CN117866954A - Application of circular RNA hsa_circ_0067842 as breast cancer prognosis marker and in treatment target - Google Patents

Abstract

The invention belongs to the technical field of biological medicines, and relates to a breast cancer prognosis marker, a treatment target and application thereof. The hsa_circ_0067842 can be used as a biomarker for prognosis of breast cancer and a treatment target point for the first time, and provides a new idea for prognosis and treatment of breast cancer; compared with normal tissues, the research of the invention shows that hsa_circ_0067842 is obviously up-regulated in tumor tissues of breast cancer patients, and has better clinical application value when being used as a molecular marker; the results of the present invention indicate that hsa_circ_0067842 is present in both the nucleus and cytoplasm of breast cancer cells. The interference hsa_circ_0067842 can inhibit migration and invasion capacity of breast cancer cells, which shows that hsa_circ_0067842 plays a role in promoting oncogenes in the occurrence and development of breast cancer, provides a new thought for clinical treatment of breast cancer, and is expected to become a new treatment target of breast cancer.

Description

Application of circular RNA hsa_circ_0067842 as breast cancer prognosis marker and in treatment target

Technical Field

The invention belongs to the technical field of biological medicines, and relates to a breast cancer prognosis marker, a treatment target and application thereof.

Background

Breast cancer is one of the highest malignant tumors of women worldwide, and is also the main cause of cancer death in women, and the incidence and mortality rate of breast cancer are in the forefront and show a rising trend year by year. Recent statistics in 2020 indicate that breast cancer has become the first cancer, the number of new cases worldwide is about 230 ten thousand, the number of dead cases is about 69 ten thousand, and the morbidity (11.7%) and the mortality (6.9%) of the breast cancer are the first in female malignant tumor, which seriously threatens female life health. In China, the current situation of breast cancer is also severe, the incidence rate of the breast cancer is the first in female malignant tumors, the age-standardized rate shows an ascending trend, 30-59 year old females are taken as high incidence, the incidence rate shows a younger trend, and huge burden is caused to families and society. Breast cancer is a highly heterogeneous disease with multi-factor combined action, the main high risk factors causing the breast cancer are genetic factors, reproductive factors, high-fat diet and the like, in addition, the occurrence of metastasis is closely related to the poor prognosis of breast cancer patients, and more than 90% of death cases are caused by metastasis. Therefore, the timely and accurate treatment of breast cancer directly affects the prognosis of breast cancer patients. The novel high-sensitivity and high-specificity breast cancer treatment target spot is explored, the prognosis of a breast cancer patient is improved, the long-term life quality is improved, and the novel high-sensitivity and high-specificity breast cancer treatment target spot is a focus and difficulty of clinical attention in recent years.

The circular RNA is a special non-coding RNA molecule with a covalent closed circular structure, does not have a 5 'cap structure and a 3' polyadenylation tail, can resist digestion of exonuclease, exists more stably in various body fluids than linear RNA, has a tissue-specific or developmental stage-specific expression mode, and is an ideal molecular marker. In recent years, studies have shown that circular RNAs can be involved in the progression of different diseases in a variety of ways. Circular RNAs exert biological functions mainly by the following 4 ways: (1) Molecular sponges as micrornas, i.e., competitive endogenous RNA mechanisms; (2) the effect of binding, anchoring or sequestering proteins; (3) regulating transcription of the parent gene; (4) encodes a peptide or protein having a function.

In recent years, the relationship of circular RNAs to cancers has become a research hotspot in the field of cancer research, and more circular RNAs have been demonstrated to be aberrantly expressed in various human cancers including breast cancer. Circular RNAs have been found to be involved in tumor cell proliferation, apoptosis, epithelial-to-mesenchymal transition (EMT), migration, invasion, and angiogenesis, etc., i.e., circular RNAs play an important role in tumor biological processes and are increasingly becoming molecular markers for tumor diagnosis, treatment, and prognosis. Therefore, based on the abnormal expression and biological functions of the annular RNA in the breast cancer, the novel annular RNA is researched and found to be used as a molecular therapeutic target and a prognosis marker of the breast cancer, and has profound clinical significance for improving the five-year survival rate of breast cancer patients and improving the prognosis of the breast cancer.

Disclosure of Invention

Aiming at the problems existing in the traditional breast cancer treatment and prognosis, the invention provides a novel circular RNA hsa_circ_0067842 serving as a breast cancer prognosis marker and application thereof in a treatment target.

In order to achieve the above purpose, the invention is realized by adopting the following technical scheme:

according to the invention, 6 breast cancers and tissues beside paired cancers are selected from a tissue specimen library, high-throughput chip analysis is performed after quality inspection is qualified, differential expression annular RNA analysis is performed by using a bioinformatics method, and hsa_circ_0067842 with remarkably high expression is selected as a research target. In addition, the expression level of hsa_circ_0067842 is verified in 126 breast cancer tissues and 59 normal tissue samples by using a tissue chip technology, and the expression level of hsa_circ_0067842 in the breast cancer tissues is found to be significantly up-regulated, and survival analysis results show that hsa_circ_0067842 is related to shorter total survival time and disease-free survival time; in vitro functional experiments show that hsa_circ_0067842 can promote migration and invasion capacity of breast cancer cells.

In a first aspect, the present invention provides a circular RNA hsa_circ_0067842 derived from human chromosome 3, cyclized from exons 12-17 of the SMC4 gene, having the deoxyribonucleotide sequence SEQ ID NO.1 of hsa_circ_0067842 of

>hsa_circ_0067842|NM_005496|SMC4

GGGGACTTAGGAGCCATTGATGAAAAATACGACGTGGCTATATCATCCTGTTGTCATGCACTGGACTACATTGTTGTTGATTCTATTGATATAGCCCAAGAATGTGTAAACTTCCTTAAAAGACAAAATATTGGAGTTGCAACCTTTATAGGTTTAGATAAGATGGCTGTATGGGCGAAAAAGATGACCGAAATTCAAACTCCTGAAAATACTCCTCGTTTATTTGATTTAGTAAAAGTAAAAGATGAGAAAATTCGCCAAGCTTTTTATTTTGCTTTACGAGATACCTTAGTAGCTGACAACTTGGATCAAGCCACAAGAGTAGCATATCAAAAAGATAGAAGATGGAGAGTGGTAACTTTACAGGGACAAATCATAGAACAGTCAGGTACAATGACTGGTGGTGGAAGCAAAGTAATGAAAGGAAGAATGGGTTCCTCACTTGTTATTGAAATCTCTGAAGAAGAGGTAAACAAAATGGAATCACAGTTGCAAAACGACTCTAAAAAAGCAATGCAAATCCAAGAACAGAAAGTACAACTTGAAGAAAGAGTAGTTAAGTTACGGCATAGTGAACGAGAAATGAGGAACACACTAGAAAAATTTACTGCAAGCATCCAGCGTTTAATAGAGCAAGAAGAATATTTGAATGTCCAAGTTAAGGAACTTGAAGCTAATGTACTTGCTACAGCCCCTGACAAAAAAAAGCAGAAATTGCTAGAAGAAAACGTTAGTGCTTTCAAAACAGAATATGATGCTGTGGCTGAGAAAGCTGGTAAAGTAGAAGCTGAGGTTAAACGCTTACACAATACCATCGTAGAAATCAATAATCATAAACTCAAGGCCCAACAAGACAAACTTGATAAAATAAATAAGCAATTAGATGAATGTGCTTCTGCTATTACTAAAGCCCAAGTAGCAATCAAGACTGCTGACAG the position of the circular RNA hsa_circ_0067842 in the chromosome is shown in FIG. 2.

In a second aspect, the invention provides the use of the circular RNA hsa_circ_0067842 as a molecular biological marker for breast cancer. The expression level of hsa_circ_0067842 in a sample from a subject likely to have breast cancer is detected, wherein a higher expression level of hsa_circ_0067842 correlates with an increased likelihood of the subject having breast cancer and a poor prognosis.

In a third aspect, the invention discloses a primer pair specifically recognizing hsa_circ_0067842, the primer sequences are: forward CAAGGCCCAACAAGACAAACTTGA and reverse ATGGCTCCTAAGTCCCCCTG.

In a fourth aspect, the invention provides an application of the circular RNA hsa_circ_0067842 in preparing a breast cancer prognosis reagent or kit. The detection method of hsa_circ_0067842 molecular marker comprises the steps of total RNA extraction of a sample, RNA reverse transcription and real-time fluorescence quantitative PCR amplification. The method comprises the following specific steps: total RNA was extracted using the flyway fast2000 kit, second step: RNA was reverse transcribed into cDNA using Evo M-MLV RT Premix, beta-actin as an endogenous reference, and all RT-qPCR reactions were performed using SYBR Green Premix Pro Taq HS.

In a fifth aspect, the invention provides a specific small interfering RNA capable of down-regulating the expression level of circular RNA hsa_circ_0067842, and provides application thereof in preparing a medicament for treating breast cancer, wherein the sequence of the specific small interfering RNA is as follows

si-hsa_circ_0067842#1：

Forward direction UGCUGACAGGGGGACUUAGTT

Reverse CUAAGUCCCCCUGUCAGCATT;

si-hsa_circ_0067842#2：

forward direction GACUGCUGACAGGGGGACUTT

Reverse AGUCCCCCUGUCAGCAGUCTT.

The application of specific small interfering RNA for down regulating the expression level of circular RNA hsa_circ_0067842 in the preparation of medicaments for treating breast cancer is characterized in that the acting objects are MDA-MB-231 and MDA-MB-468 cell strains.

In a sixth aspect, the invention discloses the localization and biological functions exerted by hsa_circ_0067842 in breast cancer cells, and the probe sequence is:

5’Cy3-CCTAAGTCCCCCTGTCAGCAGTCTT-3’Cy3。

the invention provides application of circular RNA hsa_circ_0067842 as a novel potential breast cancer molecular prognosis marker and a treatment target, relates to screening, detection, functional analysis and application of hsa_circ_0067842, and designs and synthesizes a specific primer for real-time fluorescence quantitative PCR and small interfering RNA (siRNA) of in vitro interference hsa_circ_0067842. The circular RNA molecule hsa_circ_0067842, which was significantly highly expressed in breast cancer, was screened by high throughput chip analysis of 6 breast cancers and paracancerous tissues. The results of the verification by tissue specimen detection show that hsa_circ_0067842 is highly expressed in a tissue sample of a breast cancer patient compared with normal tissues and is related to prognosis of the breast cancer patient. Functional experimental results show that hsa_circ_0067842 can promote migration and invasion of breast cancer cells.

Compared with the prior art, the invention has the advantages and positive effects that:

1. the invention discovers that hsa_circ_0067842 can be used as a prognosis marker and a treatment target point of breast cancer for the first time, and provides a new idea for improving prognosis and treatment of breast cancer.

2. Research shows that hsa_circ_0067842 is significantly up-regulated in tumor tissues of breast cancer patients compared with normal tissues, and the hsa_circ_0067842 has better clinical significance when used as a molecular marker.

3. The results of the present invention indicate that hsa_circ_0067842 is present in both the nucleus and cytoplasm of breast cancer cells. The interference hsa_circ_0067842 can inhibit migration and invasion capacity of breast cancer cells, which shows that hsa_circ_0067842 plays a role in promoting oncogenes in the occurrence and development of breast cancer, provides a new thought for clinical treatment of breast cancer, and is expected to become a new treatment target of breast cancer.

Drawings

FIG. 1 is a volcanic plot of a data mining analysis of a circRNA chip showing the distribution of differentially expressed circRNA in breast cancer and paracancerous tissues (fold change >4 or <0.25, p < 0.001).

FIG. 2 is a schematic representation of the position of hsa_circle_ 0067842 on a chromosome.

FIG. 3 is a graph showing the results of detection of hsa_circ_0067842 expression level in breast cancer tissues. ^**** Represents the p value<0.0001。

FIG. 4 is a graph of the prognosis relationship of Kaplan-Meier analysis hsa_circ_0067842 with breast cancer patients.

FIG. 5 is a graph showing the results of measurement of the expression level of hsa_circ_0067842 in a breast cancer cell line and normal breast epithelial cells. ^* Represents the p value<0.05， ^** Represents the p value<0.01。

FIG. 6 is a graph showing the results of RNA fluorescence in situ hybridization, identifying subcellular localization of hsa_circ_0067842 (blue in the original image, nuclear DAPI, red, circular RNA hsa_circ_0067842 marker, color not shown after adjustment to black and white).

FIG. 7 is hsa_circ_0067842 Small Interfering RNA (SiR)NA) in MDA-MB-468 cell lines. si-NC represents a negative control group; si-hsa_circ_0067842#1, si-hsa_circ_0067842#2 represent groups of siRNAs targeting hsa_circ_0067842 reverse splice sites, respectively. ^*** Represents the p value<0.001， ^**** Represents the p value<0.0001。

FIG. 8 is a diagram of RT-qPCR validation of hsa_circ_0067842 small interfering RNA (siRNA) transfection knockdown efficiency in MDA-MB-231 cell lines. si-NC represents a negative control group; si-hsa_circ_0067842#1, si-hsa_circ_0067842#2 represent groups of siRNAs targeting hsa_circ_0067842 reverse splice sites, respectively. ^*** Represents the p value<0.001。

FIG. 9 is a graph showing the statistical results of the migration and invasion capacity changes of breast cancer cells MDA-MB-468 after the knockdown of circular RNA hsa_circ_0067842. ^** Represents the p value<0.01， ^*** Represents the p value<0.001。

FIG. 10 is a graph showing the statistical results of the migration and invasion capacity changes of breast cancer cells MDA-MB-231 after the circular RNA hsa_circ_0067842 was knocked down. ^** Represents the p value<0.01， ^*** Represents the p value<0.001。

Detailed Description

In order that the above objects, features and advantages of the invention will be more clearly understood, a further description of the invention will be provided with reference to specific examples. It should be noted that, in the case of no conflict, the embodiments of the present application and the features in the embodiments may be combined with each other.

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced otherwise than as described herein, and therefore the present invention is not limited to the specific embodiments of the disclosure that follow.

Example 1

This example provides the expression of hsa_circ_0067842 in breast cancer tissue and its relationship to prognosis.

1. Experimental materials and methods

1.1 clinical sample collection: collecting normal fresh tissues beside the breast cancer and corresponding cancers, wherein the sample collection standard is as follows: (1) a pathological examination is confirmed as breast cancer; (2) without incorporation of other malignancies or diseases; (3) no treatment such as any medicine or radiotherapy and chemotherapy is received before operation. Cleaning residual blood on the surface of the tissue with precooled PBS, sub-packaging on ice, rapidly quick-freezing in liquid nitrogen for 30min, and transferring to a-80 ℃ ultralow temperature refrigerator.

1.2 differential circRNA expression profile: high-throughput circRNA chip analysis was performed based on 6 cases of breast cancer and paracancerous normal tissues, setting default thresholds for the significant difference genes as: p is less than or equal to 0.001 and Fold change is less than or equal to 0.25 or more than or equal to 4.0, and a differential circRNA expression profile is obtained, as shown in figure 1.

1.3RNA extraction and real-time fluorescent quantitative PCR (RT-qPCR): total RNA from the tissue was extracted using Trizol reagent (Invitrogen, carlsbad, calif. USA); total RNA of the cells was extracted using RNA extraction kit fast2000 (Feijie, shanghai). The reverse transcription kit adopts Evo M-MLV RT Premix Kit (AG, hunan); the real-time fluorescent quantitative PCR kit adopts SYBR Green Premix Pro Taq HS qPCR Kit (AG, hunan); beta-actin is used as an internal reference; by 2 ^-ΔΔCt Calculating the relative expression quantity of RNA by a method; primers were synthesized by atactic boshang biotechnology limited; the primer sequences are shown in Table 1.

TABLE 1 primer sequences for RT-qPCR

1.4 statistical analysis: results were statistically analyzed using SPSS 23.0 software and plotted using GraphPad Prism 9.0 software. Statistical analysis was performed using t-test or Wilcoxon signed rank sum test as needed. Experimental data were obtained from three independent experiments, data expressed as mean ± standard deviation, all p values were double sided, and p <0.05 was considered statistically significant.

2. Experimental results:

2.1 in example 1, the present invention provides significantly differentially expressed circRNAs by analytical screening of high throughput circRNA chip data, see figure 1.

2.2 in example 1 hsa_circ_0067842 is derived from chromosome 3, see FIG. 2.

2.3 in example 1, the differentially expressed circular RNAs hsa_circ_0067842 were significantly up-regulated in breast cancer tissue, see figure 3. And its high expression is associated with a poor prognosis for breast cancer patients, see figure 4.

Example 2

This example provides subcellular localization of hsa_circ_0067842 in breast cancer cells and discusses the effect of interfering with expression of hsa_circ_0067842 on breast cancer cell migration and invasion.

1. Experimental materials and methods

1.1 cell lines and cell culture: the human breast cancer cell lines MDA-MB-468 and MDA-MB-231 and the human normal breast epithelial cell MCF-10A are all purchased from Shanghai life sciences of China academy of sciences. Breast cancer cell lines MDA-MB-468 and MDA-MB-231 were cultured in DMEM medium containing 10% fetal bovine serum, MCF-10A was cultured in DMEM-F12K medium containing 10% fetal bovine serum, insulin, hydrocortisone, 100U/ml penicillin streptomycin mixture was added, and the mixture was incubated at 37℃with 5% CO ₂ Is cultured in an environment of (a).

1.2 fluorescent in situ hybridization of RNA: the fluorescent in situ hybridization probe and the kit are designed and synthesized by the gene of the Jima (Shanghai), and are finished through cell fixation, prehybridization, hybridization and sealing, and the fluorescent position is observed by a confocal microscope for photographing analysis, wherein the sequence of the in situ hybridization probe is 5'Cy3-CCTAAGTCCCCCTGT CAGCAGTCTT-3' Cy3.

1.3 transfection: specific small interfering RNAs (sirnas) targeting hsa_circ_0067842 reverse splice sites and negative controls (si-NC) were synthesized from the Ji Ma gene (Shanghai); transferring the siRNA into colorectal cancer cells MDA-MB-468 and MDA-MB-231 by using Lipofectamine 2000; the siRNA sequences are shown in table 2, and the interference efficiencies are shown in fig. 7 and 8.

TABLE 2siRNA sequences

1.4Transwell migration experiments: the 24-well cell pool was placed into a 24-well plate with forceps using 200. Mu.l pure medium weightSuspension 4 x 10 ⁴ The transfected cells were added to the upper chamber. 650 μl of medium containing 20% fetal bovine serum was added to the lower chamber. 37 ℃,5% CO ₂ After 24-36h, PBS is used for washing three times, the untransferred cells in the upper chamber are wiped clean by a cotton swab, and methanol is fixed for more than 30 minutes. The fixative was discarded, washed three times with PBS and stained with Giemsa for more than 30 minutes. The dye solution was discarded, washed three times with PBS, the cell pool membranes were excised and the neutral gums fixed. The cells were counted and statistically analysed using a zeiss microscope for photography.

1.5Transwell invasion experiments: the 24-well cell pool was placed into a 24-well plate with forceps. The upper chamber was filled with 60. Mu.l of diluted matrigel and placed at 37℃with 5% CO ₂ More than 30 minutes in the cell incubator until the matrigel solidifies. Resuspension 8×10 with 200 μl of pure medium ⁴ The transfected cells were added to the upper chamber. 650 μl of medium containing 20% fetal bovine serum was added to the lower chamber. 37 ℃,5% CO ₂ After 24-36h, PBS is used for washing three times, the untransferred cells in the upper chamber are wiped clean by a cotton swab, and methanol is fixed for more than 30 minutes. The fixative was discarded, washed three times with PBS and stained with Giemsa for more than 30 minutes. The dye solution was discarded, washed three times with PBS, the cell pool membranes were excised and the neutral gums fixed. The cells were counted and statistically analysed using a zeiss microscope for photography.

1.6RNA extraction and real-time fluorescent quantitative PCR (RT-qPCR): as in example 1.

1.7 statistical analysis: as in example 1.

2. Experimental results:

2.1 in example 2, the present invention examined hsa_circ_0067842 expression in human breast cancer cells and normal breast epithelial cells by RT-qPCR, and the results showed that hsa_circ_0067842 was significantly more highly expressed in breast cancer cells MDA-MB-468 and MDA-MB-231 compared to normal breast epithelial cells MCF-10A, see FIG. 5.

2.2 in example 2, the present invention explored subcellular localization of hsa_circ_0067842 in breast cancer cells MDA-MB-231 by RNA fluorescence in situ hybridization experiments, and the results showed that hsa_circ_0067842 was expressed in both the nucleus and cytoplasm, see FIG. 6.

2.3 in example 2, the present invention was able to significantly silence the expression level of hsa_circ_0067842 in breast cancer cells after transfection of small interfering RNAs si-hsa_circ_0067842#1 and si-hsa_circ_0067842#2 in breast cancer cells MDA-MB-468 and MDA-MB-231, see FIGS. 7 and 8.

2.4 in example 2, the present invention performed functional experiments using breast cancer cells MDA-MB-468 and MDA-MB-231 transfected with hsa_circ_0067842 small interfering RNAs, and the results showed that knockdown hsa_circ_0067842 significantly inhibited the migration and invasion ability of breast cancer cells, see FIGS. 9 and 10.

The above results indicate that hsa_circ_0067842 is highly expressed in breast cancer tissues and cells and is associated with poor prognosis in breast cancer patients; cell localization shows that hsa_circ_0067842 is simultaneously expressed in cell nucleus and cytoplasm, and in vitro experiments show that down-regulating the expression of hsa_circ_0067842 can inhibit migration and invasion capacity of breast cancer cells, indicating that hsa_circ_0067842 plays a role of oncogene in breast cancer. Provides a new potential molecular target for the treatment and prognosis of breast cancer.

The present invention is not limited to the above-mentioned embodiments, and any equivalent embodiments which can be changed or modified by the technical content disclosed above can be applied to other fields, but any simple modification, equivalent changes and modification made to the above-mentioned embodiments according to the technical substance of the present invention without departing from the technical content of the present invention still belong to the protection scope of the technical solution of the present invention.

Claims (9)

1. A circular RNA hsa_circ_0067842 is derived from a human chromosome 3, is formed by cyclizing exons 12-17 of an SMC4 gene, and has a deoxyribonucleotide sequence shown in a sequence table SEQ ID NO. 1.

2. Use of the circular RNA hsa_circ_0067842 according to claim 1 as a molecular biomarker for breast cancer.

3. The use according to claim 2, characterized in that the circular RNA hsa_circ_0067842 is used as a molecular biological marker for breast cancer in the preparation of a prognostic reagent or kit for breast cancer.

4. Use of a specific primer pair for detecting the high or low expression level of the circular RNA hsa_circ_0067842 of claim 1 in the preparation of a breast cancer prognosis reagent or kit.

5. A primer for specifically amplifying the circular RNA hsa_circ_0067842 as set forth in claim 1, wherein the primer sequence is forward CAAGGCCCAACAAGACAAACTTGA and reverse ATGGCTCCTAAGTCCCCCTG.

6. A prognosis kit for breast cancer according to claim 3, characterized in that it contains the following primers: forward CAAGGCCCAACAAGACAAACTTGA, reverse ATGGCTCCTAAGTCCCCCTG; internal reference primer: forward ACCCACTCCTCCACCTTTGAC and reverse TGTTGCTGTAGCCAAATTCGTT.

7. Use of a specific small interfering RNA for down-regulating the expression level of the circular RNA hsa_circ_0067842 according to claim 1 for the preparation of a medicament for treating breast cancer, characterized in that the sequence of the specific small interfering RNA is

si-hsa_circ_0067842#1：

Forward direction UGCUGACAGGGGGACUUAGTT

Reverse CUAAGUCCCCCUGUCAGCATT;

si-hsa_circ_0067842#2：

forward direction GACUGCUGACAGGGGGACUTT

Reverse AGUCCCCCUGUCAGCAGUCTT.

8. The use of small specific interfering RNA for down-regulating the expression level of circular RNA hsa_circ_0067842 according to claim 7, wherein the subjects are MDA-MB-231 and MDA-MB-468 cell lines.

9. The use of hsa_circ_0067842 according to claim 1 for localization and biological function in breast cancer cells, wherein the sequence of the fluorescent in situ hybridization probe is:

5’Cy3-CCTAAGTCCCCCTGTCAGCAGTCTT-3’Cy3。