CN112359118B - Application of long-chain non-coding RNA AC073352.1 as breast cancer diagnosis marker and treatment target - Google Patents

Abstract

The invention belongs to the technical field of biological medicines, and relates to application of a long-chain non-coding RNA lncRNA AC073352.1 in breast cancer diagnosis biomarkers and treatment targets. The lncRNA AC073352.1 can be used as a biomarker for breast cancer diagnosis and a drug therapy target for the first time. lncRNA AC073352.1 was significantly upregulated in the serum of breast cancer patients. lncRNA AC073352.1 has good ability to diagnose breast cancer. The result of the invention shows that the lncRNA AC073352.1 exists in both cytoplasm and nucleus of the breast cancer, and the interference of lncRNA AC073352.1 can inhibit the migration and invasion of the breast cancer cells, so that the lncRNA AC073352.1 plays a role of a cancer-promoting gene in the occurrence and development of the breast cancer, and provides a new target point for clinical treatment of the breast cancer.

Description

Application of long-chain non-coding RNA AC073352.1 as breast cancer diagnosis marker and treatment target

Technical Field

The invention belongs to the technical field of biological medicines, and relates to application of long-chain non-coding RNA AC073352.1 in breast cancer diagnosis biomarkers and treatment targets.

Background

Breast cancer is one of the most common malignant tumors in women worldwide and is also the leading cause of cancer death in women, and the morbidity and mortality rate thereof is rising year by year. Recent data statistics in 2019 show that more than 160 million people are diagnosed with breast cancer and the number of deaths is over 40 million every year in the world, the number of the deaths is increased by about 2% every year, the incidence rate of female tumors is the first in the world, and the life health of women is seriously threatened. In female malignant tumors in China, the incidence rate is high and the age standardization rate shows a rising trend, the number of the breast cancer patients is about 30 ten thousand every year, and 30-59-year-old women are high, so that the breast cancer prevention and treatment method has great burden on families and society, and is particularly important for the prevention and treatment of breast cancer. The occurrence and development of breast cancer are a complex process with multiple factors and high heterogeneity, metastasis is closely related to death of breast cancer patients, more than 90% of death cases are caused by metastasis, and the metastasis is also an important factor causing poor prognosis of breast cancer. Early diagnosis and timely and correct treatment of breast cancer directly affect the prognosis of breast cancer patients. Therefore, the research of a novel high-sensitivity and high-specificity breast cancer diagnosis biomarker and a treatment target, the improvement of the early diagnosis rate of breast cancer, and the method is a hot spot and a difficult point concerned in recent years.

Long non-coding RNAs (lncrnas) are a class of RNA molecules whose transcripts are over 200 nucleotides in length and have limited potential for encoding proteins. lncRNA is largely classified into the following according to its relative position and orientation in the genome: sense lncRNA, antisense lncRNA, bidirectional lncRNA, intergenic lncRNA, and intragenic lncRNA. Research shows that lncRNA has a specific spatial structure and highly conserved sequence elements and is widely present in various levels of cells, and the lncRNA regulates important pathophysiological processes such as chromatin remodeling, DNA methylation, histone modification, RNA metabolism and epigenetic characteristic regulation at multiple levels of transcription, post-transcription, translation and post-translation. Recent studies have found that lncRNA is widely involved in various biological processes, such as regulation of cell proliferation, apoptosis, cell migration, cell invasion, and the like. The literature reports that the abnormally expressed lncRNAs are closely related to the processes of occurrence, development, metastasis, drug resistance and the like of various human diseases, particularly malignant tumors (gastric cancer, breast cancer, liver cancer and the like). These characteristics show that lncRNA plays an important role in biological processes and is gradually becoming a brand new target for clinical tumor diagnosis, treatment and prognosis.

Early breast cancer usually lacks obvious clinical signs, and early diagnosis is mainly obtained through molybdenum target X-ray, color Doppler ultrasound and other imaging examinations, but the specificity and the sensitivity of diagnosis on early breast cancer are not high. Based on the abnormal expression and biological function of lncRNA in breast cancer, the novel lncRNA is determined to be used as a breast cancer diagnosis biomarker and a treatment target, and the biological regulation function of lncRNA in breast cancer is explored, so that the method has potential clinical significance for diagnosis and treatment of breast cancer.

Disclosure of Invention

The invention provides application of a novel long-chain non-coding RNA AC073352.1 in a breast cancer diagnosis biomarker and a breast cancer treatment target aiming at the problems in the traditional breast cancer diagnosis and treatment.

In order to achieve the purpose, the invention is realized by adopting the following technical scheme:

the application of lncRNA AC073352.1 as a breast cancer diagnosis biomarker and a breast cancer treatment target point, wherein the Gene ID of lncRNA is ENSG00000272662.1 and is derived from human chromosome 3.

An expression level of lncRNA AC073352.1 in a sample from a subject likely to have breast cancer, wherein a higher expression level of lncRNA AC073352.1 correlates with an increased likelihood of the subject having breast cancer and a poor prognosis.

The invention provides application of a breast cancer diagnosis biomarker lncRNA AC073352.1 in preparation of a breast cancer diagnosis product.

The invention provides a primer pair for specifically recognizing AC073352.1, which has the following base sequences: TGGCAGGTCTTCCTAAGGTG, and AGCAGAGGTTGTAGTGACGG.

The invention provides application of a reagent for detecting the expression level of AC073352.1 by sample total RNA extraction, qRT-PCR and real-time quantitative PCR in breast cancer diagnosis.

Specific steps included total RNA extraction (feijast 2000 kit), β -actin (CATGTACGTTGCTATCCAGGC and CTCCTTAATGTCACGCACGAT) as internal control, and performing all qRT-PCR reactions using SYBR Green PCR Master mix.

The application of AC073352.1 as a breast cancer molecule therapeutic target in regulating cell migration and invasion.

The first objective of the invention is to provide a potential diagnosis biomarker and a treatment target of breast cancer, which is lncRNA AC073352.1 (ENSG 00000272662.1| Chromosome 3: 119497678-119498181).

The second purpose of the invention is to provide a primer pair which specifically recognizes lncRNA AC073352.1, and comprises an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is TGGCAGGTCTTCCTAAGGTG; the nucleotide sequence of the downstream primer is AGCAGAGGTTGTAGTGACGG.

The third purpose of the invention is to disclose the expression of IncRNA AC073352.1 in the serum of breast cancer patients and a ROC curve for evaluating the diagnostic ability of IncRNA AC 073352.1.

The fourth purpose of the invention is to disclose the location and the exerted biological functions of lncRNA AC073352.1 in breast cancer cells, and the probe sequence is CCAGCAGAACTGACAAGGTACAAACGGA.

The invention provides application of lncRNA AC073352.1 in diagnosis and treatment of breast cancer. The invention discloses lncRNA AC073352.1 as a novel potential breast cancer diagnosis biomarker and a novel potential breast cancer diagnosis target. The invention selects 6 cases of breast cancer and tissues beside the breast cancer from a tissue specimen bank, performs high-throughput chip analysis after quality inspection is qualified, performs combined analysis on the differentially expressed lncRNA and TCGA analysis data, and screens 2 candidate lncRNA molecules which are remarkably highly expressed in a breast cancer group and are relevant to prognosis. The lncRNA AC073352.1 is found to be significantly up-regulated in the breast cancer through qRT-PCR verification in serum, a receiver working curve (ROC) shows that lncRNA AC073352.1 has good potential for diagnosing the breast cancer, and the high-expression lncRNA AC073352.1 is related to poor prognosis of a patient; functional experimental results show that lncRNA AC073352.1 can promote migration and invasion of breast cancer cells.

Compared with the prior art, the invention has the advantages and positive effects that:

1. the lncRNA AC073352.1 can be used as a biomarker for breast cancer diagnosis and a drug therapy target for the first time.

2. lncRNA AC073352.1 was significantly upregulated in the serum of breast cancer patients compared to healthy humans.

The ROC curve shows that lncRNA AC073352.1 has good ability to diagnose breast cancer.

4. The result of the invention shows that the lncRNA AC073352.1 exists in both cytoplasm and nucleus of the breast cancer, and the interference of lncRNA AC073352.1 can inhibit the migration and invasion of the breast cancer cells, so that the lncRNA AC073352.1 plays a role of a cancer-promoting gene in the occurrence and development of the breast cancer, and provides a new target point for clinical treatment of the breast cancer.

Drawings

FIG. 1 is an intersection heatmap of IncRNA chips and TCGA data mining analysis results showing the distribution of IncRNA differentially expressed in breast and paraneoplastic tissues (fold change > 2 or < 0.5, p < 0.001).

FIG. 2 shows the correlation between lncRNA AC073352.1 in TCGA public database and breast cancer tissue and patient prognosis. Kaplan-Meier analysis lncRNA AC073352.1 is related to the prognosis of breast cancer patients.

FIG. 3 is a graph showing the results of the detection of the expression level of IncRNA AC073352.1 in the serum of breast cancer patients and healthy subjects using the primers of IncRNA AC 073352.1. Represents a p value < 0.001.

FIG. 4 is a ROC plot for evaluating the potential of lncRNA AC073352.1 for diagnosing breast cancer.

FIG. 5 is a graph showing the results of detection of the expression level of IncRNA AC073352.1 in breast cancer cell lines and normal breast epithelial cells using primers for IncRNA AC 073352.1.

FIG. 6 shows the results of fluorescence in situ hybridization of RNA, identifying the position of IncRNA AC073352.1 (in the original figure, blue is cell nucleus Dapi, red is marker IncRNA AC073352.1, and color is not shown after black and white image adjustment).

FIG. 7 is a qRT-PCR validation graph of the transfection and knockdown efficiency of lncRNA AC073352.1 small interfering RNA (siRNA) in both MDA-MB-468 and MCF-7 cell lines. siNC represents a negative control group; the si AC073352.1-1 and the si AC073352.1-2 represent groups of siRNA transfected with two kinds of targeting lncRNA AC073352.1 respectively. Represents a p value < 0.001.

FIG. 8 is a graph showing the statistics of the migration and invasion capacity of MDA-MB-468 in breast cancer cells after knockdown of IncRNA AC 073352.1. Represents a p value < 0.001.

FIG. 9 is a graph showing the statistical results of the changes in the migration and invasion capacity of MCF-7 in breast cancer cells after knockdown of IncRNA AC 073352.1. Represents a p value <0.05, represents a p value < 0.001.

Detailed Description

In order that the above objects, features and advantages of the present invention may be more clearly understood, the present invention will be further described with reference to specific embodiments. It should be noted that the embodiments and features of the embodiments of the present application may be combined with each other without conflict.

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced in other ways than those specifically described herein, and thus the present invention is not limited to the specific embodiments of the present disclosure.

Example 1

This example provides a demonstration of the expression, prognosis and diagnostic efficacy of lncRNA AC073352.1 in breast cancer.

1. Experimental materials and methods

1.1 organization

Collecting normal fresh tissues of breast cancer and corresponding paracarcinoma, wherein the sample collection standard is as follows: firstly, the breast cancer is confirmed by pathological examination; ② no other malignant tumors or diseases; and thirdly, before operation, the patient does not receive any treatment such as medicine or radiotherapy and chemotherapy. Washing residual blood on the surface of the postoperative tissue by using precooled PBS, quickly putting the postoperative tissue into liquid nitrogen for quick freezing, and transferring the postoperative tissue into a refrigerator at the temperature of minus 80 ℃.

1.2 serum

The breast cancer patients are collected and treated by the primary admission, do not receive any treatment before operation and are confirmed by pathological examination after operation. Healthy subjects excluded other neoplastic diseases. All serum samples were taken before receiving any drug treatment or before surgery. Serum samples were obtained by centrifugation at 4 ℃ and stored in a freezer at-80 ℃.

1.3 lncRNA differential Gene expression Profile

6 cases of breast cancer and paracancerous normal tissues were selected from the tissue specimen bank. After quality inspection is qualified, high-throughput chip analysis is carried out, and TCGA data mining analysis is combined to compare breast cancer and normal tissue data (default threshold values of genes with obvious differences are set to be p less than or equal to 0.001 and Fold change less than or equal to 0.5 or more than or equal to 2.0), so as to obtain a lncRNA differential gene expression profile which is shown in figure 1.

1.4 RNA extraction and fluorescent real-time quantitative PCR (qRT-PCR)

Extracting total RNA from tissue by Trizol (Invitrogen, Carlsbad, Calif. USA); extracting serum total RNA by using a hepatitis C nucleic acid purification diagnostic kit (QIAGEN, Shenzhen); total RNA of cells is extracted by adopting an RNA extraction kit fast2000 (Feijie, Shanghai). The reverse transcription kit adopts PrimeScript^TMRT reagent Kit (TAKARA, Dalian); the fluorescent quantitative PCR kit adopts TB Green TM Premix Ex taq^TMII (TAKARA, Dalian). Beta-actin is used as an internal reference; by using 2^-ΔΔCtCalculating the relative expression quantity of RNA; the primer is synthesized by Jinan Boshang biotechnology, Inc.; the primer sequences are shown in Table 1, and the qRT-PCR system is shown in Table 2.

TABLE 1 primer sequences for qRT-PCR

TABLE 2 systems used for qRT-PCR

1.5 data processing and analysis

Statistical analysis of the data was performed using SPSS 19.0 software and statistical mapping was performed using GraphPad Prism 7.0 software. Samples or differences between groups were compared using the t-test or Wilcoxon rank-sum test as needed, and p <0.05 was considered statistically different. Experimental data were derived from three independent experiments, and data are presented as mean ± standard deviation. The diagnostic efficacy of lncRNA is shown by ROC curve and area under the curve AUC analysis.

2. Results of the experiment

2.1 in example 1, the different genes of lncRNAs of breast cancer and paracancer normal tissues obtained by high-throughput lncRNAs chip detection are compared with the different lncRNAs of breast cancer and normal tissues obtained by TCGA data analysis to obtain lncRNA with obvious differential expression, which is shown in figure 1. Among them, lncRNA AC073352.1 was significantly up-regulated in breast cancer, and its high expression was significantly correlated with poor prognosis in patients (p = 0.027), see fig. 2.

2.2 in example 1, the present inventors selected 43 serum samples of breast cancer patients and healthy subjects from a serum specimen bank and extracted total RNA in serum. The results showed that lncRNA AC073352.1 was significantly highly expressed in the serum of breast cancer patients, see fig. 3. The area under the ROC curve, AUC, is 0.847, which indicates that the gene has better diagnostic value for breast cancer, and is shown in figure 4.

Example 2

This example discusses the effect of interfering with lncRNA AC073352.1 expression on breast cancer cell migration and invasion.

1. Experimental materials and methods

1.1 cell lines and culture

Human breast cancer cell lines MDA-MB-468 and MCF-7 and a human normal breast epithelial cell line MCF-10A were purchased from Shanghai Life sciences institute of Chinese academy of sciences. Breast cancer cells MDA-MB-468 and MCF-7 were cultured in DMEM (Gibco) medium containing 10% fetal bovine serum (Gibco). Normal mammary epithelial cells MCF-10A were cultured in DMEM/F12 (Meyer) medium containing 10% horse serum and supplemented with 100ng/ml cholera toxin, 20ng/ml EGF, 0.5. mu.g/ml hydrocortisone and 10. mu.g/ml insulin. All cell lines were cultured at 37 ℃ and 5% CO₂In an incubator.

1.2 fluorescent in situ hybridization of RNA

The fluorescence in situ hybridization probe and the kit which are designed and synthesized by Google Biotechnology company (Wuhan) are adopted and finished by cell fixation, prehybridization, hybridization and mounting, the fluorescence position is observed by using a Nikon confocal microscope, and the sequence SEQ ID NO.5 of the in situ hybridization probe is shown in Table 3.

TABLE 3 fluorescent in situ hybridization Probe sequences for RNA

1.3 transfection of cells

Specific small interfering rna (sirna) targeting lncRNA AC073352.1 and negative control (siNC) were designed and synthesized from the gimar gene (shanghai); transfection of siRNA into breast cancer cells MDA-MB-468 and MCF-7 using Lipofectamine 2000 (Invitrogen, Carlsbad, Calif., USA); the siRNA sequences are shown in Table 4.

TABLE 4 siRNA sequences

1.4 cell migration assay

The 24-well cell pool was placed in a 24-well plate, and the transfected cells were trypsinized at 5X 10⁴The corresponding cell mass was removed per well, resuspended in 200. mu.l serum-free medium, and plated in the upper chamber of a 24-well cell, and the medium containing 20% fetal bovine serum was added to the lower chamber. 37 ℃ and 5% CO₂After 24h incubation, the upper and lower chambers were discarded, the cells that did not migrate in the upper chamber were erased, washed 2 times with PBS, and fixed with 4% paraformaldehyde for 1 h. The fixative was discarded, washed 2 times with PBS, and stained with Giemsa stain for 1 h. Discard the staining solution, wash with PBS for 2 times, cut the cell pore membrane, and seal the gel onto the glass slide. Pictures were taken using a zeiss microscope and counted.

1.5 cell invasion assay

The 24-well cell pool was placed in a 24-well plate, 60. mu.l matrigel (BD Biosciences) was added to the upper chamber, and placed in a cell incubator for 1h to be gelled. Trypsinizing the transfected cells at 1X 10⁵The corresponding cell mass was removed per well, resuspended in 200. mu.l serum-free medium, and plated in the upper chamber of a 24-well cell, and the medium containing 20% fetal bovine serum was added to the lower chamber. 37 ℃ and 5% CO₂After 24h incubation, the upper and lower chambers were discarded, the cells that did not migrate in the upper chamber were erased, washed 2 times with PBS, and fixed with 4% paraformaldehyde for 1 h. The fixative was discarded, washed 2 times with PBS, and stained with Giemsa stain for 1 h. Abandoning the staining solution, washing with PBS for 2 times, and filtering the cell membraneCut, the gel of neutral tree is sealed on the glass slide. Photographs were observed using a zeiss microscope and counted.

1.6 RNA extraction and fluorescent real-time quantitative PCR (qRT-PCR)

Same as example 1

1.7 data processing and analysis

Same as example 1

2. Results of the experiment

2.1 in example 2, the present invention examined lncRNA AC073352.1 expression in human breast cancer cell lines and normal breast epithelial cells, showing that lncRNA AC073352.1 expression in breast cancer cell lines MDA-MB-468 and MCF-7 is significantly higher than in normal breast epithelial cells MCF-10A, see FIG. 5.

2.2 in example 2, the results of the RNA fluorescence immune in situ hybridization experiment of the present invention in human breast cancer cell MDA-MB-468 showed that lncRNA AC073352.1 is expressed in both cytoplasm and nucleus, mainly localized to cytoplasm, as shown in FIG. 6.

2.3 in example 2, the invention significantly down-regulated the expression level of lncRNA AC073352.1 in breast cancer cells after transfection of siAC073352.1-1 and siAC073352.1-2 in human breast cancer cells MDA-MB-468 and MCF-7, as shown in FIG. 7. Represents a p value < 0.001.

2.4 in example 2, siAC073352.1-1 and siAC073352.1-2 were transfected in human breast cancer cells MDA-MB-468 and MCF-7, and the results of cell experiments show that knocking down lncRNA AC073352.1 can significantly inhibit the migration and invasion abilities of breast cancer cells, as shown in FIG. 8 and FIG. 9. Represents a p value <0.05, represents a p value < 0.001.

The results show that the lncRNA AC073352.1 is highly expressed in tissues, serum and cells of the breast cancer and is related to poor prognosis, and the ROC curve shows that the diagnosis efficiency is higher; the cell localization shows that lncRNA AC073352.1 is mainly expressed in cytoplasm, and in vitro experiments show that lncRNA AC073352.1 promotes the migration and invasion capacity of breast cancer cells, which indicates that lncRNA AC073352.1 plays the role of cancer-promoting genes in breast cancer. The lncRNA AC073352.1 is expected to become a novel breast cancer diagnosis biomarker and a novel breast cancer treatment target.

The above-described embodiments are exemplary, but only preferred embodiments of the present invention, and the scope of the present invention is not limited thereto, and any simple changes or equivalent substitutions that can be made by those skilled in the art within the technical scope of the present invention will be apparent from the technical scope of the present invention.

The above description is only a preferred embodiment of the present invention, and not intended to limit the present invention in other forms, and any person skilled in the art may apply the above modifications or changes to the equivalent embodiments with equivalent changes, without departing from the technical spirit of the present invention, and any simple modification, equivalent change and change made to the above embodiments according to the technical spirit of the present invention still belong to the protection scope of the technical spirit of the present invention.

SEQUENCE LISTING

<110> secondary Hospital of Shandong university

<120> application of long-chain non-coding RNA AC073352.1 as breast cancer diagnosis marker and treatment target

<130> 1

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 40

<212> DNA

<213> Artificial sequence

<400> 1

tggcaggtct tcctaaggtg agcagaggtt gtagtgacgg 40

<210> 2

<211> 84

<212> DNA

<213> Artificial sequence

<400> 2

ggucuuccua agguggauut taauccaccu uaggaagacc ttgcuaacau augcuucgaa 60

gttcuucgaa gcauauguua gctt 84

<210> 3

<211> 28

<212> DNA

<213> Artificial sequence

<400> 3

ccagcagaac tgacaaggta caaacgga 28

Claims (3)

1. The application of the specific small interfering RNA for inhibiting the expression level of lncRNA AC073352.1 in the preparation of the drugs or reagents for treating breast cancer diseases is characterized in that the sequence of the specific small interfering RNA is

siAC073352.1-1：GGUCUUCCUAAGGUGGAUUTT，AAUCCACCUUAGGAAGACCTT；siAC073352.1-2：

GCUAACAUAUGCUUCGAAGTT，CUUCGAAGCAUAUGUUAGCTT。

2. The use of claim 1, wherein the specific small interfering RNA is targeted to breast cancer cells MDA-MB-468 and MCF-7.

3. The application of the specific small interfering RNA for inhibiting the expression level of lncRNA AC073352.1 in the preparation of the medicine for inhibiting the migration and invasion capacity of breast cancer cells is characterized in that the specific small interfering RNA has the sequence

siAC073352.1-1：GGUCUUCCUAAGGUGGAUUTT，AAUCCACCUUAGGAAGACCTT；siAC073352.1-2：

GCUAACAUAUGCUUCGAAGTT，CUUCGAAGCAUAUGUUAGCTT。

Images