CN112011578B - Method for producing acetylacetone by extracellular enzyme reaction - Google Patents
Method for producing acetylacetone by extracellular enzyme reaction Download PDFInfo
- Publication number
- CN112011578B CN112011578B CN201910464183.5A CN201910464183A CN112011578B CN 112011578 B CN112011578 B CN 112011578B CN 201910464183 A CN201910464183 A CN 201910464183A CN 112011578 B CN112011578 B CN 112011578B
- Authority
- CN
- China
- Prior art keywords
- acetylacetone
- enzyme reaction
- extracellular enzyme
- producing
- dke1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
- C12P7/26—Ketones
- C12P7/28—Acetone-containing products
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
- C12Y113/11—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of two atoms of oxygen (1.13.11)
- C12Y113/1105—Acetylacetone-cleaving enzyme (1.13.11.50)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a method for generating acetylacetone through extracellular enzyme reaction, belonging to the technical field of biological engineering. The method comprises the following steps: 1) the acetylacetone lyase mutant gene Dke1K15QConnecting to an expression vector to obtain a recombinant vector; 2) transforming the recombinant vector obtained in the step 1) into host bacteria to obtain recombinant bacteria, and fermenting and culturing the recombinant bacteria to obtain a culture solution; 3) treating the culture solution obtained in the step 2) to obtain an enzyme solution; 4) mixing the enzyme solution obtained in the step 3) with a reaction substrate, and reacting to prepare acetylacetone. The method provided by the invention can convert methylglyoxal and ammonium acetate into acetylacetone in vitro by using enzyme reaction, the yield reaches 388.9mg/L, and a new thought is provided for solving the problem of toxicity inhibition of acetylacetone on cells in a whole cell synthesis system.
Description
Technical Field
The invention relates to a method for producing acetylacetone by extracellular enzyme reaction, belonging to the technical field of biological engineering.
Background
Acetylacetone, also known as 2, 4-pentanedione, has wide applications in various industries such as medicine, agriculture, chemical industry, and the like. The prior acetylacetone is mainly obtained by a chemical synthesis method, which generally has the defects of low yield, high energy consumption, high cost, large environmental protection pressure and the like, and does not meet the current requirements of low-carbon economy. The biological method has high synthesis efficiency, low energy consumption and low cost, can avoid the generation of a large amount of pollutants, and has obvious advantages compared with a chemical method.
The biosynthesis of acetylacetone has not received much attention. In the Chinese patent CN201810865467.0, the production of acetylacetone by fermentation using glucose as a substrate is realized for the first time after the overexpression in Escherichia coli by optimizing the nucleotide sequence of an acetylacetone lyase gene from Acinetobacter johnsonii. The production of acetylacetone is also low due to the toxicity of acetylacetone to microbial cells (Water Research,1980,14(3): 231-241.).
Disclosure of Invention
In order to solve the above problems, the present invention provides a method for producing acetylacetone by an extracellular enzyme reaction, comprising the steps of:
1) connecting the acetylacetone lyase mutant gene Dke 1K 15Q to an expression vector to obtain a recombinant vector;
2) transforming the recombinant vector obtained in the step 1) into host bacteria to obtain recombinant bacteria, and fermenting and culturing the recombinant bacteria to obtain a culture solution;
3) treating the culture solution obtained in the step 2) to obtain an enzyme solution;
4) mixing the enzyme solution obtained in the step 3) with a reaction substrate, and reacting to prepare acetylacetone.
The sequence of the acetylacetone lyase mutant gene Dke 1K 15Q in the step 1) is shown as SEQ ID NO. 2. The amino acid sequence of the acetylacetone lyase mutant expressed by the gene is shown as SEQ ID NO. 1.
The expression vector in the step 1) is pETDuet-1.
The host bacterium in the step 2) is escherichia coli.
The fermentation culture of the step 2) is to inoculate the recombinant bacteria into a fermentation culture medium and culture the recombinant bacteria at 37 ℃ and 180rpm until the concentration of the bacteria is OD6000.6-0.8, adding IPTG with the final concentration of 0.05mM, and culturing at 30 ℃ for 4-6h to obtain a culture solution.
Step 3) the treatment comprises the following steps: pretreating the culture solution obtained in the step 2), crushing thalli in the culture solution by using ultrasonic waves to obtain a crushed bacterial solution, centrifugally separating the crushed bacterial solution, retaining a supernatant, and purifying the supernatant by using a nickel column to obtain an enzyme solution.
The pretreatment is to centrifuge the culture solution at 4 ℃ and 10000rpm for 5min, remove the supernatant, wash the supernatant twice with 50mM phosphate buffer solution with pH7.4, and then resuspend the supernatant with 5mL of the phosphate buffer solution; the ultrasonic crushing is carried out by processing for 20min at 20KHz and 60W by using an ultrasonic crusher; the centrifugal separation is carried out for 15min at 4 ℃ and 13000 rpm; and (3) the nickel column purification is to pour the supernatant after cell disruption and centrifugation into a nickel column treated by a Bindingbuffer with the pH value of 7.5, add the solution into the Elution buffer after the liquid completely flows out, wash out the protein and collect the enzyme solution containing the protein.
Step 4) reacting, wherein the concentration of the acetylacetone lyase mutant Dke 1K 15Q protein in the reaction system is 0.01-1 mM, and the reaction substrate comprises MgCl2·6H2O, KCl dithiothreitol, Tris-HCl buffer, FeSO4·7H2O, methylglyoxal, ammonium acetate; the concentration of each substrate in the reaction system is as follows: MgCl2·6H2O10 mM, KCl 10mM, dithiothreitol 1mM, Tris-HCl buffer 20mM, FeSO4·7H2O0.5 mM, methylglyoxal 10mM, ammonium acetate 10 mM.
And 4) carrying out the reaction in a sealed condition, wherein the reaction temperature is 37 ℃, the reaction time is 1-12 h, and the reaction environment is a shaking table at 180 rpm.
Advantageous effects
The method provided by the invention can convert methylglyoxal and ammonium acetate into acetylacetone in vitro by using enzyme reaction, the yield reaches 388.9mg/L, and a new thought is provided for solving the problem of toxicity inhibition of acetylacetone on cells in a whole cell synthesis system.
Drawings
FIG. 1 GC-MS detection of the in vitro enzyme reaction product acetylacetone.
FIG. 2 shows SDS-PAGE of the purified enzyme solution.
Detailed Description
Definitions and abbreviations
The following abbreviations or acronyms are used in the present invention:
acetylacetonatolyase gene: dke1
Coli (Escherichia coli): coli
"overexpression" or "overexpression" refers to the expression of a particular gene in an organism in large amounts, in excess of normal levels (i.e., wild-type expression levels), which can be achieved by enhancing endogenous expression or introducing a foreign gene.
The invention is further elucidated below by way of examples. However, the present invention is not limited to the following examples.
The experimental procedures used in the following examples are conventional unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The formula of the culture medium is as follows:
LB liquid medium: 5g/L yeast powder, 10g/L NaCl, 10g/L peptone, pH7.
LB solid medium: 5g/L yeast powder, 10g/L NaCl, 10g/L peptone, 15g/L agar, pH7.
Shake flask fermentation medium: 20g/L glucose, 5g/L yeast powder, 10g/L NaCl, 10g/L peptone, pH7.
In the actual culture process, antibiotics at a certain concentration, such as 100. mu.g.mL-1 ampicillin, can be added to the above medium to maintain the stability of the plasmid.
Preparation example preparation of Gene sequence encoding mutant Acetylacetone lyase for improving the efficiency of Acetylacetone Synthesis Dke 1K 15Q
The acetylacetonatolyase gene sequence derived from Acinetobacter johnsonii was codon-optimized and synthesized by Kinzhi, Suzhou (SEQ ID NO. 4). The synthesized gene is used as a template, and a primer is designed by utilizing site-directed mutagenesis.
An upstream fragment (primers F: CGGGATCCGATGGACTACTGCAACA and R: TTGTTGTCAGAGATTTGAACGTATTCTT) and a downstream fragment (primers F: AAGAATACGTTCAAATCTCTGACAAAA and R: CGGAATTCTTAAGCAGCTTCGTTTTTGGTA) of the dke1 gene are respectively obtained by PCR amplification, and a target fragment is recovered by a recovery kit. Using the obtained upstream and downstream fragments as substrates, an acetylacetonatolyase mutant gene sequence Dke 1K 15Q with glutamine changed from lysine at the 15 th position was obtained by bridge PCR (primers F: CGGGATCCGATGGACTACTGCAACA and R: CGGAATTCTTAAGCAGCTTCGTTTTTGGTA), and the sequence was shown in SEQ ID NO. 2. PCR conditions were 95 ℃ for 3min, 35 cycles (95 ℃ for 30s, 53 ℃ for 30s, 72 ℃ for 1min), 7Keeping the temperature at 2 ℃ for 5min and 16 ℃. The PCR amplification system was 1. mu.L template with 1. mu.L upstream and downstream primers, 2 XPrime STAR max 25. mu.L, ddH2O 22μL。
Example 1
The obtained Dke 1K 15Q fragment and plasmid pETDuet-1 are cut by BamHI and EcoRI, and the cut product is recovered; and then carrying out connection: connecting the recovered vector and dke1 gene fragment at 16 ℃ for more than 6h according to the molar ratio of 1: 5; and recovering the ligation product to obtain an expression vector of the coding gene of the acetylacetone lyase mutant for improving the synthesis efficiency of acetylacetone, which is named as pETDuet-Dke 1K 15Q.
The obtained vector pETDuet-Dke 1K 15Q was introduced into E.coli BL21(DE3) competent cells, and the cells were plated with a medium containing 100. mu.g.mL-1Ampicillin LB solid plates; the coated plate was placed in a 37 ℃ incubator and cultured until single colonies grew. And (3) selecting a single clone, streaking the single clone on a solid LB plate, continuously culturing the single clone in a constant-temperature incubator at 37 ℃ until the single clone grows out again, and carrying out colony PCR verification (primers are F: GATGCGTCCGGCGTAGAGC and R: GCTAGTTATTGCTCAGCGG) by taking the single clone as a template to obtain the escherichia coli E.coliBL21(pETDuet-Dke 1K 15Q) containing the acetylacetone lyase mutant after the verification is correct.
Inoculating the positive clone into fermentation medium, culturing at 37 deg.C and 180rpm until the thallus concentration is OD6000.6-0.8, adding IPTG with the final concentration of 0.05mM, and culturing at 30 ℃ for 4-6h to obtain a culture solution.
The resulting culture was centrifuged at 10000rpm for 5min at 4 ℃ and then washed twice with 50mM phosphate buffer solution (pH7.4), and then resuspended in 5mL of phosphate buffer solution. Processing with ultrasonic crusher at 20KHz and 60W for 20 min; centrifuging at 4 deg.C and 13000rpm for 15min, and retaining supernatant; and purifying the obtained supernatant by using a nickel column to obtain pure enzyme solution. And the condition of nickel column purification is that supernatant fluid after cell disruption and centrifugation is poured into a nickel column treated by Binding buffer with pH7.5, after liquid completely flows out, the solution is added into the Elution buffer to wash out protein, and enzyme liquid containing the protein is obtained after collection.
Mixing the pure enzyme solution of the obtained acetylacetone lyase mutant with a reaction substrateIn combination, a pure enzyme solution was added to a final concentration of 0.1mM to form a reaction system containing the following components: MgCl2·6H2O10 mM, KCl 10mM, dithiothreitol 1mM, Tris-HCl buffer 20mM, FeSO4·7H2O0.5 mM, methylglyoxal 10mM, ammonium acetate 10 mM. The reaction system was sealed in a 1.5ml centrifuge tube and placed in a shaker at 37 ℃ and 180rpm for 12 h.
Detection of acetylacetone
A sample of 1. mu.L of the reaction solution obtained in example 1 was introduced by GC-MS to analyze the product and detect the acetylacetone product. The GC-MS gas chromatography column was HP-5MS 5% Phenyl Methyl Silox (30 m.times.0.25 mm, 0.25 μm), and the temperature was programmed from 50 ℃ for 5min, and at a rate of 15 ℃/min to 240 ℃ for 5 min. The acetylacetone yield was found to be 388.9 mg/L.
Comparative example 1:
according to the same strategy as the preparation example and the embodiment, the experiment is carried out by using the sequence gene shown in SEQ ID NO.4 to replace the mutated gene sequence Dke 1K 15Q of the acetylacetone lyase, the acetylacetone is produced by in vitro enzyme reaction by expressing the acetylacetone lyase (the amino acid sequence is shown in SEQ ID NO. 3), the yield of the obtained acetylacetone is 129.5mg/L, and the production is reduced by 66.7 percent compared with the production by using the mutant gene Dke 1K 15Q of the acetylacetone lyase.
Comparative example 2:
according to the same strategy of the preparation example, the 17 th amino acid of the acetylacetone lyase is mutated from serine to aspartic acid, and the upstream fragment amplification primer is F: CGGGATCCGATGGACTACTGCAACA and R: GAACGGAACGTAGTTGTTGTCATCGATTTTAACGTATTCTTC, the downstream fragment amplification primer is F: GAAGAATACGTTAAAATCGATGACAACAACTACGTTCCGTTC and R: CGGAATTCTTAAGCAGCTTCGTTTTTGGTA, the bypass PCR primers were F: CGGGATCCGATGGACTACTGCAACA and R: CGGAATTCTTAAGCAGCTTCGTTTTTGGTA are provided. The acetylacetonatolyase mutant gene Dke 1S 17D was prepared.
According to the same strategy as that of the preparation examples and examples, experiments were carried out by using the acetylacetonatolyase mutant gene Dke 1S 17D instead of the acetylacetonatolyase mutant gene sequence Dke 1K 15Q, and acetylacetone was produced by in vitro enzyme reaction by expressing the acetylacetonatolyase mutant Dke 1S 17D (the amino acid sequence is shown in SEQ ID NO. 5), so that the yield of acetylacetone was 67.8mg/L, which was 82.6% lower than that produced by using the acetylacetonatolyase mutant Dke 1K 15Q.
The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all modifications of equivalent structures and equivalent processes performed by the present specification and drawings, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.
SEQUENCE LISTING
<110> institute of bioenergy and Process in Qingdao, China academy of sciences
<120> method for producing acetylacetone by extracellular enzyme reaction
<130>
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 153
<212> PRO
<213> Acetylacetone lyase mutant
<220>
<221> PRO
<222> (1)..(153)
<400> 1
mdycnkkhta eeyvqisdnn yvpfpeafsd ggitwqllhs spetsswtai fncpagssfa 60
shihagpgey fltkgkmevr ggeqeggsta yapsygfess galhgktffp vesqfymtfl 120
gplnfiddng kviasigwae aqgawlatkn eaa 153
<210> 2
<211> 462
<212> DNA
<213> acetylacetonato lyase mutant coding gene
<220>
<221> DNA
<222> (1)..(462)
<400> 2
atggactact gcaacaaaaa acacaccgct gaagaatacg ttcaaatctc tgacaacaac 60
tacgttccgt tcccggaagc gttctctgac ggtggtatca cctggcagct gctgcactct 120
tctccggaaa cctcttcttg gaccgctatc ttcaactgcc cggctggttc ttctttcgct 180
tctcacatcc acgctggtcc gggtgaatac ttcctgacca aaggtaaaat ggaagttcgt 240
ggtggtgaac aggaaggtgg ttctaccgct tacgctccgt cttacggttt cgaatcttct 300
ggtgctctgc acggtaaaac cttcttcccg gttgaatctc agttctacat gaccttcctg 360
ggtccgctga acttcatcga cgacaacggt aaagttatcg cttctatcgg ttgggctgaa 420
gctcagggtg cttggctggc taccaaaaac gaagctgctt aa 462
<210> 3
<211> 153
<212> PRO
<213> Acetylacetone lyase
<220>
<221> PRO
<222> (1)..(153)
<400> 3
mdycnkkhta eeyvkisdnn yvpfpeafsd ggitwqllhs spetsswtai fncpagssfa 60
shihagpgey fltkgkmevr ggeqeggsta yapsygfess galhgktffp vesqfymtfl 120
gplnfiddng kviasigwae aqgawlatkn eaa 153
<210> 4
<211> 462
<212> DNA
<213> Gene encoding acetylacetone lyase
<220>
<221> DNA
<222> (1)..(462)
<400> 4
atggactact gcaacaaaaa acacaccgct gaagaatacg ttaaaatctc tgacaacaac 60
tacgttccgt tcccggaagc gttctctgac ggtggtatca cctggcagct gctgcactct 120
tctccggaaa cctcttcttg gaccgctatc ttcaactgcc cggctggttc ttctttcgct 180
tctcacatcc acgctggtcc gggtgaatac ttcctgacca aaggtaaaat ggaagttcgt 240
ggtggtgaac aggaaggtgg ttctaccgct tacgctccgt cttacggttt cgaatcttct 300
ggtgctctgc acggtaaaac cttcttcccg gttgaatctc agttctacat gaccttcctg 360
ggtccgctga acttcatcga cgacaacggt aaagttatcg cttctatcgg ttgggctgaa 420
gctcagggtg cttggctggc taccaaaaac gaagctgctt aa 462
<210> 5
<211> 153
<212> PRO
<213> Acetylacetone lyase mutant
<220>
<221> PRO
<222> (1)..(153)
<400> 5
MDYCNKKHTA EEYVKIDDNN YVPFPEAFSD GGITWQLLHS SPETSSWTAI FNCPAGSSFA 60
SHIHAGPGEY FLTKGKMEVR GGEQEGGSTA YAPSYGFESS GALHGKTFFP VESQFYMTFL 120
GPLNFIDDNG KVIASIGWAE AQGAWLATKN EAA 153
Claims (9)
1. A method for producing acetylacetone by an extracellular enzyme reaction, which is characterized in that: the method comprises the following steps:
1) the acetylacetone lyase mutant gene Dke1K15QConnecting to an expression vector to obtain a recombinant vector; the acetylacetone lyase mutant gene Dke1K15QThe sequence of (A) is shown as SEQ ID NO. 2;
2) transforming the recombinant vector obtained in the step 1) into host bacteria to obtain recombinant bacteria, and fermenting and culturing the recombinant bacteria to obtain a culture solution;
3) treating the culture solution obtained in the step 2) to obtain an acetylacetone lyase mutant Dke1K15QA protease solution;
4) mixing the enzyme solution obtained in the step 3) with a reaction substrate and then reacting to prepare acetylacetone(ii) a The reaction substrate comprises MgCl2·6H2O10 mM, KCl 10mM, dithiothreitol 1mM, Tris-HCl buffer 20mM, FeSO4·7H2O0.5 mM, methylglyoxal 10mM, ammonium acetate 10 mM.
2. The method for producing acetylacetone by an extracellular enzyme reaction according to claim 1, wherein: the acetylacetone lyase mutant gene Dke1K15QThe amino acid sequence of the expressed acetylacetone lyase mutant is shown as SEQ ID NO. 1.
3. The method for producing acetylacetone by an extracellular enzyme reaction according to claim 1, wherein: the expression vector in the step 1) is pETDuet-1.
4. The method for producing acetylacetone by an extracellular enzyme reaction according to claim 1, wherein: the host bacterium in the step 2) is escherichia coli.
5. The method for producing acetylacetone by an extracellular enzyme reaction according to claim 1, wherein: the fermentation culture of the step 2) is to inoculate the recombinant bacteria into a fermentation culture medium and culture the recombinant bacteria at 37 ℃ and 180rpm until the concentration of the bacteria is OD6000.6-0.8, adding IPTG with the final concentration of 0.05mM, and culturing at 30 ℃ for 4-6h to obtain a culture solution.
6. The method for producing acetylacetone by an extracellular enzyme reaction according to claim 1, wherein: step 3) the treatment comprises the following steps: pretreating the culture solution obtained in the step 2), crushing thalli in the culture solution by using ultrasonic waves to obtain a crushed bacterial solution, centrifugally separating the crushed bacterial solution, retaining a supernatant, purifying the supernatant by using a nickel column to obtain the acetylacetone lyase mutant Dke1K15QAnd (3) protease liquid.
7. The method for producing acetylacetone by an extracellular enzyme reaction according to claim 6, wherein: the pretreatment is to centrifuge the culture solution at 4 ℃ and 10000rpm for 5min, remove the supernatant, wash the supernatant twice with 50mM phosphate buffer solution with pH7.4, and then resuspend the supernatant with 5mL of the phosphate buffer solution; the ultrasonic crushing is carried out by processing for 20min at 20KHz and 60W by using an ultrasonic crusher; the centrifugation is carried out for 15min at 13000rpm and 4 ℃.
8. The method for producing acetylacetone by an extracellular enzyme reaction according to claim 1, wherein: step 4) reacting, namely, acetylacetone lyase mutant Dke1 in a reaction systemK15QThe protein concentration is 0.01-1 mM.
9. The method for producing acetylacetone by an extracellular enzyme reaction according to claim 1, wherein: and 4) carrying out the reaction in a sealed condition, wherein the reaction temperature is 37 ℃, the reaction time is 1-12 h, and the reaction environment is a shaking table at 180 rpm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910464183.5A CN112011578B (en) | 2019-05-30 | 2019-05-30 | Method for producing acetylacetone by extracellular enzyme reaction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910464183.5A CN112011578B (en) | 2019-05-30 | 2019-05-30 | Method for producing acetylacetone by extracellular enzyme reaction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112011578A CN112011578A (en) | 2020-12-01 |
| CN112011578B true CN112011578B (en) | 2021-12-21 |
Family
ID=73500515
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910464183.5A Active CN112011578B (en) | 2019-05-30 | 2019-05-30 | Method for producing acetylacetone by extracellular enzyme reaction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112011578B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112011523B (en) * | 2019-05-30 | 2022-03-01 | 中国科学院青岛生物能源与过程研究所 | Acetylacetone lyase mutant capable of improving acetylacetone synthesis efficiency, gene, expression vector, cell and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110791467A (en) * | 2018-08-01 | 2020-02-14 | 中国科学院青岛生物能源与过程研究所 | Recombinant bacterium for producing acetylacetone and construction method and application thereof |
-
2019
- 2019-05-30 CN CN201910464183.5A patent/CN112011578B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110791467A (en) * | 2018-08-01 | 2020-02-14 | 中国科学院青岛生物能源与过程研究所 | Recombinant bacterium for producing acetylacetone and construction method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Acetylacetone-cleaving enzyme Dke1: a novel C-C-bond-cleaving enzyme from Acinetobacter johnsonii;Straganz, GD等;《BIOCHEMICAL JOURNAL》;20030201;第369卷;第573-581页 * |
| UniProtKB/Swiss-Prot: Q8GNT2.1;National Center for Biotechnology Information;《NCBI Genbank database》;20141001;第1-2页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112011578A (en) | 2020-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021184809A1 (en) | Preparation and application of l-amino acid deaminase mutant | |
| CN108795916B (en) | Lysine decarboxylase mutant, coding gene thereof, expression and application thereof | |
| CN109022338B (en) | Process for producing phenylpyruvic acid by enzymatic conversion of phenylalanine | |
| CN114874964B (en) | Construction method and application of recombinant escherichia coli for high yield of 2' -fucosyllactose | |
| CN112877386A (en) | Method for synthesizing nicotinamide mononucleotide based on enzyme method | |
| CN109777788B (en) | Leucine dehydrogenase mutant and application thereof | |
| JP6489013B2 (en) | Improved nitrile hydratase | |
| CN114107152B (en) | Construction method and application of high-yield 3-fucosyllactose microorganism | |
| CN109321541B (en) | Mutant of L-amino acid oxidase | |
| CN112011578B (en) | Method for producing acetylacetone by extracellular enzyme reaction | |
| CN109097378B (en) | Isoprene synthase, encoding gene, expression vector, engineering bacterium thereof, method for producing isoprene and application | |
| CN112251428B (en) | Glutamic acid decarboxylase mutant and application thereof in production of gamma-aminobutyric acid | |
| CN111454918B (en) | Enol reductase mutant and application thereof in preparation of (R) -citronellal | |
| CN113122526A (en) | Nitrile hydratase lysine mutant HBA-K1, coding gene and application | |
| CN109295023B (en) | Glutamate oxidase mutant, nucleic acid molecule, application and method for preparing ketoglutaric acid | |
| CN108004225B (en) | Mutant of phenylalanine aminomutase from Pantoea agglomerans | |
| CN112375725B (en) | Metabolic engineering strain for producing vitamin B6 and construction method and application thereof | |
| CN110791467B (en) | Recombinant bacterium for producing acetylacetone and construction method and application thereof | |
| CN110804602B (en) | L-aspartic acid beta-decarboxylase mutant and application thereof | |
| CN112011523B (en) | Acetylacetone lyase mutant capable of improving acetylacetone synthesis efficiency, gene, expression vector, cell and application thereof | |
| CN113684163A (en) | Genetically engineered bacterium for improving yield of lactoyl-N-tetrasaccharide and production method thereof | |
| CN113151234A (en) | Nitrile hydratase lysine mutant HBA-K2H2R, coding gene and application | |
| CN113151233A (en) | Nitrile hydratase lysine mutant HBA-K2H2, coding gene and application | |
| CN116970579A (en) | Acetylacetone lyase mutant and method for producing 3-methyl-2, 4-pentanedione through extracellular enzyme reaction | |
| CN113444700B (en) | Acetylacetone lyase mutant capable of improving acetylacetone synthesis efficiency, nucleotide, expression vector, recombinant bacterium and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |