CN117844836A

CN117844836A - Genetic engineering bacteria for producing tetrahydropyrimidine, construction method and application thereof

Info

Publication number: CN117844836A
Application number: CN202311145351.7A
Authority: CN
Inventors: 魏嘉士; 张宝琪; 吕齐
Original assignee: Baikaisheng Shanghai Biotechnology Co ltd
Current assignee: Baikaisheng Shanghai Biotechnology Co ltd
Priority date: 2023-09-06
Filing date: 2023-09-06
Publication date: 2024-04-09

Abstract

The invention discloses a method for constructing genetic engineering bacteria with increased yield of tetrahydropyrimidine, which enhances the ectoA, B and C genes in the genetic engineering bacteria; attenuation of crr, thrA, iclR gene; and enhances the asparate dehydrogenase AspDH gene, the endogenous feedback inhibition-resistant mutant EclysC and ppc genes. The invention also discloses a genetic engineering bacterium with improved yield of the tetrahydropyrimidine obtained by the method and a method for producing the tetrahydropyrimidine and other downstream products taking the tetrahydropyrimidine as a precursor by using the genetic engineering bacterium.

Description

Genetic engineering bacteria for producing tetrahydropyrimidine, construction method and application thereof

Technical Field

The invention relates to the field of biotechnology production. In particular to a genetic engineering bacterium for producing tetrahydropyrimidine, and a construction method and application thereof.

Background

Current production processes for tetrahydropyrimidine include fermentation processes and enzyme-catalyzed processes. Among them, halophilic microorganisms have synthetic pathways for tetrahydropyrimidine, and thus are widely used in fermentation production of tetrahydropyrimidine. Sauer T and the like adopt a bacterial milking method for high-density fermentation to obtain high-yield tetrahydropyrimidine, namely bacteria are cultivated under high osmotic pressure, then solute is released through hypotonic impact, the bacteria are cultivated again under high osmotic pressure, solute is released through hypotonic impact, and the bacteria are circulated for 8-9 times in sequence to obtain the product. Zhu Wanyi (201310416404.4) discloses a novel Halomonas sp.HS-2255 and its mutant strain, the preservation number of which is CGMCCNo.6248, which can be used for producing tetrahydropyrimidine. The strain has higher yield of the tetrahydropyrimidine in a culture medium containing assimilable carbon sources and nitrogen sources and having lower NaCl content, and the content of the by-product hydroxytetrahydropyrimidine is lower.

The enzyme catalysis method is to express ectoine synthesis gene cluster ectABC in escherichia coli to obtain whole cells or crude enzyme liquid with corresponding enzyme activity, and take aspartic acid as a precursor to catalyze the process of synthesizing ectoine. Dong Zhiyang (201310518176.1, 201310534045.2) is prepared by bioconversion reaction of sodium L-aspartate with E.coli BW-pBAD-ectoBC with a preservation number of CGMCC NO. 8334. The thallus can be repeatedly used for five times, and can synthesize 87.5g of extracellular tetrahydropyrimidine with the synthesis efficiency reaching 11.67g/L.d.

In the two methods, the disadvantage of halophilic bacteria fermentation production of tetrahydropyrimidine is that high NaCl concentration is needed to stimulate products with more bacteria volume in the culture process, the fermentation period is long, the high-concentration NaCl solution has serious corrosion to fermentation equipment, the method is not suitable for large-scale industrial production, and simultaneously, the high-salt fermentation waste liquid has great pressure on the environment; the substrate for producing the tetrahydropyrimidine by the enzyme catalysis method is sodium aspartate, and the enzyme needs to be induced to express and extract, so that the operation is complex and the production cost is high.

Therefore, there is a need in the art for a simple, cost-effective, environmentally friendly method for producing tetrahydropyrimidine.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a genetic engineering bacterium for producing tetrahydropyrimidine.

Another technical problem to be solved by the present invention is to provide a method for constructing the genetically engineered probiotics for producing tetrahydropyrimidine.

Another technical problem to be solved by the present invention is to provide a method for producing tetrahydropyrimidine by using the genetically engineered probiotics.

Another technical problem to be solved by the present invention is to provide an application of the genetically engineered probiotics for producing tetrahydropyrimidine for preparing tetrahydropyrimidine.

In order to solve the technical problems, the technical scheme of the invention is as follows:

in a first aspect, the present invention provides a method for constructing a genetically engineered bacterium having increased yield of tetrahydropyrimidine, the method comprising:

1) Enhancing ectoA, B and C genes in the genetically engineered bacteria;

2) Weakening crr, thrA, iclR genes in the genetically engineered bacteria;

3) The asparate dehydrogenase AspDH gene, endogenous feedback inhibition-resistant mutant gene eclysC and ppc gene in the genetically engineered bacterium are enhanced.

In a preferred embodiment, the "enhancing" refers to increasing the expression or activity of an endogenous gene present in the genetically engineered bacterium itself; or exogenously introducing a gene which does not exist in the genetically engineered bacterium, and allowing the exogenously introduced gene to be expressed or to function in the genetically engineered bacterium.

In a preferred embodiment, the "attenuation" refers to a reduction in the expression or activity of one or more genes in the genetically engineered bacterium.

In a preferred embodiment, the "attenuation" means that the expression or activity of the attenuated gene is 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% of the expression or activity of the non-attenuated gene; preferably such that the gene is completely inactivated.

In a preferred embodiment, the "expression or activity of the attenuated gene" may be achieved by, for example, adding an inhibitor to the culture medium of the genetically engineered bacterium or knocking out the gene in the genetically engineered bacterium.

In specific embodiments, the ectoa, B, C genes are derived from halomonas elongata; the AspDH gene and the mutant gene EclysC are derived from pseudomonas aeruginosa; the ppc gene is derived from E.coli.

In a specific embodiment, the sequence of the gene ectoA is shown as SEQ ID NO. 1;

the sequence of the gene ectoB is shown as SEQ ID NO. 2;

the sequence of the gene ecto is shown as SEQ ID NO. 3;

the sequence of the gene crr is shown as SEQ ID NO. 4;

the sequence of the gene thrA is shown in SEQ ID NO. 5;

the sequence of the gene iclR is shown as SEQ ID NO. 6;

the sequence of the gene aspDH is shown as SEQ ID NO. 7;

the sequence of the gene PPC is shown as SEQ ID NO. 8;

the sequence of the gene eclysC is shown as SEQ ID NO. 9.

In a specific embodiment, the genetically engineered bacterium is a strain suitable for producing tetrahydropyrimidine;

preferably, the strain is a bacterium of the genus Escherichia, or corynebacterium glutamicum (Corynebacterium glutamicum); preferably E.coli; more preferably E.coli nissle 1917.

In a preferred embodiment, the strain itself has the ability to produce tetrahydropyrimidine.

In a preferred embodiment, the aspdata gene and the endogenous anti-feedback inhibition mutant gene EclysC are under the control of the J23119 promoter; the ppc gene is under the control of the J23115 promoter.

In a preferred embodiment, the sequence of the J23119 promoter is shown in SEQ ID NO. 10; the sequence of the J23115 promoter is shown as SEQ ID NO. 11.

In a preferred embodiment, the genetically engineered bacterium constructed by the method produces tetrahydropyrimidine at a yield of 70g/L or more.

In a second aspect, the invention provides a genetically engineered bacterium in which the ectoA, B, C genes are enhanced; the crr, thrA, iclR gene is weakened; the asparate dehydrogenase AspDH gene, endogenous feedback inhibition-resistant mutant EclysC and ppc genes were enhanced.

the sequence of the gene ectoB is shown as SEQ ID NO. 2;

the sequence of the gene ecto is shown as SEQ ID NO. 3;

the sequence of the gene crr is shown as SEQ ID NO. 4;

the sequence of the gene thrA is shown in SEQ ID NO. 5;

the sequence of the gene iclR is shown as SEQ ID NO. 6;

the sequence of the gene aspDH is shown as SEQ ID NO. 7;

the sequence of the gene PPC is shown as SEQ ID NO. 8;

the sequence of the gene eclysC is shown as SEQ ID NO. 9.

In a preferred embodiment, the genetically engineered bacterium is prepared by the method of the first aspect.

In a third aspect, the invention provides a genetically engineered bacterium prepared by the method of the first aspect, or an application of the genetically engineered bacterium of the second aspect in preparation of tetrahydropyrimidine.

In a fourth aspect, the present invention provides a process for the preparation of tetrahydropyrimidine, the process comprising:

1) Culturing the genetically engineered bacterium produced by the method of the first aspect, or the genetically engineered bacterium of the second aspect, to produce tetrahydropyrimidine;

2) Optionally isolating and purifying the resulting tetrahydropyrimidine from the culture system obtained in step 1).

In a preferred embodiment, the yield of tetrahydropyrimidine prepared by the method can reach more than 70 g/L.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

FIG. 1 shows a liquid chromatogram of a tetrahydropyrimidine standard;

FIG. 2 shows a liquid chromatogram of a tetrahydropyrimidine broth;

FIG. 3 shows the variation of the tetrahydropyrimidine concentration with the fermentation time.

Detailed Description

The inventors have conducted extensive and intensive studies and have unexpectedly found that the ectoa, B, C genes are enhanced in strains suitable for producing tetrahydropyrimidine; the genetically engineered bacteria obtained by weakening crr, thrA, iclR genes and strengthening aspDH genes, ppc genes and EclysC mutant genes can utilize glucose fermentation to produce tetrahydropyrimidine. The invention not only overcomes the defects of harsh reaction conditions, high energy consumption and the like in the preparation of the tetrahydropyrimidine by a chemical synthesis method; the method also overcomes the defects of complex process, high production cost and the like in the preparation of the tetrahydropyrimidine by fermentation or enzyme catalysis, thereby having better industrial application value. The present invention has been completed on the basis of this finding.

Definition of terms

The term "exogenous" as used herein means that a system contains materials that were not originally present. For example, a gene encoding a gene that is not originally present in a strain is introduced into the strain by transformation or the like, and is "exogenous" to the strain. Accordingly, the term "endogenous" as used herein refers to a substance that is originally present in a system.

The term "enhancing" as used herein refers to increasing, enhancing, augmenting or elevating the expression or activity of a gene or protein, such as an enzyme. It will also be readily understood by those skilled in the art, given the teachings and prior art of the present invention, that "enhancing" as used herein shall also include enhancing the expression or activity of a heterologous gene by expressing that gene. In particular embodiments, enhancing expression or activity of a gene may be accomplished by expressing the gene endogenously or heterologously, and/or increasing the copy number of the gene, and/or modifying the promoter of the gene to enhance transcription initiation rate, and/or modifying the translational regulatory region or rare codons of messenger RNA carrying the gene to enhance translational strength, and/or modifying the gene itself to enhance mRNA stability, protein stability, release of feedback inhibition of the protein, and the like.

The term "attenuation" or "attenuation" as used herein refers to a decrease in the expression or activity of one or more genes. In particular embodiments, inhibitors may be utilized to attenuate the expression or activity of genes. For example, the expression or activity of a weakened gene is 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% of the expression or activity of the non-weakened gene. In a preferred embodiment, the gene to be attenuated may be rendered completely non-expressed or completely inactive. For example, the gene may be directly knocked out.

The invention relates to a construction method of genetically engineered bacteria and constructed strain

The invention provides a method for constructing genetic engineering bacteria with increased yield of tetrahydropyrimidine, which enhances the ectoA, B and C genes in the genetic engineering bacteria; weakening crr, thrA, iclR genes in the genetically engineered bacteria; meanwhile, the aspdata gene of the aspartate dehydrogenase, the endogenous feedback inhibition resistant mutant genes eclysC and ppc in the genetically engineered bacterium are enhanced.

Based on the teachings of the present invention and common general knowledge in the art, the skilled artisan knows and can construct the above genetically engineered bacteria using genes of various origins. In specific embodiments, the ectoa, B, C genes are derived from halomonas elongata; the AspDH gene and the mutant gene EclysC are derived from pseudomonas aeruginosa; the ppc gene is derived from E.coli. In a preferred embodiment, the sequence of the gene ectoA is shown as SEQ ID NO. 1; the sequence of the gene ectoB is shown as SEQ ID NO. 2; the sequence of the gene ecto is shown as SEQ ID NO. 3; the sequence of the gene crr is shown as SEQ ID NO. 4; the sequence of the gene thrA is shown in SEQ ID NO. 5; the sequence of the gene iclR is shown as SEQ ID NO. 6; the sequence of the gene aspDH is shown as SEQ ID NO. 7; the sequence of the gene PPC is shown as SEQ ID NO. 8; the sequence of the gene eclysC is shown as SEQ ID NO. 9.

Based on the teachings of the present invention and the general knowledge in the art, one skilled in the art will also appreciate that promoters may be utilized to further enhance the expression or activity of genes in need thereof. In specific embodiments, the expression of the asparate dehydrogenase AspDH gene and the endogenous anti-feedback inhibition mutant gene EclysC is controlled using the J23119 promoter; the expression of the ppc gene was controlled using the J23115 promoter. In a preferred embodiment, the sequence of the J23119 promoter is shown in SEQ ID NO. 10; the sequence of the J23115 promoter is shown as SEQ ID NO. 11.

For genes that need to be enhanced in the methods of the invention, those skilled in the art will recognize that these genes may be exogenously introduced, i.e., from no to some enhancement; but also the enhancement that the strain originally exists, i.e. from low to high.

For genes that need to be attenuated in the methods of the invention, those skilled in the art will recognize that these genes may be originally present in the strain, and thus inhibitors or complete knockouts may be utilized to reduce the expression or activity of these genes. In certain cases, these genes that need to be attenuated may also be absent from the strain itself.

The improvement of the yield of the tetrahydropyrimidine can not only mean that the original strain does not produce the tetrahydropyrimidine, but also has the capacity of producing the tetrahydropyrimidine after being constructed by the method of the invention; also referred to as the original strain being capable of producing tetrahydropyrimidine, the yield of tetrahydropyrimidine is increased after construction by the method of the invention.

Therefore, the construction method of the invention can not only construct the strain for producing the tetrahydropyrimidine from scratch, but also reconstruct the existing strain for producing the tetrahydropyrimidine. The yield of the tetrahydropyrimidine produced by the genetically engineered bacteria transformed or constructed by the method can reach 70g/L or higher.

The beneficial effects of the invention are mainly as follows:

1. the genetically engineered bacterium constructed by the method can directly ferment and produce the tetrahydropyrimidine by taking the glucose as a substrate;

2. the genetically engineered bacteria constructed by the method can accumulate a large amount of tetrahydropyrimidine under the conventional fermentation condition without high salt concentration;

3. the yield of the tetrahydropyrimidine produced by the genetically engineered bacteria constructed by the method is high;

3. compared with the existing fermentation method and enzyme catalysis method for producing tetrahydropyrimidine salt, the method has the advantages that the cost of the control raw materials in the whole fermentation process of producing tetrahydropyrimidine by the genetically engineered bacteria constructed by the method is low, the culture condition is simple, the equipment loss is small, the fermentation period is short, the operation is simple and convenient, and the collection of bacterial body extraction enzyme liquid is not needed; and

4. the method for producing the tetrahydropyrimidine by using the genetically engineered bacteria constructed by the method is environment-friendly.

The invention is further described below in conjunction with specific embodiments. It should be understood that the following examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The technical means used in the examples are, unless specified otherwise, conventional in the art or are in accordance with the experimental methods recommended by the manufacturers of the kits and instruments. Reagents and biological materials used in the examples were obtained commercially unless otherwise specified.

Example 1 construction of genetically engineered E.coli nissle 1917 producing tetrahydropyrimidine

(1) Construction of the metabolic pathway of L-aspartic acid-beta-semialdehyde to tetrahydropyrimidine.

(1) And (3) designing a pair of primers S1-F/R according to a sequence by synthesizing the codon-optimized ectABC gene by the Kirschner company, and amplifying to obtain an ectABC fragment.

(2) The primer Mut1-F/R clone was designed to obtain pmut1 vector plasmid, and ectABC and pmut1 linear fragments with the same cohesive ends were obtained.

(3) The two target fragments obtained in the step (2) were ligated using the following holy-seamless ligase to obtain the target vector pmut1-ectABC.

(4) Transforming the vector obtained in step (3) into E.coli nissle 1917 to obtain E.coli ECN01

(2) Knock-out of crr Gene

(1) Deleting genes in the escherichia coli genome by using a CRISPR-Cas9 system, adopting a PCR technology, taking an E.coli nissle 1917 genome as a template, designing homologous arm primers at two ends of the genes according to crr gene sequences, amplifying to obtain upstream and downstream homologous arms of the crr genes, and constructing the upstream and downstream homologous arms on a pTargetF vector.

(2) The gene knockout fragment is introduced into E.coli ECN01 containing pCas plasmid to obtain positive transformant, and the crr gene knockout bacterium E.coli ECN02 is obtained after eliminating spectinomycin and kanamycin resistance gene in the positive transformant.

(3) Knockout of iclR Gene

Knocking out the iclR gene by the method in the step (2), obtaining a positive transformant, eliminating the chloramphenicol resistance gene, and obtaining crr and iclR gene knocked-out bacteria E.coli ECN03

(4) Knockout of thrA Gene

Knocking out thrA gene by the method in the step (2), obtaining positive transformant and eliminating chloramphenicol resistance gene to obtain crr, iclR, thrA gene knocked-out bacteria E.coli ECN04.

(5) Overexpression of the endogenous feedback inhibition-resistant mutant gene EclysC

(1) Adopting a PCR technology, taking an E.coli nissle 1917 genome as a template, and designing two pairs of primers to amplify eclysC gene fragments according to eclysC gene sequences;

(2) integrating the fragment into the pmut1 plasmid e site;

(3) the gene fragment (2) was introduced into E.coli ECN04 to obtain a positive transformant, E.coli ECN05.

(6) Overexpression of ppc gene;

(1) adopting a PCR technology, taking an E.coli nissle 1917 genome as a template, and designing a pair of primers according to a ppc gene sequence to amplify a ppc gene fragment;

(2) integrating the fragment into the pmut1 plasmid e site;

(3) the gene fragment (2) is introduced into E.coli ECN05 to obtain a positive transformant, namely E.coli ECN06.

(7) Overexpression of aspDH Gene

(1) The aspDH gene is synthesized by the Jinsry company and subjected to codon optimization, a pair of primers is designed according to the sequence, and an aspDH gene fragment is amplified;

(2) integrating the fragment into the pmut1 plasmid e site;

(3) the gene fragment (2) was introduced into E.coli ECN06 to obtain a positive transformant, namely E.coli ECN07.

The genetic engineering bacteria for producing the tetrahydropyrimidine can be seen as follows:

1) The gene crr encoding the glucose-specific enzyme domain A of the phosphotransferase system and the gene iclR encoding the glyoxylate cycle transcription repressor in E.coli are deleted to reduce the consumption of phosphoenolpyruvate and to enhance glyoxylate cycle, making the carbon stream more useful for the synthesis of oxaloacetate.

2) Knocking out a gene thrA encoding aspartokinase/homoserine dehydrogenase in the genome of the escherichia coli to weaken threonine pathway; meanwhile, in order to supplement the deficiency of aspartokinase activity, the mutant gene EclysC of endogenous anti-feedback inhibition of escherichia coli is overexpressed.

3) Replacing the ppc promoter of the phosphoenolpyruvate kinase encoding gene with the J23115 promoter for overexpression; the P.aeruginosa aspartate dehydrogenase AspDH gene controlled by the J23119 promoter was integrated in the pmut1 vector to enhance the conversion of oxaloacetate to aspartate.

Through the series of transformation, the metabolic flux from glucose to L-aspartic acid-beta-semialdehyde is enhanced, the branch metabolism of the L-aspartic acid-beta-semialdehyde is weakened, the engineering bacteria can directly utilize glucose to ferment to produce the tetrahydropyrimidine, the yield of the tetrahydropyrimidine after 72h of fermentation reaches 70.77g/L, and the specific method for producing the tetrahydropyrimidine is shown in example 2.

EXAMPLE 2 fermentation culture and detection of engineering bacterium E.coli ECN07 producing tetrahydropyrimidine

In this example, the genetic engineering bacteria e.coli ECN07 producing tetrahydropyrimidine were fermented and tested, and the specific steps are as follows:

(1) Activating genetic engineering bacteria (E.coli ECT06 engineering bacteria) for generating tetrahydropyrimidine by using a bacterial complete culture medium, and culturing at a constant temperature of 37 ℃ for 12 hours;

(2) Transferring the activated inclined plane to a second-generation activated inclined plane, and culturing for 10 hours at the constant temperature of 37 ℃;

(3) Seed culture, scraping a ring of strain into a 250mL round bottom triangular flask filled with 50mL of seed culture medium by using an inoculating loop, and shake culturing at 37 ℃ and 220rpm for 6-8h, wherein the strain is first-stage seed liquid; inoculating the first-stage seed solution into seed culture medium (such as shaking bottle liquid amount 200 ml) with 0.1-10% inoculum size, shake culturing at 37deg.C and 220rpm for 6-8 hr to obtain second-stage seed solution.

(4) Inoculating the secondary seed liquid into a fermentation tank containing a fermentation medium by using a pipette for fermentation culture; the fermentation conditions are as follows: the liquid filling amount of the fermentation tank is 30-70%. Inoculating the seed solution into a fermentation tank filled with a fermentation medium according to an inoculum size of 0.1-10%, wherein the initial fermentation condition is 30-37 ℃, the dissolved oxygen is maintained at 0.1-1vvm in the fermentation process, the residual sugar in the fermentation liquid is controlled at 0.5-5g/L by feeding glucose solution in the fermentation process, the pH is controlled at 6.8-7.4 by ammonia water, and the fermentation is carried out for 48-72h.

(5) Collecting fermentation liquor, centrifuging at 13000rpm, collecting supernatant phase, and detecting tetrahydropyrimidine content;

(6) Diluting the supernatant by 200 times by using deionized water, and filtering by a 0.22 mu m microporous filter membrane to be tested;

(7) The tetrahydropyrimidine content in the sample was determined using 1260 info II liquid chromatography system (agilent). The sample is prepared by using a microscale sample injection needle, the sample injection amount is 20 μl, the chromatographic column is HILIC Amide chromatographic column, the column temperature is 30 ℃, the mobile phase is 1% acetonitrile, the flow rate is 1mL/min, the ultraviolet detection wavelength is 210nm, and the peak outlet time is about 4.0min. After 48h of fermentation, the tetrahydropyrimidine content in the fermentation broth was 70.77g/L (FIG. 3) as measured by liquid chromatography, as shown in FIGS. 1 and 2.

The seed culture medium comprises the following components: glucose 2.5%, yeast powder 1%, peptone 0.6%, KH ₂ PO ₄ 1.2％，MgSO ₄ ·7H ₂ O 0.5％，FeSO ₄ ·7H ₂ O 10mg/l，MnSO ₄ ·H ₂ O10 mg/l, vitamin B11.3mg/l, vitamin H0.3 mg/l, and deionized water.

The fermentation medium comprises the following components: glucose 2.0%, yeast powder 0.2%, peptone 0.4%, sodium citrate 0.01%, KH ₂ PO ₄ 0.2％，MgSO ₄ ·7H ₂ O 0.07％，FeSO ₄ ·7H ₂ O 80mg/l，MnSO ₄ ·H ₂ O80mg/l, vitamin B10.8mg/l, vitamin H0.2 mg/l, and deionized water.

Therefore, aiming at the problems in the background technology, the invention provides an engineering bacterium capable of producing tetrahydropyrimidine, wherein the engineering bacterium has escherichia coli with a specific genotype and contains an ectopic gene derived from halophila elongata; crr, thrA, iclR three gene-defective; pseudomonas aeruginosa aspDH gene with J23119 promoter control; the ppc gene under the control of the J23115 promoter; the tacJ23119 promoter controls eclysC mutant genes. Under the combined action of the genotypes, the engineering bacteria for the tetrahydropyrimidine can ferment with glucose as a substrate to produce the tetrahydropyrimidine, and can overcome the defects of harsh reaction conditions, high energy consumption and the like of a chemical synthesis method; can overcome the defects of complex process, high production cost and the like existing in the halomonas elongata fermentation or enzyme catalysis method.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

The sequences to which the invention relates

Gene ectoA (SEQ ID NO: 1)

ATGAACGCAACCACAGAGCCCTTTACACCCTCCGCCGACCTGGCCAAGCCCAGCGTGGCCGATGCCGTGGTCGGCCATGAGGCCTCACCGCTCTTCATCCGCAAGCCAAGCCCCGATGACGGCTGGGGCATCTACgAGCTGGTCAAGTCCTGTCCGCCTCTCGACGTCAATTCCGCCTACGCCTATCTGTTGCTGGCCACCCAGTTCCGCGATAGCTGCGCCGTGGCGACCAACGAAGAGGGCGAGATCGTCGGCTTCGTTTCCGGCTACGTGAAGAGCAACGCCCCCGATACCTATTTCCTCTGGCAGGTTGCCGTGGGCGAGAAGGCACGTGGCACCGGCCTGGCCCGTCGTCTGGTGGAAGCCGTGATGACACGCCCGGAAATGGCCGAGGTCCACCATCTCGAGACCACTATCACGCCCGACAACCAGGCGTCCTGGGGCTTGTTCCGCCGTCTCGCCGATCGCTGGCAGGCGCCGTTGAACAGCCGCGAATACTTCTCCACCGATCAACTCGGCGGTGAGCATGACCCGGAAAACCTCGTTCGCATCGGCCCGTTCCAGACCGACCAGATCTGA

Gene ectoB (SEQ ID NO: 2)

ATGCAGACCCAGATTCTCGAACGCATGGAGTCCGACGTTCGGACCTACTCCCGCTCCTTCCCGGTCGTCTTCACCAAGGCGCGCAATGCCCGCCTGACCGACGAGGAAGGGCGCGAGTACATCGACTTCCTGGCCGGTGCCGGCACCCTGAACTACGGCCACAACAACCCGCACCTCAAGCAGGCGCTGCTCGACTATATCGACAGCGACGGCATCGTCCACGGCCTGGACTTCTGGACTGCGGCCAAGCGCGACTATCTGGAAACCCTGGAAGAGGTGATCCTCAAGCCGCGCGGTCTCGACTACAAGGTGCATCTGCCCGGACCGACTGGCACCAACGCCGTCGAGGCGGCCATTCGCCTGGCCCGGGTCGCCAAGGGGCGCCACAATATCGTCTCCTTCACCAACGGCTTTCATGGCGTCACCATGGGCGCGCTGGCGACCACCGGTAACCGCAAGTTCCGCGAGGCCACCGGTGGCGTGCCGACCCAGGCTGCTTCCTTCATGCCGTTCGATGGCTACCTCGGCAGCAGCACCGACACCCTCGACTACTTCGAGAAGCTGCTCGGCGACAAGTCCGGCGGCCTGGACGTGCCCGCGGCGGTGATCGTCGAGACAGTGCAGGGCGAGGGCGGTATCAATGTCGCCGGCCTGGAGTGGCTCAAGCGCCTCGAGAGCATCTGCCGCGCCAATGACATCCTGCTGATCATCGACGACATCCAGGCGGGCTGCGGCCGGACCGGCAAGTTCTTCAGCTTCGAGCATGCCGGCATCACGCCGGATATCGTGACCAACTCCAAGTCGCTGTCCGGTTACGGCCTGCCGTTCGCTCACGTCCTGATGCGCCCCGAGCTCGACAAGTGGAAGCCCGGTCAGTACAACGGCACCTTCCGCGGCTTCAACCTGGCTTTCGCCACTGCTGCTGCCGCCATGCGCAAGTACTGGAGCGACGACACCTTCGAGCGTGACGTGCAGCGCAAGGCTCGCATCGTCGAGGAACGCTTCGGCAAGATCGCCGCCTGGCTGAGCGAGAACGGCATCGAGGCCTCCGAGCGCGGCCGCGGGCTGATGCGGGGCATCGACGTGGGTTCCGGCGATATCGCCGACAAGATCACCCACCAAGCCTTCGAGAACGGGTTGATCATCGAAACCAGCGGTCAGGACGGCGAAGTGGTCAAGTGCCTGTGCCCGCTGACCATTCCCGACGAAGACCTGGTCGAGGGACTCGACATCCTCGAGACCAGCACCAAGCAGGCCTTTAGCTGA

Gene ectC (SEQ ID NO: 3)

ATGATCGTTCGCAATCTCGAAGAAGCGCGCCAGACCGACCGTCTGGTCACCGCCGAAAACGGCAACTGGGACAGCACCCGCCTGTCGCTGGCCGAAGATGGTGGCAACTGCTCCTTCCACATCACCCGCATCTTCGAGGGTACCGAGACCCACATCCACTATAAGCATCACTTCGAGGCTGTTTATTGCATCGAAGGCGAGGGCGAAGTGGAAACCCTGGCCGATGGCAAGATCTGGCCCATCAAGCCGGGTGACATCTACATCCTCGACCAGCACGACGAGCACCTGCTGCGCGCCAGCAAGACCATGCACCTGGCCTGCGTGTTCACGCCGGGCCTGACCGGCAACGAAGTGCACCGCGAAGACGGTTCCTACGCACCTGCCGACGAAGCCGACGACCAGAAGCCGCTGTAA

Gene crr (SEQ ID NO: 4)

ATGGGTTTGTTCGATAAACTGAAATCTCTGGTTTCCGACGACAAGAAGGATACCGGAACTATTGAGATCATTGCTCCGCTCTCTGGCGAGATCGTCAATATCGAAGACGTGCCGGATGTCGTTTTTGCGGAAAAAATCGTTGGTGATGGCATTGCTATCAAACCAACGGGTAACAAAATGGTCGCGCCTGTAGACGGCACCATTGGTAAAATCTTTGAAACCAACCACGCGTTCTCTATCGAATCTGATAGCGGCGTTGAGCTGTTCGTCCACTTCGGTATCGACACCGTTGAACTGAAAGGCGAAGGCTTCAAGCGTATTGCTGAAGAAGGTCAGCGCGTGAAAGTTGGTGATACTGTCATTGAATTTGATCTGCCGCTGCTGGAAGAGAAAGCCAAGTCAACCCTGACTCCGGTTGTTATCTCCAACATGGACGAAATCAAAGAACTGATCAAACTGTCCGGTAGCGTAACCGTGGGTGAAACCCCGGTTATCCGCATCAAGAAGTAA

Gene thrA (SEQ ID NO: 5)

ATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGGGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCATCTGGTAGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTCTGACGGGACTCGCCGCCGCCCAGCCGGGATTTCCGCTGGCACAATTGAAAACTTTCGTCGACCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATCAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTGTTAGAAGCGCGTGGTCACAACGTTACCGTTATCGATCCGGTCGAAAAACTGCTGGCAGTGGGTCATTACCTCGAATCTACCGTTGATATTGCTGAATCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGACCACATGGTGCTGATGGCTGGTTTCACTGCCGGTAATGAAAAAGGCGAGCTGGTGGTTCTGGGACGCAACGGTTCCGACTACTCCGCTGCGGTGCTGGCGGCCTGTTTACGCGCCGATTGTTGCGAGATCTGGACGGATGTTGACGGTGTTTATACCTGCGATCCGCGTCAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTATCAGGAAGCGATGGAGCTTTCTTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATCACCCCCATCGCCCAGTTTCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCTCAAGCACCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACCGGTCAAGGGCATTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCCGGCCCGGGGATGAAAGGGATGGTTGGCATGGCGGCGCGCGTCTTTGCAGCGATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGAATACAGTATCAGTTTCTGCGTTCCGCAAAGCGACTGTGTGCGAGCTGAACGGGCAATGCAGGAAGAGTTCTACCTGGAACTGAAAGAAGGTTTACTGGAGCCGTTGGCGGTGACGGAACGGCTGGCCATTATCTCGGTGGTAGGTGATGGTATGCGCACCTTACGTGGGATCTCGGCGAAATTCTTTGCCGCGCTGGCCCGCGCCAATATCAACATTGTCGCCATTGCTCAGGGATCTTCTGAACGCTCAATCTCTGTCGTGGTCAATAACGATGATGCGACCACTGGCGTGCGCGTTACTCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTGGCGTCGGTGGCGTTGGCGGTGCGCTGCTGGAGCAACTGAAGCGTCAGCAAAGCTGGTTGAAGAATAAACATATCGACTTACGTGTCTGCGGTGTTGCTAACTCGAAGGCACTCCTCACCAATGTACATGGCCTTAATCTGGAAAACTGGCAGGAAGAACTGGCGCAAGCCAAAGAGCCGTTTAATCTCGGGCGCTTAATTCGCCTCGTGAAAGAATATCATCTGCTGAACCCGGTCATTGTTGACTGTACTTCCAGCCAGGCAGTGGCGGATCAATATGCCGACTTCCTGCGCGAAGGTTTCCACGTTGTTACGCCGAACAAAAAGGCCAACACCTCGTCGATGGATTACTACCATCAGTTGCGTTATGCGGCGGAAAAATCGCGGCGTAAATTCCTCTATGACACCAACGTTGGGGCTGGATTACCGGTTATCGAGAACCTGCAAAATCTGCTCAATGCTGGTGATGAATTGATGAAGTTCTCCGGCATTCTTTCAGGTTCGCTTTCTTATATCTTCGGCAAGTTAGACGAAGGCATGAGTTTCTCCGAGGCGACCACACTGGCGCGGGAAATGGGTTATACCGAACCGGACCCGCGAGATGATCTTTCTGGTATGGATGTGGCGCGTAAGCTATTGATTCTCGCTCGTGAAACGGGACGTGAACTGGAGCTGGCGGATATTGAAATTGAACCTGTGCTGCCCGCAGAGTTTAACGCCGAGGGTGATGTCGCCGCTTTTATGGCGAATCTGTCACAGCTCGACAATCTCTTTGCCGCGCGTGTGGCGAAGGCCCGTGATGAAGGAAAAGTTTTGCGCTATGTTGGCAATATTGATGAAGATGGCGTCTGCCGCGTGAAGATTGCCGAAGTGGATAGTAATGATCCGCTGTTCAAAGTGAAAAATGGCGAAAACGCCCTGGCCTTCTATAGCCACTATTATCAGCCGCTGCCGTTGGTACTGCGCGGATATGGTGCGGGCAATGACGTTACAGCTGCCGGTGTCTTTGCTGATCTGCTACGTACCCTCTCATGGAAGTTAGGAGTCTGA

Gene iclR (SEQ ID NO: 6)

TCAGCGTATTCCACCGTACGCCAGCGTCACTTCCTTCGCCGCTTTAATCACCATCGCGCCAAACTCGGTCACGCGGTCATCGGTAATACGTGAAATCGGTCCGGAAATTGAAATTGCGGCAAACGGTTCGCGGTGCTCATCGAAAATACACGCTGCAAGGCAACGCAGCCCCAGCGCATGTTCCTCATCGTCAAATGAATAACCCCGTTTGCGCGTTTGGGCGAGATCTTCTTTTAAATGCACAGGAGACACCAGCGTCGCGTGGGTATAGGCATGTAACCCTTTGCGGTGCAGCAGCTTCGTCACCTGTTCTTCGCTCAGTTGGGCCAGAAAGGCTTTACCCGCACCGGAAGCGTGCATCGGCAATTTACCGCCGATAGGCGCGGACATACGCATCAGGTGAGTACACTGTACCTGGTCGATAATAATCGCTTCGTGATTGCTTTGATCAAGCACCGCCATATTGACCGTTTCGCCAGACTCTTCCATTAGATTGCGCAGGATAGGGTGAACAATCGCTAACAAATTACGGCTCTGGAGAAAGCTGCTACCGACCATAAAGGCGTGTGCGCCGATTGCCCAGTGACCCAGTTCGCCGACCTGACGGACAAAGCCCTGTTGCTGCATCGTGGTTAGCAGGCGGTGGGTCGTGGAATTGGGTAACCCGGCTTGCTGTGCCAGTTCCGTGAGTGCCACACTGCCATTGGATTCGGCAATCCACTCCAGTAATTTCAGGCCACGCGTTAAAGACTGAACCTGTCCAGTCGCTGGTGCGGTGGCAACGGCGGGTTTTCTGCCGCGTTTTGCGGGAATGGGTGCGACCAT

Gene aspDH (SEQ ID NO: 7)

ATGGCCCTGAATATTGTGATGATTGGTTGTGGTGCCATTGGCGCCGGTGTGCTGGAATTATTAGAAAATGATCCGCAGCTGCGTGTGGATGCCGTGATTGTGCCACGTGATAGCGAAACCCAGGTGCGTCATCGTCTGGCCAGTTTACGTCGTCCGCCACGTGTTCTGAGTGCCTTACCGGCAGGTGAACGTCCAGATCTTCTGGTGGAATGTGCCGGTCATCGTGCCATTGAACAGCATGTGCTGCCGGCCTTAGCCCAGGGTATTCCGTGTTTAGTGGTGAGCGTGGGTGCCCTTAGCGAACCAGGTTTAGTGGAACGTCTGGAAGCCGCCGCACAAGCCGGTGGTAGTCGTATTGAACTTCTGCCGGGTGCCATTGGTGCCATTGATGCCTTAAGCGCCGCACGTGTTGGTGGTTTAGAAAGCGTGCGTTATACCGGTCGTAAACCGGCCAGCGCCTGGTTAGGTACACCAGGTGAAACAGTTTGTGATCTGCAGCGTCTGGAAAAAGCCCGTGTGATTTTTGATGGTAGCGCCCGTGAAGCCGCCCGTTTATATCCGAAAAATGCCAATGTGGCCGCCACCCTGAGCCTGGCAGGTCTTGGTTTAGATCGTACACAAGTTCGTCTGATTGCCGATCCGGAAAGCTGTGAAAATGTGCATCAGGTGGAAGCCAGCGGTGCCTTTGGTGGTTTTGAACTGACCCTGCGTGGTAAACCGCTGGCCGCCAATCCAAAAACCAGCGCCTTAACCGTTTATAGCGTGGTGCGTGCACTGGGTAATCATGCCCATGCCATTAGCATTTAA

Gene PPC (SEQ ID NO: 8)

ATGAACGAACAATATTCCGCATTGCGTAGTAATGTCAGTATGCTCGGCAAAGTGCTGGGAGAAACCATCAAGGATGCGTTGGGAGAACACATTCTTGAACGCGTAGAAACTATCCGTAAGTTGTCCAAATCTTCACGCGCTGGCAATGATGCTAACCGCCAGGAGTTGCTCACCACCTTACAAAATTTGTCGAACGACGAGCTGCTGCCCGTTGCGCGTGCGTTTAGTCAGTTCCTGAACCTGGCCAACACCGCTGAGCAATACCACAGCATTTCGCCGAAAGGCGAAGCTGCCAGCAACCCGGAAGTGATCGCCCGCACCCTGCGTAAACTGAAAAACCAGCCGGAACTGAGCGAAGACACCATCAAAAAAGCAGTGGAATCGCTGTCGCTGGAACTGGTCCTCACGGCTCACCCAACCGAAATTACCCGTCGTACACTGATCCACAAAATGGTGGAAGTGAACGCCTGTTTAAAACAGCTCGATAACAAAGATATCGCCGACTACGAACACAACCAGCTGATGCGCCGCCTGCGCCAGTTGATCGCCCAGTCATGGCATACCGATGAAATCCGTAAACTGCGCCCAAGCCCGGTAGATGAAGCCAAATGGGGCTTTGCCGTAGTAGAAAACAGCCTGTGGCAAGGCGTACCGAATTACCTGCGCGAACTGAACGAACAACTGGAAGAGAACCTCGGCTACAAACTGCCCGTCGAATTTGTTCCGGTCCGTTTTACCTCGTGGATGGGCGGTGACCGCGACGGCAACCCGAACGTCACTGCCGATATCACCCGCCACGTCCTGCTACTCAGCCGCTGGAAAGCCACCGATTTGTTCCTGAAAGATATTCAGGTTCTGGTTTCTGAACTGTCGATGGTTGAAGCCACCCCTGAACTGCTGGCGCTGGTTGGCGAAGAGGGTGCCGCAGAACCGTATCGCTATCTGATGAAAAACCTGCGTTCTCGCCTGATGGCGACACAGGCATGGCTGGAAGCGCGCCTGAAAGGCGAAGAATTGCCAAAACCAGAAGGTCTGCTGACACAAAACGAAGAACTGTGGGAACCGCTCTACGCTTGCTACCAGTCACTTCAGGCGTGTGGCATGGGTATTATCGCCAATGGCGATCTGCTCGACACCCTGCGCCGCGTGAAATGTTTCGGCGTACCGCTGGTGCGTATTGATATCCGTCAGGAGAGCACGCGTCATACCGAAGCATTAGGCGAACTGACCCGCTACCTCGGTATCGGCGATTATGAAAGCTGGTCAGAAGCCGACAAACAGGCGTTCCTGATCCGCGAACTGAACTCCAAACGTCCGCTTCTACCACGCAACTGGCAACCAAGCGCCGAAACGCGCGAAGTGCTCGATACCTGCCAGGTGATTGCCGAAGCGCCGCAAGGCTCCATTGCCGCCTACGTGATCTCGATGGCGAAAACGCCGTCCGACGTGCTGGCTGTCCACCTGCTGCTGAAAGAAGCGGGTATCGGGTTTGCGATGCCGGTTGCTCCGCTGTTTGAAACCCTCGATGACCTGAACAACGCCAACGATGTCATGACCCAGCTGCTGAATATCGACTGGTATCGCGGCCTGATTCAGGGCAAACAGATGGTGATGATTGGCTATTCCGACTCAGCAAAAGATGCGGGCGTGATGGCAGCTTCCTGGGCGCAATATCAGGCACAGGATGCATTAATCAAAACCTGCGAAAAAGCGGGTATTGAGCTGACGTTGTTCCACGGTCGCGGCGGTTCCATTGGTCGCGGCGGCGCACCTGCCCATGCGGCGCTGCTGTCACAACCGCCAGGAAGCCTGAAAGGTGGCCTGCGCGTGACCGAACAGGGCGAGATGATCCGCTTTAAATATGGTCTGCCAGAAATCACCGTCAGCAGCCTGTCGCTGTACACCGGGGCGATTCTGGAAGCCAACCTGCTGCCACCGCCTGAGCCGAAAGAGAGCTGGCGTCGCATTATGGATGAACTGTCAGTCATCTCCTGCGATCTCTACCGTGGCTACGTACGTGAAAACAAAGATTTTGTGCCTTACTTCCGCTCCGCTACGCCGGAACAAGAATTGGGTAAACTGCCGTTGGGTTCACGTCCGGCGAAACGTCGCCCAACCGGCGGCGTCGAGTCACTGCGCGCTATTCCGTGGATTTTCGCCTGGACGCAAAACCGCCTGATGCTCCCCGCCTGGCTGGGTGCAGGTACGGCGCTGCAAAAAGTGGTCGAAGATGGCAAACAGAGCGAGCTGGAAGCCATGTGCCGCGATTGGCCATTCTTCTCGACGCGTCTCGGCATGCTGGAGATGGTCTTCGCCAAAGCAGACCTGTGGCTGGCGGAATACTATGACCAACGCCTGGTAGACAAAGCACTGTGGCCGTTAGGTAAAGAGTTACGCAATCTGCAAGAAGAAGACATCAAAGTGGTGCTGGCGATTGCCAACGATTCTCACCTGATGGCCGATCTGCCGTGGATTGCAGAGTCTATTCAGCTACGGAATATTTACACCGACCCGCTGAACGTATTGCAGGCCGAGTTGCTGCACCGCTCCCGCCAGGCAGAAAAAGAAGGCCAGGAACCGGATCCTCGCGTCGAGCAGGCGTTAATGGTCACTATTGCCGGGATTGCGGCAGGTATGCGTAATACCGGCTAA

Gene eclysC (SEQ ID NO: 9)

ATGTCTGAAATTGTTGTCTCCAAATTTGGCGGTACCAGCGTAGCTGATTTTGACGCCATGAACCGCAGCGCTGATATTGTGCTTTCTGATGCCAACGTGCGTTTAGTTGTCCTCTCGGCTTCTGCTGGTATCACTAATCTGCTGGTCGCTTTAGCTGAAGGACTGGAACCTGGCGAGCGATTCGAAAAACTCGACGCTATTCGCAACATCCAGTTTGCCATTCTGGAACGTCTGCGTTACCCGAACGTTATCCGTGAAGAGATTGAACGTCTGCTGGAGAACATTACTGTTCTGGCAGAAGCGGCGGCGCTGGCAACGTCTCCGGCGCTGACAGATGAACTGGTCAGCCACGGCGAGCTGATGTCGACCCTGCTGTTTGTCGAGATCCTGCGCGAACGCGATGTTCAGGCACAGTGGTTTGATGTACGTAAAGTGATGCGTACCAACGATCGATTTGGTCGTGCAGAGCCAGATGTAGCCGCGCTGGCGGAACTGGCCGCGCTGCAGCTGCTCCCACGCCTCAATGAAGGCTTAGTGATCACCCAGGGATTTATCGGCAGCGAAAATAAAGGTCGTACAACGACGCTTGGCCGTGGAGGCAGCGATTATACGGCAGCCTTGCTGGCGGAGGCTTTACACGCATCTCGTGTTGATATCTGGACCGACGTCCCGGGCATCTACACCACCGATCCGCGCGTGGTTTCCGCAGCAAAACGCATTGATGAAATCGCGTTTGCCGAAGCGGCAGAGATGGCAACTTTTGGTGCAAAAGTACTGCATCCGGCAACGTTGCTACCCGCAGTACGCAGCGATATCCCAGTCTTTGTCGGCTCCAGCAAAGACCCACGCGCAGGTGGTACGCTGGTGTGCAATAAAACTGAAAATCCGCCGCTGTTCCGCGCGCTGGCGCTTCGTCGCAATCAGACTCTGCTCACTTTGCACAGCCTGAATATGCTGCATTCTCGCGGTTTCCTCGCGGAAGTTTTCGGCATCCTCGCGCGGCATAATATTTCGGTAGACTTAATCACCACGTCAGAAGTGAGTGTGGCATTAATCCTTGATACCACCGGTTCAACCTCCACTGGCGATACGTTGCTGACGCAATCCCTGCTGATGGAGCTTTCCGCACTGTGCCGGGTGGAAGTGGAAGAGGGTCTGGCGCTGGTCGCGTTGATTGGCAATGACCTGTCAAAAGCCTGCGGCGTTGGCAAAGAGGTATTCGGCGTACTGGAACCGTTCAACATTCGCATGATTTGTTACGGCGCATCCAGCCATAACCTGTGCTTCCTGGTGCCCGGCGAAGATGCCGAGCAGGTAGTGCAGAAGCTGCATTTTAATTTATTTGAGTAA

J23115 promoter (SEQ ID NO: 10)

tttatagctagctcagcccttggtacaatgctagc

J23119 promoter (SEQ ID NO: 11)

ttgacagctagctcagtcctaggtataatgctagc。

Claims

1. A method of constructing a genetically engineered bacterium having increased yield of tetrahydropyrimidine, the method comprising:

1) Enhancing ectoA, B and C genes in the genetically engineered bacteria;

2) Weakening crr, thrA, iclR genes in the genetically engineered bacteria;

2. The method of claim 1, wherein the ectoa, B, C genes are derived from halomonas elongata; the AspDH gene and the mutant gene EclysC are derived from pseudomonas aeruginosa; the ppc gene is derived from E.coli.

3. The method according to claim 2, wherein the sequence of the gene ectoA is shown in SEQ ID NO. 1;

the sequence of the gene ectoB is shown as SEQ ID NO. 2;

the sequence of the gene ecto is shown as SEQ ID NO. 3;

the sequence of the gene crr is shown as SEQ ID NO. 4;

the sequence of the gene thrA is shown in SEQ ID NO. 5;

the sequence of the gene iclR is shown as SEQ ID NO. 6;

the sequence of the gene aspDH is shown as SEQ ID NO. 7;

the sequence of the gene PPC is shown as SEQ ID NO. 8;

the sequence of the gene eclysC is shown as SEQ ID NO. 9.

4. The method of claim 3, wherein the genetically engineered bacterium is a strain suitable for producing tetrahydropyrimidine;

5. A genetically engineered bacterium, wherein the ectoA, B and C genes in the genetically engineered bacterium are enhanced; the crr, thrA, iclR gene is weakened; the asparate dehydrogenase AspDH gene, endogenous feedback inhibition-resistant mutant EclysC and ppc genes were enhanced.

6. The genetically engineered bacterium of claim 5, wherein the ectoa, B, C genes are derived from halomonas elongata; the AspDH gene and the mutant gene EclysC are derived from pseudomonas aeruginosa; the ppc gene is derived from E.coli.

7. The genetically engineered bacterium of claim 6, wherein the sequence of the gene ectoA is shown in SEQ ID NO. 1;

the sequence of the gene ectoB is shown as SEQ ID NO. 2;

the sequence of the gene ecto is shown as SEQ ID NO. 3;

the sequence of the gene crr is shown as SEQ ID NO. 4;

the sequence of the gene thrA is shown in SEQ ID NO. 5;

the sequence of the gene iclR is shown as SEQ ID NO. 6;

the sequence of the gene aspDH is shown as SEQ ID NO. 7;

the sequence of the gene PPC is shown as SEQ ID NO. 8;

the sequence of the gene eclysC is shown as SEQ ID NO. 9.

8. The genetically engineered bacterium of claim 7, wherein said genetically engineered bacterium is a strain suitable for producing tetrahydropyrimidine;

9. The genetically engineered bacterium prepared by the method of any one of claims 1 to 4, or the use of the genetically engineered bacterium of any one of claims 5 to 8 in the preparation of tetrahydropyrimidine.

10. A method of preparing tetrahydropyrimidine, the method comprising:

1) Culturing the genetically engineered bacterium produced by the method of any one of claims 1-4, or the genetically engineered bacterium of any one of claims 5-8 to produce tetrahydropyrimidine;