CN113151455A

CN113151455A - Application of exosome miR-181b-5p in diagnosis and treatment of esophageal squamous carcinoma

Info

Publication number: CN113151455A
Application number: CN202010075106.3A
Authority: CN
Inventors: 王颖; 徐寒梅; 陆继强
Original assignee: China Pharmaceutical University
Current assignee: China Pharmaceutical University
Priority date: 2020-01-22
Filing date: 2020-01-22
Publication date: 2021-07-23
Anticipated expiration: 2040-01-22
Also published as: CN113151455B

Abstract

The invention relates to a tumor exosome miR-181b-5p and application thereof, wherein miR-181b-5p can promote tumor angiogenesis in vivo and in vitro, induce tumor growth and metastasis, a clinical patient serum exosome miR-181b-5p can be used for diagnosis and prognosis evaluation of esophageal squamous cell carcinoma, and a miR-181b-5p inhibitor can be used as a medicament for inhibiting angiogenesis and tumor growth, metastasis and tumor angiogenesis of esophageal squamous cell carcinoma.

Description

Application of exosome miR-181b-5p in diagnosis and treatment of esophageal squamous carcinoma

Technical Field

The invention belongs to the field of biological medicines, particularly relates to the field of tumor diagnosis and treatment, and particularly relates to application of an exosome miR-181b-5p in diagnosis and treatment of esophageal squamous cell carcinoma.

Background

Esophageal cancer is one of the common malignant tumors of human beings, and is classified according to pathological forms, and the esophageal cancer has two main types: esophageal squamous carcinoma (ESCC) and Esophageal Adenocarcinoma (EAC), wherein esophageal adenocarcinoma is the main cause in western countries, and research is also mainly focused on the pathogenesis and treatment aspects of esophageal adenocarcinoma; esophageal squamous carcinoma mainly occurs in Asian regions such as China, and more than 90% of esophageal carcinoma in China is esophageal squamous carcinoma. Due to the lack of early diagnosis methods and biological detection indexes, most esophageal cancer patients are already in middle and advanced stages at the time of initial diagnosis, and the 5-year overall survival rate of the patients is low, so that the search for effective early diagnosis and prognosis markers is of great significance.

The occurrence and development of tumors are mediated by multiple factors including genetics, environment, immunity, and metabolism, wherein the tumor microenvironment is critical to the growth and metastasis of tumors. Various cellular and non-cellular components in the tumor microenvironment, such as immune cells, fibroblasts, vasculature, etc., and the specific local environment outside the cancer cells play a very important role in the process of tumor development. Based on the practical problem that clinical treatment is difficult to break through, the treatment of esophageal cancer patients cannot be limited to tumors, and the method can start from the targeted adjustment of tumor microenvironment. Tumor angiogenesis is a necessary condition for the formation of the tumor microenvironment, and is also one of the characteristics of the formation of the tumor microenvironment. Angiogenesis is closely related to the occurrence, development, malignant proliferation and metastasis of tumors, and the targeted regulation of the angiogenesis process in the tumor microenvironment is an effective anticancer treatment strategy.

The exosome is a nano-scale extracellular vesicle secreted by various cells, has the diameter of 30-100nm and the shape of a cup stand or a disc, and is released to the outside of the cells in an exocytosis form after the intracellular multivesicular body fuses with cell membranes. Exosomes can be used as novel vectors for intercellular information communication, and participate in various biological processes by influencing the intercellular information communication. Exosomes contain various contents, including mRNA, miRNA, DNA, protein, lipid, etc., more than 3000 kinds of RNA, 2700 kinds of miRNA, and nearly thousand of lipids, which are transported by exosomes and act on corresponding target cells to exert their biological functions. The exosomes secreted by the tumor cells carry special information possessed by the tumor cells and transmit information favorable for self growth to various surrounding cells and tissues by secreting the exosomes to promote the growth and metastasis of the tumor cells, and the mechanism for promoting the growth mainly comprises: promoting tumor angiogenesis, causing immune escape, inducing tumor metastasis, participating in tumor drug resistance and the like.

In a word, the exosome is taken as an important component in a tumor microenvironment, carries genetic information or protein, participates in regulation and control of signal transduction between tumor cells and vascular endothelial cells, promotes the process of tumor angiogenesis and tumor deterioration, and provides a brand new idea for clinical diagnosis and treatment of cancer patients by carrying out deep molecular mechanism research on the exosome.

Disclosure of Invention

Through years of research, the inventor identifies and obtains a miRNA (micro ribonucleic acid) -miR-181b-5p highly related to diagnosis and treatment of esophageal squamous cell carcinoma, the miRNA exists in exosomes secreted by the esophageal squamous cell carcinoma, the high-expression miR-181b-5p can indicate the existence of the esophageal squamous cell carcinoma, and the function of inhibiting miR-181b-5p can inhibit the growth and metastasis of tumors of the esophageal squamous cell carcinoma or the angiogenesis of the tumors, so that the miRNA is used for treating the esophageal squamous cell carcinoma. The present invention has been completed based on the above findings. Specifically, the invention at least comprises the following technical scheme:

the first aspect of the invention provides application of miR-181b-5p in preparation of a reagent, a composition or a kit for diagnosis or prognosis evaluation of esophageal squamous cell carcinoma, preferably, the sequence of miR-181b-5p is AACAUUCAUUGCUGUCGGUGGGU (SEQ ID NO: 1).

The second aspect of the invention provides application of a detection reagent of miR-181b-5p in preparation of a reagent, a composition or a kit for diagnosis or prognosis evaluation of esophageal squamous cell carcinoma, preferably, the sequence of miR-181b-5p is AACAUUCAUUGCUGUCGGUGGGU (SEQ ID NO: 1).

In one embodiment, the detection reagent is used for detecting the expression level of miR-181b-5p in a sample from the subject, preferably, the detection reagent is used for detecting the expression level of miR-181b-5p in exosomes from the sample from the subject; also preferably, the sample is a body fluid sample, such as blood, serum, plasma, tears, urine, saliva, interstitial fluid, cerebrospinal fluid or sweat.

In another embodiment, the detection reagent is a specific amplification primer of miR-181b-5p and/or a specific binding probe of miR-181b-5 p; preferably, the primer sequence is:

an upstream primer: 5'-AACATTCATTGCTGTCGGTGGGT-3' (SEQ ID NO: 2);

a downstream primer: 5'-TTTGGCACTAGCACATT-3' (SEQ ID NO: 3).

A third aspect of the invention provides a method of diagnosis or prognostic evaluation of esophageal squamous carcinoma, comprising the step of detecting an expression level of miR-181b-5p in a sample from a subject, wherein a higher expression level of miR-181b-5p, as compared to a healthy control, is indicative of the subject having, or being at higher risk of having, esophageal squamous carcinoma, and/or a poor prognosis;

preferably, the miR-181b-5p in the sample refers to miR-181-5p present in exosomes in the sample;

also preferably, the method further comprises the step of isolating exosomes from the sample and/or extracting miRNA from the exosomes;

more preferably, the method of isolating exosomes is ultracentrifugation; further preferably, the sample is a body fluid sample, such as blood, serum, plasma, tears, urine, saliva, interstitial fluid, cerebrospinal fluid or sweat.

In one embodiment, wherein the detection is quantitative PCR, preferably the primers used for the quantitative PCR are:

an upstream primer: 5'-AACATTCATTGCTGTCGGTGGGT-3' (SEQ ID NO: 2);

a downstream primer: 5'-TTTGGCACTAGCACATT-3' (SEQ ID NO: 3).

In another embodiment, wherein the detection is in situ hybridization, i.e., in situ hybridization detection of a tissue sample is performed using a probe, which may be labeled with digoxigenin or with a fluorescent label.

The fourth aspect of the invention provides an esophageal squamous carcinoma diagnosis or prognosis evaluation kit, which comprises a reagent for detecting the expression level of miR-181b-5p, preferably, the reagent comprises a specific amplification primer of miR-181b-5p and/or a specific binding probe of miR-181b-5 p;

also preferably, the kit further comprises a reagent for isolating exosomes from a body fluid sample (e.g., blood, serum, plasma, tears, urine, saliva, interstitial fluid, cerebrospinal fluid, or sweat), and/or a reagent for extracting miRNA from exosomes.

The fifth aspect of the invention provides a miRNA marker for diagnosis and/or prognosis evaluation of esophageal squamous carcinoma, wherein the marker is miR-181b-5p, and preferably, the sequence of miR-181b-5p is AACAUUCAUUGCUGUCGGUGGGU.

The sixth aspect of the invention provides application of an inhibitor of miR-181b-5p in preparation of a medicament for treating esophageal squamous carcinoma, preferably, the inhibitor can reduce or inhibit expression of miR-181b-5p, reduce stability of miR-181b-5p, or reduce or inhibit function or activity of miR-181b-5 p; also preferably, the inhibitor comprises: a protein, antisense oligonucleotide, LNA, PNA, or small molecule compound;

in a specific embodiment, the inhibitor is an antisense oligonucleotide, sequence such as ACCCACCGACAGCAAUGAAUGUU (SEQ ID NO: 4).

The seventh aspect of the invention provides a pharmaceutical composition for treating esophageal squamous carcinoma, which comprises a therapeutically effective amount of an inhibitor of miR-181b-5p, and a pharmaceutically acceptable carrier; preferably, the inhibitor is capable of reducing or inhibiting expression of miR-181b-5p, reducing stability of miR-181b-5p, or reducing or inhibiting function or activity of miR-181b-5 p; also preferably, the inhibitor comprises: a protein, antisense oligonucleotide, LNA, PNA, or small molecule compound;

The miR-181b-5p provided by the invention is used for diagnosis and prognosis of esophageal squamous carcinoma, has extremely high sensitivity and specificity, and the expression level of the miR-181b-5p is closely related to the N stage and clinical stage of a patient, so that the miR-181b-5p can be used for stage of cancer. More importantly, the miR-181b-5p can be used for pathological change indication of the esophageal squamous carcinoma, the function of the miR-181b-5p is closely related to the occurrence and development of esophageal squamous carcinoma cells, and the function of inhibiting the miR-181b-5p can inhibit the growth and metastasis of cancer cells and tumor angiogenesis, so that the miR-181b-5p can be used as a drug target for clinical treatment of patients with the esophageal squamous carcinoma.

Drawings

FIG. 1 shows the expression of the esophageal squamous carcinoma cell exosome marker protein.

FIG. 2 shows the results of the identification of exosome morphology by transmission electron microscopy.

FIG. 3 shows that esophageal squamous carcinoma exosomes promote HUVEC in vitro tubule formation.

FIG. 4 shows that esophageal squamous carcinoma exosomes promote angiogenesis in nude mice.

FIG. 5 shows the miRNA chip expression profiles of esophageal squamous carcinoma tissues and para-carcinoma tissues.

FIG. 6 shows the expression level of miR-181b-5p in esophageal squamous carcinoma tissue and para-carcinoma tissue detected by qPCR (quantitative PCR) 43.

FIG. 7 shows the expression level of miR-181b-5p in 10 esophageal squamous carcinoma cell lines detected by qPCR.

FIG. 8 shows the expression level of miR-181b-5p in exosomes secreted by 10 esophageal squamous carcinoma cell lines detected by qPCR.

FIG. 9 shows the correlation analysis results of miR-181b-5p expression level in esophageal squamous carcinoma cell line and miR-181b-5p expression level in exosome secreted by the esophageal squamous carcinoma cell line.

FIG. 10 shows that miR-181b-5p promotes HUVEC tubule formation in vitro.

FIG. 11 shows that miR-181b-5p promotes HUVEC tubule formation in vitro in exosomes.

FIG. 12 shows that miR-181b-5p promotes angiogenesis in nude mice in exosomes.

FIG. 13 shows that miR-181b-5p promotes the growth of subcutaneous transplantable tumor of esophageal squamous carcinoma nude mice.

FIG. 14 shows HE staining of tumor metastasis in the liver and lung of nude mice.

FIG. 15 shows the results of detecting angiogenesis in tumor tissues using immunohistochemistry.

FIG. 16 shows the observation of tumor metastasis in nude mice within 8 weeks using in vivo imaging.

FIG. 17 shows the tumor metastasis of the liver and lung of nude mice observed by HE staining after 8 weeks.

FIG. 18 shows immunohistochemical detection of liver and lung angiogenesis.

FIG. 19 shows the results of the expression levels of plasma miR-181b-5p in 38 patients with esophageal squamous carcinoma and 32 healthy volunteers.

FIG. 20 shows the results of an analysis of the correlation of the expression level of miR-181b-5p with the prognosis of a patient.

FIG. 21 shows the results of detecting the expression levels of miR-181b-5p in esophageal squamous carcinoma tissues and paracarcinoma tissues by in situ hybridization.

FIG. 22 shows the results of detecting the expression levels of miR-181b-5p and CD31 in esophageal squamous carcinoma tissues and paracarcinoma tissues by in situ hybridization.

Detailed Description

The invention may be further understood by the examples, however, it is to be understood that these examples are not limiting of the invention. Variations of the invention, now known or further developed, are considered to fall within the scope of the invention as described herein and claimed below.

Definition of

miR-181-5p is a microRNA, alternatively called microRNA, microRNA or miRNA, and the above names have the same meaning in the present invention. miRNA is a type of endogenous RNA molecule with the length of about 20-24 nucleotides, and the initial obtained after the coding gene of miRNA is transcribed is pri-miRNA, which is called pre-miRNA, namely the precursor of miRNA after one-time processing, and then mature miRNA is obtained after Dicer enzyme digestion.

The miR-181-5p in the invention can refer to different existing forms in the maturation process, namely pri-miRNA, pre-miRNA and mature miRNA, wherein the sequence of the mature miRNA is shown as SEQ ID NO:1 is shown. Moreover, the miR-181-5p of the present invention also includes functional equivalents thereof, i.e., variant forms, which variants or functional equivalents have the same function as the endogenous wild-type sequence of miR-181-5p, while having a deletion, substitution or insertion of one or more nucleotides compared to the wild-type sequence.

It is known in the art that in order to ensure the stability of a microRNA, a protective base, such as TT, may be added to one or both ends of the microRNA, or the microRNA base may be modified, but the modification does not affect the function of the microRNA. Therefore, sequences obtained by base modification or adding bases at two ends under the condition of not influencing the function of miR-181b-5p are also included in the protection scope of the invention.

The detection reagent refers to a reagent or a reagent combination for detecting the endogenous expression level of miR-181b-5p, such as a primer (primer pair) and/or a specific probe. The detection reagent can be used in various detection methods, such as quantitative PCR (more for example, fluorescent quantitative PCR), or in situ hybridization, such as in situ hybridization detection using a labeled (for example, fluorescent labeled) specific probe for a tissue sample (such as esophageal squamous carcinoma tissue sample, pathological section) to obtain a specific detection signal.

The 'inhibitor' refers to a reagent for expressing miR-181b-5p, or inhibiting the stability of miR-181b-5p, or inhibiting the activity of miR-181b-5p, or shortening the action time of miR-181b-5 p.

The target of the inhibitor is not limited to miR-181b-5p per se, but also comprises genome adjacent sequences of genes encoding miR-181b-5p, and also can comprise sequences functionally upstream and downstream of miRNA-181b-5p, such as target protein or target gene of miR-181b-5p or protein or gene regulating miR-181b-5 p.

Classes of inhibitors include, but are not limited to, proteins, antisense oligonucleotides, LNAs, PNAs, or small molecule compounds, and the like.

Examples

Example 1: extraction and identification of exosomes

Extracting exosomes of the upper clear liquid of the esophageal squamous carcinoma cell TE-13 and Eca-109 cell culture by an ultracentrifugation method, which comprises the following steps: firstly, centrifuging at 4 ℃ for 15min at 3000 Xg to remove dead cells; centrifuging at 6000 Xg for 40min to remove cell debris; centrifuging at 10000 Xg for 1h, and taking the supernatant; centrifuging at 100000 Xg for 1h, collecting precipitate as exosome, resuspending exosome with 400 μ l PBS, and storing at-80 deg.C.

Extracting total protein in the exosome by using RIPA protein lysate, and detecting the surface marker protein of the exosome by using Western blot: firstly, carrying out SDS-PAGE electrophoresis for 2 hours, then transferring a membrane by a wet method, transferring the gel after electrophoresis to a PVDF fiber membrane activated by methanol, transferring the membrane for 1 hour by adopting a constant current condition with the current of 0.22mA, after the PVDF fiber membrane is sealed for 2 hours, incubating CD9, CD63, TSG101 and HSP70 for one antibody overnight, after TBST is cleaned, incubating with a second antibody for 2 hours, then treating by using ECL luminous liquid and exposing for imaging.

The morphology of the exosome is observed by using a transmission electron microscope, and the method comprises the following specific steps: flatly placing a copper mesh used for a transmission electron microscope on weighing paper, dropwise adding 20 mu L of the exosome solution, and baking for 10min under an infrared lamp; and (3) dropwise adding 2 drops of phosphotungstic acid after drying, continuously baking for 10min, sucking away redundant liquid, and observing an exosome structure under a projection electron microscope.

As a result: the expression condition of the exosome marker protein is shown in figure 1, and the structure of the exosome identified by a transmission electron microscope is shown in figure 2.

Example 2: the esophageal squamous carcinoma cell exosome can promote the formation of vascular endothelial cell (HUVEC) tubules

5 mu g of exosomes secreted by esophageal squamous carcinoma cells TE-13 and Eca-109 and esophageal epithelial cells HEEC were respectively incubated with HUVEC cells for 24 hours. 50 μ L of Matrigel gel was spread in a 96-well plate, and then the 96-well plate was placed in an incubator at 37 ℃ for 30min to solidify the Matrigel gel. Taking 1X 10 HUVEC cells after the co-incubation of each group and exosomes⁴Each was seeded in the above 96-well plate and each group of HUVEC cells was observed for tubule formation after 6 hours and tubule branching was recorded.

As a result: the HUVEC tubule formation conditions of each group are shown in figure 3, and exosomes secreted by esophageal squamous carcinoma cells TE-13 and Eca-109 can remarkably promote the HUVEC tubule formation, while exosomes secreted by esophageal epithelial cells have no remarkable influence on the HUVEC tubule formation.

Example 3: the esophageal squamous carcinoma cell exosome can promote angiogenesis in a nude mouse

20 mu g of exosome secreted by TE-13, Eca-109 and HEEC and 0.5mL of Matrigel gel are mixed uniformly and then inoculated subcutaneously into the right armpit of BALB/c nude mice, the Matrigel gel is dissected out 14 days later, photographed and observed, and the blood vessel marker CD31 is observed by immunohistochemistry and HE staining.

As a result: TE-13 and Eca-109 exosomes were able to significantly promote angiogenesis in nude mice, while HEEC exosomes had no significant effect on angiogenesis in nude mice (see FIG. 4).

Example 4: expression profile chip analysis of human esophageal squamous carcinoma and paired normal tissues

7 pairs of esophageal squamous carcinoma cancer tissues and tissues beside the cancer (from Nanjing military area general Hospital) are subjected to miRNA expression chip research by Beijing Boao classical biotechnology limited, and miRNA which are differentially expressed and are related to angiogenesis are analyzed.

As a result: the result of the miRNA expression chip shows that miR-181b-5p is highly expressed in esophageal squamous carcinoma tissues (as shown in figure 5), and the sequence is AACAUUCAUUGCUGUCGGUGGGU (SEQ ID NO:1)

Example 5: RT-qPCR (reverse transcription-quantitative polymerase chain reaction) verification that miR-181b-5p is highly expressed in esophageal squamous carcinoma tissues, esophageal squamous carcinoma cells and esophageal squamous carcinoma exosomes

Total RNA in esophageal squamous carcinoma tissue and para-carcinoma tissue (from Nanjing military general Hospital) and 10 esophageal squamous carcinoma cell lines (TE10, TE13, TE12, Eca109, KYSE30, KYSE150, KYSE180, KYSE410, KYSE450 and KYSE510) (from professor West university Zhoujin professor laboratory) were extracted using Trizol reagent and instructions of Life corporation, and the purity and concentration of the extracted RNA were quantified using exosome miRNA extraction kit (from QIAGEN) using a NanoDrop ND-1000 nucleic acid quantifier. Using abm^TMMiRNAcDNASynthesis Kit, Inc., with Poly (A) Polymerase labeling testThe kit carries out reverse transcription on the extracted total RNA to synthesize cDNA. Using abm^TMThe company EvaGreen mirNaqPCR MasterMix kit carries out PCR reaction. Assay analysis was done by QuantStudio 3Real-Time PCR system, using primer sequences:

a forward primer: 5'-AACATTCATTGCTGTCGGTGGG-3' (SEQ ID NO:2)

Reverse primer: 5'-TTTGGCACTAGCACATT-3' (SEQ ID NO:3)

As a result: the miR-181b-5p is highly expressed in esophageal squamous carcinoma tissues, esophageal squamous carcinoma cells and exosomes secreted by the esophageal squamous carcinoma cells, and the expression quantity of the miR-181b-5p in the esophageal squamous carcinoma cells is positively correlated with the expression quantity of the miR-181b-5p in the exosomes (as shown in figures 6-9).

Example 6: miR-181b-5p promotes HUVEC tubule formation in vitro

Mimic, inhibitor, and negative control (synthesized by GmbH, Suzhou) of miR-181b-5p were transfected into HUVEC cells according to the instructions for transfection reagents (purchased from abm Co.), and after 24 hours of culture, 1X 10 cells were taken for each group⁴The cells were subjected to tubule formation experiments in the same manner as in example 2.

miR-181b-5p imic sequence (double-stranded):

sense strand: 5'-AACAUUCAUUGCUGUCGGUGGGU-3' (SEQ ID NO: 5);

antisense strand: 5'-CCACCGACAGCAAUGAAUGUUUU-3' (SEQ ID NO: 6).

miR-181b-5p inhibitor:ACCCACCGACAGCAAUGAAUGUU(SEQ ID NO:4)；

negative control:CAGUACUUUUGUGUAGUACAA(SEQ ID NO:7)

As a result: compared with the negative control group, miR-181b-5p imic can remarkably promote the formation of the HUVEC tubules, and miR-181b-5p inhibitor can inhibit the formation of the HUVEC tubules, so that the miR-181b-5p has the effect of promoting the formation of the HUVEC tubules (as shown in figure 10).

Example 7: esophagus squamous carcinoma cell exosome miR-181b-5p for promoting in-vitro HUVEC tubule formation

Exosomes secreted by Eca109 cells transfected with miR-181b-5p micic, inhibitor and negative control are extracted by a differential centrifugation method, and then the exosomes and HUVEC are incubated for 24 hours and then subjected to a tubule formation experiment, wherein the experiment method is the same as that in example 2.

As a result: as shown in FIG. 11, exosomes secreted by Eca109 cells transfected with miR-181b-5p imic can significantly promote HUVEC tubule formation, and the effect of exosomes secreted by Eca109 cells transfected with miR-181b-5p inhibitor on promoting HUVEC tubule formation is significantly inhibited, which indicates that miR-181b-5p in exosomes of esophageal squamous carcinoma cells promotes HUVEC tubule formation in vitro.

Example 8: miR-181b-5p in esophageal squamous carcinoma cell exosome promotes angiogenesis in nude mouse

And (3) extracting exosomes secreted by Eca109 cells transfected with miR-181b-5p mimics, inhibitors and negative control by a differential centrifugation method, uniformly mixing 20 mu g of the exosomes with 0.5mL of Matrigel gel glue, then subcutaneously inoculating the exosomes to the right armpit of a BALB/C nude mouse, dissecting after 14 days, taking out the Matrigel glue, photographing and observing, and observing a blood vessel marker CD31 by immunohistochemistry and HE staining.

As a result: as shown in FIG. 12, exosomes secreted by Eca109 cells transfected with miR-181b-5p imic can remarkably promote angiogenesis in nude mice, and the miR-181b-5p in esophageal squamous carcinoma exosomes can promote angiogenesis in nude mice.

Example 9: miR-181b-5p can promote growth and angiogenesis of subcutaneous transplantation tumor of esophageal squamous carcinoma nude mouse

LNA-miR-181b-5p imic, LNA-miR-181b-5p inhibitor and LNA-negative control (namely, the miR-181b-5p imic, the inhibitor and the negative control in example 6 are modified by LNA to improve stability) are transfected into Eca-109 cells, and the transfected Eca-109 cells are taken and diluted to 5 x 10⁶ Inoculating 100 μ L of the strain to right axilla of Balb/c nude mice subcutaneously, observing tumor growth of the nude mice, measuring tumor volume and mouse weight once every two days, ending the experiment after 20 days, and taking serum, tumor, liver and lung tissues; immunohistochemical detection of blood vessel marker CD31 in tumor tissue, HE staining and immunohistochemical observation of metastasis and angiogenesis in liver and lung tissue, respectively.

As a result: as shown in FIGS. 13-15, LNA-miR-181b-5p imimic can promote the in vivo growth, angiogenesis and metastasis of esophageal squamous cell carcinoma, and in contrast, LNA-miR-181b-5p inhibitor can inhibit the in vivo growth, angiogenesis and metastasis of esophageal squamous cell carcinoma.

Example 10: miR-181b-5p in exosome can promote esophageal squamous cell carcinoma nude mouse to transfer in vivo

Infecting Eca109 cells with GFP lentivirus, screening to obtain Eca109 cells stably expressing GFP, diluting to 1X 10⁶200 mu L of the cells are inoculated into Balb/c nude mice in a tail vein, the mice after tumor inoculation are randomly divided into 3 groups, 20 mu g of exosome secreted by Eca109 transfected with miR-181b-5p mic, inhibitor and negative control is injected into each group of mice in the tail vein respectively, the injection is performed for 1 time per week for 8 weeks, the in vivo cell transfer condition of the Eca109 is observed by living body imaging every week, the liver and lung tissues of the mice are dissected after 8 weeks, HE staining and immunohistochemistry are performed, and the transfer focus and angiogenesis condition are observed.

As a result: the liver and lung metastasis of the miR-181b-5p mimic group nude mice is obvious, and the liver and lung tissue angiogenesis is obvious, while the liver and lung metastasis of the miR-181b-5p inhibitor group nude mice is reduced, and the liver and lung tissue angiogenesis is obviously reduced (as shown in figures 16-18),

example 11: serum exosome of esophageal squamous carcinoma patient is highly expressed by miR-181b-5p and is relevant to patient prognosis

Serum from 38 patients with esophageal squamous carcinoma and 32 healthy volunteers was isolated, exosome miRNA was extracted from the Serum using exosome miRNA extraction Kit (exoRNeasy Serum/Plasma Maxi Kit, QIAGEN, cat. No.77064), and miR-181b-5p expression level in Plasma was detected by RT-qPCR in the same manner as in example 5. Follow-up data of 38 patients with esophageal cancer are investigated, and the correlation between the expression level of the plasma exosome miR-181b-5p and the prognosis of the patients is analyzed.

As a result: the expression level of the serum exosome miR-181b-5p of the esophageal squamous carcinoma patient is remarkably higher than that of the serum exosome miR-181b-5p of a healthy volunteer, and the prognosis of the patient with high miR-181b-5p expression is poor, which indicates that the miR-181b-5p can be used as a biomarker for diagnosis and prognosis evaluation of the esophageal squamous carcinoma patient (see fig. 19 and 20).

Example 12: correlation analysis of miR-181b-5p expression level and patient prognosis

Tissue samples of 58 cases of esophageal squamous cell carcinoma patients (from Nanjing military district general Hospital) are obtained, qPCR is used for detecting the expression level of miR-181b-5p in tumor tissues, and the expression level is judged according to the value of delta Ct (delta Ct ═ Ct cancer tissue-Ct cancer adjacent tissues), wherein the higher the value of the delta Ct is, the lower the expression level is. Taking a median delta Ct-12.97 as cutoff, the delta Ct less than 12.97 is high expression, the delta Ct more than 12.97 is low expression, so that 58 cases of esophageal squamous carcinoma patients are divided into two groups of miR-181b-5p high expression and miR-181b-5p low expression, clinical data of the patients are collected, and the correlation between miR-181b-5p expression and each pathological characteristic is analyzed by chi-square test.

As a result: the chi-square test result shows that the expression level of miR-181b-5p is related to N stage and clinical stage (Table 1), which indicates that miR-181b-5p can be used as an esophageal squamous carcinoma diagnosis biomarker and an index for evaluating clinical prognosis.

TABLE 1

Example 13: in situ hybridization detection of correlation of miR-181b-5p with angiogenesis and clinical prognosis

In-situ hybridization and immunohistochemistry are utilized to detect the expression level of miR-181b-5p and the expression of CD31 (completed by Shanghai Chi super Biotechnology limited company) in 87 cancer tissues and tissues beside the cancer of esophageal squamous carcinoma patients (from China center for Biochip engineering research (Shanghai Chi super Biotechnology limited company) Shanghai Zhangjiang biological Bank of China), and the correlation between the expression of miR-181b-5p and the expression of CD31 is analyzed; and scoring the in situ hybridization results, the scoring criteria being as follows:

sections of tumor tissue and paracancerous tissue were visualized under an Aperio ScanScope CS2, and were scan analyzed using ImageScope, and scored on two parts, respectively: area of staining and degree of staining.

For the stained area: the section with 5% labeled cells scored 0; sections with 5-30% labeled cells scored 1; sections with 31-70% labeled cells were scored as 2; sections of more than 71% of the labeled cells were scored as 3.

For the degree of staining: staining intensity was automatically scored according to scanning software, where 0 indicated negative staining, 1 indicated weak positive staining, 2 indicated moderate positive staining, and 3 indicated strong positive staining.

Multiplying the staining area and the degree of staining to generate a staining intensity score for each section, and then subtracting the tumor tissue staining intensity score for each patient from the paracancerous tissue staining intensity score to obtain a miR-181b-5p expression score for each patient, with a score of 0 or greater defined as high expression and a score of less than 0 defined as low expression.

Dividing the miR-181b-5p into a high expression group and a low expression group according to the score values, collecting clinical data of a patient, and analyzing the correlation between miR-181b-5p expression and each pathological feature by using chi-square test; and analyzing the relevance of the miR-181b-5p and each pathological feature and the survival time of the patient by using univariate and multivariate Cox regression analysis.

As a result: 87 in-situ hybridization and immunohistochemistry of clinical tumor and tissues beside cancer discover that the expression level of miR-181b-5p is positively correlated with the expression of a blood vessel marker CD31, and both of the expression level and the expression level are highly expressed in the tumor tissues, which indicates that miR-181b-5p promotes tumor angiogenesis and suggests that miR-181b-5p can be used as a new target for designing anti-tumor angiogenesis drugs (see figures 21 and 22). Chi fang test results showed that miR-181b-5p expression levels correlated with N staging and clinical staging (table 2); univariate and multivariate Cox regression analysis results show that miR-181b-5p expression levels can be an independent factor in assessing patient prognosis (table 3). The miR-181b-5p can be used as a biomarker for diagnosing esophageal squamous carcinoma and an index for evaluating clinical prognosis.

TABLE 2

TABLE 3

<110> university of Chinese pharmacy

<130> MP1938043

<160> 7

<170> PatentIn version 3.2

<210> 1

<211> 23

<212> RNA

<213> Homo sapiens

<400> 1

aacauucauu gcugucggug ggu 23

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

aacattcatt gctgtcggtg ggt 23

<210> 3

<211> 17

<212> DNA

<213> Artificial sequence

<400> 3

tttggcacta gcacatt 17

<210> 4

<211> 23

<212> RNA

<213> Artificial sequence

<400> 4

acccaccgac agcaaugaau guu 23

<210> 5

<211> 23

<212> RNA

<213> Artificial sequence

<400> 5

aacauucauu gcugucggug ggu 23

<210> 6

<211> 23

<212> RNA

<213> Artificial sequence

<400> 6

ccaccgacag caaugaaugu uuu 23

<210> 7

<211> 21

<212> RNA

<213> Artificial sequence

<400> 7

caguacuuuu guguaguaca a 21

Claims

The application of miR-181b-5p in preparing a reagent, a composition or a kit for diagnosis or prognosis evaluation of esophageal squamous carcinoma is disclosed, wherein preferably, the sequence of miR-181b-5p is AACAUUCAUUGCUGUCGGUGGGU (SEQ ID NO: 1).
Application of the detection reagent of miR-181b-5p in preparation of a reagent, a composition or a kit for diagnosis or prognosis evaluation of esophageal squamous carcinoma, preferably, the sequence of miR-181b-5p is AACAUUCAUUGCUGUCGGUGGGU (SEQ ID NO: 1).
3. The use according to claim 2, wherein the detection reagent is used for detecting the expression level of miR-181b-5p in a sample from the subject, preferably the detection reagent is used for detecting the expression level of miR-181b-5p in exosomes from the sample from the subject; also preferably, the sample is a body fluid sample, such as blood, serum, plasma, tears, urine, saliva, interstitial fluid, cerebrospinal fluid or sweat.
4. The use of claim 2 or 3, wherein the detection reagent is a specific amplification primer of miR-181b-5p and/or a specific binding probe of miR-181b-5 p; preferably, the primer sequence is:

an upstream primer: 5'-AACATTCATTGCTGTCGGTGGGT-3' (SEQ ID NO: 2);

a downstream primer: 5'-TTTGGCACTAGCACATT-3' (SEQ ID NO: 3).
5. A method of diagnosis or prognostic evaluation of esophageal squamous cancer, comprising the step of detecting an expression level of miR-181b-5p in a sample from a subject, wherein a higher expression level of miR-181b-5p, as compared to a healthy control, is indicative of the subject having, or being at higher risk of having, esophageal squamous cancer, and/or a poor prognosis; preferably, the miR-181b-5p in the sample refers to miR-181-5p present in exosomes in the sample; also preferably, the method further comprises the step of isolating exosomes from the sample and/or extracting miRNA from the exosomes; more preferably, the method of isolating exosomes is ultracentrifugation; further preferably, the sample is a body fluid sample, such as blood, serum, plasma, tears, urine, saliva, interstitial fluid, cerebrospinal fluid or sweat.
6. The method according to claim 5, wherein the detection comprises quantitative PCR or in situ hybridization, preferably the primers used for the quantitative PCR are:

an upstream primer: 5'-AACATTCATTGCTGTCGGTGGGT-3' (SEQ ID NO: 2);

a downstream primer: 5'-TTTGGCACTAGCACATT-3' (SEQ ID NO: 3).
7. An esophageal squamous carcinoma diagnosis or prognosis evaluation kit, which comprises a reagent for detecting the expression level of miR-181b-5p, preferably the reagent comprises a specific amplification primer of miR-181b-5p and/or a specific binding probe of miR-181b-5 p; also preferably, the kit further comprises a reagent for isolating exosomes from a body fluid sample (e.g., blood, serum, plasma, tears, urine, saliva, interstitial fluid, cerebrospinal fluid, or sweat), and/or a reagent for extracting miRNA from exosomes.
8. A miRNA marker for diagnosis and/or prognosis evaluation of esophageal squamous carcinoma, wherein the marker is miR-181b-5p, and preferably, the sequence of miR-181b-5p is AACAUUCAUUGCUGUCGGUGGGU (SEQ ID NO: 1).
The application of the inhibitor of miR-181b-5p in preparing a medicament for treating esophageal squamous carcinoma, inhibiting growth, metastasis and/or tumor angiogenesis of esophageal squamous carcinoma cells, preferably, the inhibitor can reduce or inhibit the expression of miR-181b-5p, reduce the stability of miR-181b-5p, or reduce or inhibit the function or activity of miR-181b-5 p; also preferably, the inhibitor comprises: a protein, antisense oligonucleotide, LNA, PNA, or small molecule compound; more preferably, the inhibitor is an antisense oligonucleotide, sequence e.g., ACCCACCGACAGCAAUGAAUGUU (SEQ ID NO: 4).
10. A pharmaceutical composition for treating esophageal squamous carcinoma, inhibiting growth, metastasis and/or tumor angiogenesis of esophageal squamous carcinoma cells, comprising a therapeutically effective amount of an inhibitor of miR-181b-5p, and a pharmaceutically acceptable carrier; preferably, the inhibitor is capable of reducing or inhibiting expression of miR-181b-5p, reducing stability of miR-181b-5p, or reducing or inhibiting function or activity of miR-181b-5 p; also preferably, the inhibitor comprises: a protein, an antisense oligonucleotide, LNA, PNA or a small molecule compound, more preferably the inhibitor is an antisense oligonucleotide, sequence e.g. ACCCACCGACAGCAAUGAAUGUU (SEQ ID NO: 4).