the corncob are subjected to the following pretreatment: soaking wheat grains with lime water with mass concentration of 1% until no white core, soaking corn cob with enough water, and fermenting.

The prepared cultivation medium is filled into polypropylene plastic bags (namely cultivation bags) with the size of 16cm multiplied by 33.5cm multiplied by 0.02cm, the dry material weight of each bag is controlled to be 250-300 g, the sterilization is carried out at the temperature of 121 ℃, then the obtained stock strain KS5 is inoculated, and the cultivation is carried out at the temperature of 12-14 ℃ until the bags are full, so that the cultivation seeds of the strain KS5 are obtained.

Example 5

The embodiment provides a cultivation method of a strain KS5, which comprises the following steps:

The cultivars obtained in example 4 were crushed and uniformly spread on the surface of the bed according to a sowing amount of 200 kg/mu, and covered with 2-3 cm of soil.

7-15 Days after sowing, when hyphae germinated on the surface of the bed become white, placing a nutrition bag according to the standard of 2800 bags/mu, wherein the formula composition in the nutrition bag comprises 40wt% of nutrient substances and 60wt% of water, and the nutrient substances specifically comprise 50wt% of wheat grains, 15wt% of bran, 33wt% of corncobs, 1wt% of gypsum and 1wt% of quicklime. The specification of the nutrition bag is 16cm multiplied by 33.5cm multiplied by 0.02cm, each bag has a dry material weight of 380-420 g, and the nutrition bag is sterilized at 121 ℃ for use. In addition, the placing space of the nutrition bags is about 30cm, a way of placing at intervals is adopted, a mouth is cut on one side of the nutrition bags for 2 times, the mouth is downward, the mouth is buckled on the surface of a bed where mycelia are grown, and the mycelia of Morchella esculenta are compacted slightly with force, so that the mycelia of Morchella esculenta fully contact with nutrient substances in the nutrition bags.

Covering the surface with perforated black plastic film, maintaining uniform ventilation, and controlling air temperature below 15deg.C.

When the weight of the placed nutrition bag is obviously reduced, watering and promoting mushroom. And (5) watering for 1-3 days to obtain the primordium. The air humidity in the shed is kept at 85-95 RH%, the temperature is kept at 6-24 ℃ during fruiting, ventilation is carried out for 30-60 min each day, and the normal growth of young mushrooms is ensured.

See fig. 4 for a specific growth scenario.

When the morchella fruiting body is not expanded, the ridges and the concave pits are clear, and the meshes of the pileus are fully opened, the morchella fruiting body is mature, and the morchella fruiting body is harvested.

Comparative example 1

The comparative example uses Morchella strain YD1 collected in the field as a control strain, and is planted according to the preparation methods of the mother strain, the stock strain and the cultivar provided in examples 3 to 5 and the cultivation method of the cultivar, and the external conditions are the same as those in examples 3 to 5, except that strain KS5 is replaced with strain YD1.

Test example

When harvesting morchella obtained in example 5 and comparative example 1, 3 cells were randomly measured in each of the planting areas of strain KS5 and original parent strain YD1, each cell was 5.6m ², the yield of each cell was counted, and the acreage yield (kg/acreage) =cell yield/5.6 m ²*667m² x 0.7,0.7 was calculated as a conversion factor). The specific statistical results are shown in table 2.

TABLE 2

As can be seen from the data in Table 2, compared with the existing wild Morchella strain YD1, the yield per mu of the strain KS5 provided by the invention is obviously improved, and the average yield per mu is improved by up to 31.8%.

Experimental example

The strain KS5 provided by the invention and the hybrid parent strains Y83 and Y87 are subjected to a counter experiment, the culture medium is a PDA solid culture medium prepared according to the method, and a plate with the diameter of 9cm is adopted, and the specific method is as follows: strain KS5 and its hybrid parent strains Y83 and Y87 were inoculated into the medium in a triangular shape and each 2cm from the center of the dish, and incubated at 12.5 ℃.

As shown in FIG. 5, the results of the culture in the opposite experiment show that the antagonistic lines of the strain KS5 and the hybridized parent strains Y83 and Y87 are obvious at the junction of the colonies, which indicates that the strain KS5 obtained by screening in the invention is not the same strain as the hybridized parent strains Y83 and Y87, and the strain KS5 obtained by screening in the invention is a novel Morchella esculenta strain.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, or alternatives falling within the spirit and principles of the invention.

Claims (10)

1. A Morchella eximia (Morchella eximia) strain KS5 is characterized in that the Morchella eximia strain KS5 is preserved in China general microbiological culture collection center (CGMCC) at the 11 th month 13 of 2023, and the preservation number is CGMCC No.40978 and the preservation address is beichen XILU No.1 and 3 in the Korean region of Beijing city.

2. A method for producing a mother strain and a stock strain of the strain KS5 of claim 1, comprising the steps of:

preparing a culture medium, sterilizing, inoculating the strain KS5 into a first culture dish filled with the culture medium under aseptic conditions, and culturing to obtain a mother strain of the strain KS 5;

after the hypha in the first culture dish grows to be full, under the aseptic condition, taking a bacterial cake, transferring the bacterial cake into a second culture medium, and culturing to obtain the stock strain KS 5.

3. The method of claim 2, wherein the sterilization conditions are sterilization at 115 ℃ for 30 minutes.

4. The method according to claim 2, wherein the culture temperature of the mother seed and the stock seed is 12 to 14 ℃.

5. A method for preparing a cultivar of the strain KS5 according to claim 1, wherein a cultivation medium is prepared, the cultivar is filled into a cultivation bag, the cultivation bag is sterilized at 121 ℃, an original strain of the strain KS5 is inoculated, and the cultivation bag is fully filled with the strain KS5 cultivar at 12-14 ℃.

6. The method of claim 5, wherein the cultivation medium comprises 30wt% to 40wt% of the cultivation material and 60wt% to 70wt% of water;

Wherein the culture material comprises 50 to 70 weight percent of wheat grains, 10 to 25 weight percent of bran, 15 to 35 weight percent of corncob, 0.5 to 1 weight percent of gypsum and 0.5 to 1 weight percent of quicklime.

7. A method of cultivating strain KS5 according to claim 1, comprising the steps of:

s1, uniformly furrow-sowing or broadcasting the crushed cultivars on the surface of a furrow bed according to the sowing amount of 150-250 kg/mu, and covering soil for 2-3 cm;

S2, placing nutrition bags according to the standard of 2600-3000 bags/mu when hyphae germinated on the surface of the bed become white 7-15 days after sowing;

s3, covering a mulch film with holes, and controlling the air temperature below 15 ℃;

S4, mushroom forcing and fruiting management are carried out, and the normal growth of young mushrooms is ensured.

8. The method of cultivating strain KS5 as claimed in claim 7, wherein in step S2, the nutrition bag contains 35wt% to 40wt% of nutrients and 60wt% to 65wt% of water;

wherein the nutrient substances comprise 45-55wt% of wheat grains, 10-20wt% of bran, 15-35wt% of corncob, 0.5-1wt% of gypsum and 0.5-1wt% of quicklime.

9. The method of cultivating strain KS5 according to claim 7, wherein in step S4, the fruiting management is specifically: the humidity of the air in the greenhouse is kept between 85RH and 95RH, the temperature is between 6 and 24 ℃, and ventilation is carried out for 30 to 60 minutes each day.

10. Use of a strain KS5 according to claim 1 in Morchella cultivation.