KR102281525B1 - Transformed methanotrophs for producing cadaverine and uses thereof - Google Patents

Abstract

The present invention relates to a transgenic methanogen having high cadaverine performance and a method for producing cadaverine using the same. The transgenic methanogenic bacteria of the present invention can produce cadaverine from methane, so it is environmentally friendly and economically cadaverine. It can be usefully used for mass production of berine.

Description

Transformed methanotrophs for producing cadaverine and uses thereof

The present invention relates to a transformed methanogen having high cadaverine performance and a method for producing cadaverine using the same.

Methane is a carbon feedstock that bioconverts biomass into an important chemical, despite being 24 times more potent than a greenhouse gas compared to carbon dioxide, and is evaluated as a potential carbon source to replace petroleum-based carbon sources. This could make methane a very inexpensive and renewable source for chemical synthesis and a next-generation feedstock for future industrial biotechnology. Efforts have been made over the past few decades to address the amount of methane accumulating in the atmosphere due to anthropogenic activity and to utilize methane as a major source of cheap and renewable products.

Recent developments in genetically engineered technologies have expanded the potential of metamagnets as industrial biocatalysts using methane as the sole feedstock. As a platform for the biosynthesis of various natural and non-natural compounds such as aerobic, carotenoid, 2,3-butanediol, succinic acid and putrescine, metamagnets can be used as a platform, as well as major methane utilization pathways are being identified.

However, various efforts have been made over the past few decades to bioconvert high value-added products using inexpensive methane resources. It showed a limit in developing the fungus into an industrial strain.

Korean Patent Registration (001) KR10-1940647 Korean Patent Registration (002) KR10-1231897

An object of the present invention is pyruvate carboxylase (pyruvate carboxylase), diaminopimelate decarboxylase, lysine carboxylase (lysine decarboxylase) and cadaverine-lysine antiporter protein (cadaverine-lysine antiporter protein) It is to provide a transformed methanogen producing this activated cadaverine.

Another object of the present invention is to provide a method for high production of cadaverine from a methane substrate using the transformed methanogen.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed herein fall within the scope of the present invention. In addition, it cannot be considered that the scope of the present invention is limited by the specific descriptions described below.

One aspect of the present invention for achieving the above object is pyruvate carboxylase (pyruvate carboxylase), diaminopimelic acid carboxylase (diaminopimelate decarboxylase), lysine carboxylase (lysine decarboxylase) and cadaverine-lysine inverse receptor Provided is a transgenic methanogen producing cadaverine-lysine antiporter protein-activated cadaverine.

In addition, the inventors made intensive research efforts on a method that utilizes biomass such as methane as a method for high production of cadaverine, and surprisingly, it was confirmed that high production of cadaverine is possible when the transformed methanogen of the present invention is used. did. Type II methanotrophs, Methylosinus trichosporium OB3b, by introducing the cadaverine biosynthetic pathway to high production of cadaverine from methane, was not known at all until now, and it can be said that it is very significant in that it was developed for the first time through the present invention.

In the present invention, the term "cadaverine" is a _{diamine organic compound consisting of five carbons having a molecular formula of NH 2} (CH ₂ ) ₅ NH ₂ , known as 5-diaminopentane, and in many industrial applications It is an important base chemical. Cadarberine can be used as a component of polymers such as polyamides or polyurethanes, as chelating agents or as other additives.

In the present invention, the term “metahnotroph” refers to bacteria using methane as a major carbon source or energy source. The methanogen may mean a host strain to be transformed in the present invention, and for the purpose of the present invention, methane is used as a carbon source, oxaloacetic acid (OAA) is used as a starting material, and finally through L-lysine. As long as it can produce cadaverine, it is not particularly limited thereto. In addition, it is apparent to those skilled in the art that a strain capable of using methane together among methylotrophs using C1 compounds such as methane, methanol, and methylamine as an energy source may also be included in the methanating bacteria of the present invention.

The methanogenic bacteria is not particularly limited thereto, as long as it can use a C1 compound such as methane as an energy source, but Methylomonas, Methylobacter, Methylococcus, methylose Methylosphaera, Methylocaldum, Methyloglobus, Methylosarcina, Methyloprofundus, Methylothermus ), genus Methylohalobius, genus Methylogaea, genus Methylomarinum, genus Methylovulum, genus Methylomarinovum, genus Methyloloverum Methylorubrum, Methyloparacoccus, Methylocystis, Methylocella, Methylocapsa, Methylofurula, Methylacid It may be a phyllum genus (Methylacidiphilum), a methylacidimicrobium genus (Methylacidimicrobium), a methylomicrobium genus (Methylomicrobium) or a methylosinus genus (Methylosinus) strain, specifically methylosinus trichosporium OB3b can be

In the case of the bioconversion process using such methane magnetizing bacteria, relatively inexpensive methane can be used as a carbon source, which is economically advantageous, and in that methane in the atmosphere can be used, there are environmental advantages such as prevention of greenhouse gas emission. In addition, there is no loss of oxygen compared to the conventional process using glucose, so the yield of the final product is also high.

In the present invention, the term "transformed methanogenic bacteria" refers to a strain transformed by introducing or removing the gene of the methanogenic bacteria.

As used herein, the term "pyruvate carboxylase" is an enzyme that converts pyruvate into oxalic acid (OAA).

The gene encoding the pyruvate carboxylase ( Pyc ) is Methylomonas sp. It may be derived from DH-1, and specifically may be composed of the nucleotide sequence of SEQ ID NO: 1. More specifically, 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, most specifically 99% or more homology with the sequence of SEQ ID NO: 1 If a protein having substantially pyruvate carboxylase activity can be expressed as a base sequence, it may be included without limitation.

The term "diaminopimelate decarboxylase" as used herein is an enzyme that converts meso-diaminopimelate to lysine.

The gene encoding the diaminopimelate decarboxylase ( lysA ) may be M. trichosporium OB3b consisting of the nucleotide sequence of SEQ ID NO: 2. More specifically, 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, most specifically 99% or more homology with the sequence of SEQ ID NO: 2 If it is possible to express a protein having substantially diaminopimelate decarboxylase activity as a base sequence, it may be included without limitation.

The term "lysine decarboxylase" as used herein is an enzyme that converts lysine to cadaverine.

The gene encoding the lysine decarboxylase ( ldcC ) may be composed of the nucleotide sequence of SEQ ID NO: 3. More specifically, 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, most specifically 99% or more homology with the sequence of SEQ ID NO: 3 If a protein having substantially lysine decarboxylase activity can be expressed as a base sequence, it may be included without limitation.

The cadB gene encoding the term "cadaverine-lysine antiporter protein" of the present invention not only exports cadaverine out of the cell, but also introduces a substrate lysine into the cell. The cadaverine-lysine antireceptor protein (cadaverine-lysine antiporter protein) coding gene (cadB ) may be composed of the nucleotide sequence of SEQ ID NO: 4.

Each of the above-described enzymes or proteins is an amino acid in which one or more amino acids at one or more positions in the amino acid sequence constituting each enzyme or protein are substituted, deleted, inserted, added or inverted, as long as they exhibit the respective activity used in the present invention. It may include a sequence, as long as it shows the activity of each enzyme or protein, with respect to the amino acid sequence of each enzyme or protein, 80% or more, specifically 90% or more, more specifically 95% or more, more specifically It is apparent to those skilled in the art that an amino acid sequence having substantially the same or corresponding activity as each enzyme or protein is included in the scope of the present invention as having a homology of 99% or more.

The method of deleting part or all of the polynucleotide encoding the protein is performed by replacing a polynucleotide encoding an endogenous target protein in a chromosome with a polynucleotide or a marker gene having a partial nucleic acid sequence deleted through a vector for chromosome insertion in bacteria. can be In the present invention, the term "enhancement" means that the activity of an enzyme or protein is increased compared to the wild type or its intrinsic activity. Enhancing the activity of the enzyme or protein may be performed by any method known in the art.

Another aspect of the present invention for achieving the above object is to provide a method for producing cadaverine, comprising the step of culturing the transformed methanogenic bacteria for the production of cadaverine.

In the present invention, the term "culture" refers to growth in environmental conditions artificially regulated, such as a target cell or tissue. The environmental conditions typically include nutrients, temperature, osmotic pressure, pH, gas composition, light, etc., but it is the medium that has a direct influence, and the medium can be largely divided into a liquid medium and a solid medium. Culturing of the transformant methanogenic bacteria of the present invention can be performed using a method well known in the art.

Specifically, the culture is not particularly limited as long as it can produce cadaverine from the transformed methanogen, but continuously cultured in fed batch or fed batch or repeated fed batch process. can do. As the medium used for culture, NMS (nitrate mineral salts) medium known to be used for culturing of methanogenic bacteria can be used, and a medium in which the components contained in the medium or its content are appropriately adjusted according to the methanogenic bacteria can be used. However, it is not particularly limited thereto. In the present invention, the culture temperature of the transformant methanogenic bacteria may be 15 ℃ to 45 ℃, specifically 20 ℃ to 40 ℃, more specifically 25 ℃ to 35 ℃, for smooth contact between the methane and the strain, 150rpm to 300rpm , Specifically, 180 rpm to 270 rpm, more specifically 200 rpm to 250 rpm may be stirred, but is not limited thereto.

In the present invention, the method for producing cadaverine may be culturing the transformed methanogen in a culture medium containing methane.

In the present invention, the manufacturing method may further comprise the step of recovering cadaverine from the culture medium. The step of recovering the cadaverine may be performed by a suitable method known in the art according to the culture method. Specifically, the known cadaverine recovery method is not particularly limited thereto, but centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (eg, ammonium sulfate precipitation), chromatography ( For example, methods such as HPLC, ion exchange, affinity, hydrophobicity and size exclusion) may be used.

The transformant methanogenic bacteria of the present invention can produce cadaverine from methane, and can be effectively used for mass production of cadaverine in an environmentally friendly and economical manner.

1 is a schematic diagram showing the metabolic pathway of methanogenic bacteria for cadaverine production:
Pyc (pyruvate carboxylase); ppc (Phosphoenolpyruvate carboxylase); lysC (aspartokinase); lysA (diaminopimelate decarboxylase), cadA or ldcC (lysine decarboxylase); cadB (a cadaverine-lysine antiporter protein).
Figure 2 is a graph showing the production of cadaverine in M. trichosporium OB3b transformants added with PLP as a cofactor to NMS medium supplemented with 20% methane (v/v).
3 is a graph showing the comparison of growth (A) and cadaverine production (B) of M. trichosporium OB3b transformants in NMS medium supplemented with 20% methane (v/v).
4 is a graph comparing the growth (A) and cadaverine production (B) of M. trichosporium OB3b transformants in NMS medium supplemented with 20% methane (v/v).
5 is a graph showing the amount of cadaverine produced per hour by culturing a recombinant OB3b/cad4 strain in a fed-batch culture medium.

Hereinafter, the present invention will be described in detail.

The present inventors developed a metabolically engineered strain of Methylosinus trichosporium OB3b, a type II methanotrophs that produced cadaverine in methane.

First, L-lysine decarboxylase, which converts L-lysine to cadaverine, was introduced into M. trichosporium OB3b by plasmid-based expression of two genes cadA or ldcC from E. coli under the tac promoter. As a result of comparing the enzymatic activity of the two genes, ldcC had better cadaverine conversion ability than cadA. Next, in order to increase the L-lysine biosynthesis pool, recombinant strains OB3b/cad1 and OB3b/cad2 were obtained by overexpressing aspartokinase II or meso-diaminopimelate decarboxylase (lysA), and using them, 16.8 mg/L and 30 mg/L, respectively L of cadaverine was produced. In addition, Methyomonas sp. DH-1. Derived pyruvate carboxylase (pyc) was additionally introduced into the OB3b/cad2 strain to obtain a recombinant OB3b/cad3 strain, which produced 13-fold higher titer of cadaverine (corresponding to 41.94 mg/L) than the initial strain. To improve cadaverine productivity, the cadaverine-lysine antiporter CadB from E. coli was introduced into the OB3b/cad3 strain. The final transformed strain OB3b/cad4 was able to produce 192.09 m/L of cadaverine with a productivity of 0.153 mmol/g DCW/day by fed-batch. This result confirmed the production of cadaverine from methane as the only carbon source using the transformed methanogen, thus completing the present invention.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

<Example 1> Experimental materials and methods

<1-1> Reagents and oligonucleotides

Lamp Pfu polymerase and restriction enzyme were purchased from BioFACT (Korea). Primers designed using Snap gene and synthesized by Macrogen (Seoul, Korea) are shown in Table 1 below. The synthetic ribosome binding site (RBS) of some genes was designed based on the ribosome binding site calculator. Genomic DNA was extracted using the Kit of Wizard® Genomic DNA Purification Kit (Promega, USA). PCR purification kit and plasmid extraction kit were purchased from GeneAll Biotechnology (Korea). All plasmids purchased from NE (England) were constructed using Gibson assembly.

primer SEQ ID NO: order pAWP89-Tac-For 5 TAGTTGTCGGGAAGATGCGT For amplifying a pAWP89 backbone containing Ptac promoter pAWP89-Tac-Rev 6 AGCTGTTTCCTGTGTGAATA ldcC-For 7 tattcacacaggaaacagctATGAACATCATTGCCATTATGGGAC For amplifying a ldcC and cadA genes from genomic DNA of E. coli MG1655, the PCR product was ligated into a pAWP89 backbone to construct pAWP89-ldcC or pAWP89- cadA vector ldcC-Rev 8 gcatcttcccgacaactaTTATCCCGCCATTTTTTAGGACTC cadA-K12-For 9 tattcacacaggaaacagctATGAACGTTATTGCAATATT cadA-K12-Rev 10 gcatcttcccgacaactaTTATTTTTTGCTTTTCTT lysA-For 11 gggaacaaaagctgggtacATGCATCATTTCGACTATCG For amplifying a lysA and lysC genes from genomic DNA of M. trichosporium OB3b, the PCR product was ligated into the Kpn I site of digested pAWP89-ptac-lacZ LysA-Rev 12 cgaggggggggcccggtacTCACAGCCAATCGGGAACGC lysC-For 13 gggaacaaaagctgggtacATGGCTCGTCTGGTGATGAA LysC-Rev 14 cgaggggggggcccggtacTCAGGCCGCGGCGCAGCCCAT Pyc-For 15 ggtatcgataagcttgatatcg TCACGGCGCAGCTGCGCCCTACCGCTGTTAAAGGAGACATTTT ATGTTACGCAAAATCCTGAT For amplifying a pyc gene from genomic DNA of Methylomonas sp. DH-1, the PCR product was ligated into the EcoR I site of digested pAWP89-lysA Pyc-Rev 16 gatccccccgggctgcaggTCAATTTATTTCCACCAACA P _tac -ldc-BamHI-For 17 ttgacctgccagcccggggTTGACAATTAATCATCGGCT For amplifying a ptac-ldc gene from pAWP89-ldcC, the PCR product was ligated into the BamH I site of digested pAWP89-lysA, pAWP89-lysC, pAWP89-lysA-pyc P _tac -ldc-BamHI-Rev 18 gccgctctagaactagtgTTATCCCGCCATTTTTAGGA cadB-XbaI-For 19 ggcgggataacactagtt TTAACCAACAGTTTTTCTACCTAAAGGAGGCGTTTT ATGAGTTCTGCCAAGAAGAT For amplifying a cadB gene from genomic DNA of E. coli MG1655, the PCR product was ligated into the Xba I site of digested pAWP89-lysA-pyc-ldc

<1-2> Composition of strains and plasmids

Reverse PCR was used to linearize the vector pAWP89 using the primers pAWP89-Tac-For/pAWP89-Tac-Rev (Table 1). Lysine decarboxylase genes ldcC and cadA were amplified from genomic DNA and constructed into pAWP89 vector by Gibson assembly (Table 2). Both forms of the lysine decarboxylase ldcC and cadA were expressed in M. trichosporium OB3b under the tac promoter.

name Characteristic literature plasmid pAWP89 Puri et al., 2015 pAWP89-lacZ pAWP89 without dTomato, carrying lacZ reason from pBBR1MCS-2 Nguyen et al., 2019 pAWP89-ldcC pAWP89-lacZ containing ldcC gene from E. coli driven by P _tac promoter this study pAWP89-cadA pAWP89-lacZ containing cadA gene from E.coli driven by P _tac promoter this study pAWP89-lysC pAWP89-lacZ containing lysC gene from M. trichosporium OB3b driven by P _tac promoter this study pAWP89-lysA pAWP89-lacZ containing lysA gene from M. trichosporium OB3b driven by P _tac promoter this study pAWP89-lysA-pyc pAWP89-lacZ containing lysA gene from M. trichosporium OB3b and pyc gene from Methylomonas sp. DH-1 driven by P _tac promoter this study pAWP89-lysC-ldc pAWP89-lacZ containing lysC gene from M. trichosporium OB3b, ldcC gene from E.coli driven by P _tac promoter this study pAWP89-lysA-ldc pAWP89-lacZ containing lysA gene from M. trichosporium OB3b, ldcC gene from E.coli driven by P _tac promoter this study pAWP89-lysA-pyc-ldc pAWP89-lacZ containing lysA gene from M. trichosporium OB3b and pyc gene from Methylomonas sp. DH-1, ldcC gene from E. coli driven by P _tac promoter this study pAWP89-lysA-pyc-ldc-cadB pAWP89-lacZ containing lysA gene from M. trichosporium OB3b and pyc gene from Methylomonas sp. DH-1, ldcC gene from E.coli driven by P _tac promoter, cadB gene from E.coli driven by P _tac promoter this study strain S17-1 Escherichia coli
MG1655 Cloning host Invitrogen Methanotrophs Methylosinus trichosporium OB3b wild type strain Stein et al., 2010 Methylomonas sp. DH-1 A novel type I, isolated from brewery waste sludge Hur et al., 2017 OB3b/Ldc M. trichosporium OB3b harboring pAWP89-ldcC this study OB3b/Cad M. trichosporium OB3b harboring pAWP89-cadA this study Ob3b/cad1 M. trichosporium OB3b harboring pAWP89-lysC-ldc this study Ob3b/cad2 M. trichosporium OB3b harboring pAWP89-lysA-ldc this study Ob3b/cad3 M. trichosporium OB3b harboring pAWP89-lysA-pyc-ldc this study Ob3b/cad4 M. trichosporium OB3b harboring pAWP89-lysA-pyc-ldc-cadB this study

<1-3> Conjugation of Methylosinus trichosporium OB3b

In order to transform the recombinant expression vector obtained in Examples 1-3 into M. trichosporium OB3b, a wild-type methanogen, conjugation was performed. M. trichosporium OB3b grown at OD600 to about 0.2 was used. 50 ml of M. trichosporium OB3b and 10 ml of donor E. coli S17-1 containing the plasmid to be introduced were washed with NMS. Thereafter, the mixed cells were applied to a 0.2 μm sterile nitrocellulose filter. The filter was placed on NMS agar medium containing 0.02% (w/v) proteose-peptone, and incubated at 30° C. for 24 hours in the presence of methane (50% in air). Cells from NMS agar plates containing 0.02% (w/v) proteose-peptone were resuspended in 10 mL NMS medium, and concentrated by centrifugation at 7,000 g for 5 minutes. Cell pellets were plated on NMS agar containing kanamycin and incubated with methane/air (1:1, v/v) for 2-3 weeks until single colonies appeared.

<1-4> Medium and culture conditions

M. trichosporium OB3b was cultured in NMS (nitrate mineral salt) medium containing _{5 μM CuSO 4} as described in a previous study (Hwang et al., 2015). M. trichosporium OB3b cells were cultured in a 500 ml baffled flask containing 50 ml of NMS medium and sealed with a screw cap at 30° C. and 230 rpm with agitation. A final concentration of 30% (v/v) methane was supplied by gas exchange using a gas-tight syringe, and after daily ventilation of the headspace, 30% (v/v) methane was supplied. The optical density of the cell culture was measured on a spectrophotometer. Kanamycin (Km) with a final concentration of 50 μg/ml was used for selection of both M. trichosporium OB3b and E. coli containing recombinant plasmids.

<1-5> Enzyme analysis

To confirm the activity of lysine decarboxylase enzyme in M. trichosporium OB3b transformants, stationary phase cells were collected. Enzyme activity was measured using the crude extract extracted from the recombinant strain and treated with sonication. The protein concentration was determined by the Bradford method. Lysine decarboxylase (cadA and ldcC) activity was determined using HPLC analysis of the conversion of lysine to cadaverine. Reaction with 1 mM L-lysine, 0.1 mM pyridoxal-5-phosphate (PLP) as a cofactor in 500 mM sodium acetate buffer (pH 6.0), and 20 μL of cell-free extract were mixed in a Thermomixer at 37° C. for 30 minutes. The reaction was terminated by heating at 100° C. for 5 minutes. One unit of lysine decarboxylase activity was determined as the amount of enzyme required to convert 1 μmol of cadaverine per minute at 37°C. 50 μL of the reaction was then used for derivatization to determine both lysine and cadaverine concentrations. A negative control was used to remove the crude extract or L-lysine.

<1-6> Bioreactor Cultivation

Fermentation in the bioreactor was performed in a 5 L glass bioreactor containing 3 L of NMS medium. A gas mixture of methane and air in a ratio of 3:7 was continuously supplied at a rate of 0.2 vvm. Gas composition and flow rates were controlled by a mass flow controller (Brooks, Pennsylvania, USA). Fermentation was carried out at 30 °C and the speed of It was 200 rpm. The pH value was controlled below 7.0 by supplying 2N HCl solution to prevent the pH increase during cell growth. Liquid samples were collected at indicated times during incubation. The optical density of the cell culture (OD600) was measured with a UV-visible light spectrophotometer. The outlet gas composition was analyzed by GC equipped with a Carboxen 1000 (Carboxen 1000, Supelco, Bellefonte, PA) column.

<1-7> Analysis method

In order to analyze the amount of lysine and cadaverine in the culture medium, the supernatant was collected for each culture time. Diamine derivatives of lysine and cadaverine were obtained in 500 μL reaction mixture containing 300 μL of 50 mM sodium borate buffer (pH 9), 100 μL of methanol, 47 μL of distilled water, 3 μL of 200 mM diethylethoxymethylenemalonate (DEEMM), and 50 μL of the supernatant. DEEMM was used to derivatize lysine or cadaverine, and the derivatization reaction was performed at 70° C. for 2 hours (Alaiz et al., 1992). After filtration using a 0.2 μm filter, the reaction solution was measured with a UV detector (284 nm) in HPLC (Jasco Co., Japan) equipped with a _{reverse-phase Symmetry C 18 column (4.6×250 mm HPLC Column).} The temperature of the column was maintained at 35° C., the mobile phases were acetonitrile (A) and 25 mM sodium acetate buffer (pH 4.8) (B), and the flow rate was 1.0 mL/min. Mobile acids were used in the Gradient Method as follows: 0-2 min, 20-25% A; 2-32 min, 25-60% A; 32-37 min, 60-20%; 37-40 min, 20-20% (Kim et al., 2015).

<Example 2> Experimental results

<2-1> Construction of cadaverine production pathway by expression of lysine decarboxylase in M. trichosporium OB3b

M. trichosporium OB3b was used as a model strain for making a cadaverine-producing platform strain from methane. Since cadaverine production, utilization and degradation pathways are most likely to affect cadaverine titer, we first investigated the presence of the relevant genes in the genome of M. trichosporium OB3b. In general, cadaverine can produce biological-based substances by decarboxylation of lysine using lysine decarboxylase in microorganisms. A gene presumed to be lysine decarboxylase in the genome was not identified. Unlike E. coli or Corynebacterium, M. trichosporium OB3b contains putrescine/cadaverine aminopropyltransferase (speE), spermidine acetyltransferase (speG), glutamate-putrescine/glutamate-cadaverine ligase (puuA) and putrescine/cadaverine aminotransferase ( Among the major enzymes related to the same cadaverine utilization pathway, only putrescine/cadaverine aminopropyltransferase (speE) was confirmed. Since there is no lysine decarboxylase gene in M. trichosporium OB3bb, the lysine decarboxylase genes ldcC or cadA of E. coli MG1655 were cloned into expression plasmids under the tac promoter, respectively. An in vitro enzymatic assay was performed to evaluate the enzymatic activity of two lysine decarboxylases expressed in M. trichosporium OB3b. The enzymatic activity of these expressed genes was measured from crude extracts of recombinant strains.

As a result, the activity of lysine decarboxylase did not appear in the wild-type (WT) strain and was observed only in the recombinant strain. The specific activity of ldcC (5.815 ± 0.028 U/mg/min) was 1.35 times higher than that of cadA (4.299 ± 0.018 U/mg/min) (Table 3). It was confirmed that ldcC had superior cadaverine conversion ability compared to cadA in M. trichosporium.

In addition, recombinant strains, OB3b/LdcC and OB3b/CadA, were cultured to produce cadaverine using methane as a carbon source in flasks. After 6 days of fermentation using OB3b/LdcC, 3.253±0.042 mg/L cadaverine was obtained, which was 1.95 times higher than that obtained using OB3b/CadA (1.66±0.034 mg/L) ( FIG. 3B ).

Since it is known that lysine decarboxylase activity depends on pyridoxal-5-phosphate (PLP) as a cofactor, pydoxal-5-phosphate hydrate was added to NMS medium and then cadaverine titers were compared.

As a result, the addition of PLP did not affect the production of cadaverine ( FIG. 2 ), and the amount of PLP produced through the metabolism of M. trichosporium OB3b was sufficient for the production of cadaverine. As a result, the recombinant OB3b/LdcC strain carrying the ldcC gene from E. coli was identified as a suitable strain for producing cadaverine from methane using PLP-free NMS medium. However, since the L-lysine pool is low, the production is low, and the gene was further transformed to increase the availability of L-lysine.

<2-2> Redesign of lysine synthesis pathway to increase precursor supply

It was attempted to improve the production of cadaverine by increasing the metabolic flux of L-lysine, a direct precursor of cadaverine. It is known that L-lysine biosynthesis in E. coli, Corynebacterium and Bacillus methanolicus is regulated by lysine through various steps (by the encoded lyC, asd, dapB, dapD and lysA genes) through transcriptional repression and feedback repression. As in E. coli, L-lysine biosynthesis of M. trichosporium OB3b requires nine consecutive enzymatic reactions of L-aspartate, so the transcriptional regulation and feedback inhibition of lysine biosynthetic pathways by amino acids in lysine biosynthesis of methanobacteria have not yet been reported. there is no bar Aspartokinase III (lysC) or diaminopimelate decarboxylase (lysA) was constructed by constructing a plasmid pAWP89-lysC or pAWP89-lysA for expression under the tac promoter (Table 2), and transforming the two plasmids into wild-type M. trichosporium OB3b, resulting in a recombinant strain OB3b/lysC and OB3b/lysA were obtained. Recombinant strains (OB3b/lysC and OB3b/lysA) were tested for L-lysine production in shake flasks, and under the same conditions the wild-type strain produced 5.4±0.018 mg/L L-lysine, while OB3b/lysC (7.33± 0.012 mg/L) and OB3b/lysA (14.87±0.021 mg/L) produced 1.35-fold and 2.75-fold increase in L-lysine (Table 4) .

These results demonstrate that both lysC and lysA genes are inhibited by L-lysine, and overexpression of feedback-repressed enzymes of the lysine biosynthetic pathway can have a superior effect on L-lysine production in M. trichosporium OB3b.

In addition, expression of ldcC alone produced small amounts of cadaverine (3.253 ± 0.042 mg/L), whereas co-expression with lysC and lysA produced cadaverine (16.867 ± 0.019 mg/L and 30.575 ± 0.045 mg/L). ) was confirmed to improve (Fig. 3 and Table 4) .

<2-3> CO ₂ Analysis of productivity improvement of lysine and cadaverine according to the improvement of assimilation efficiency

The lack of an upstream precursor, oxaloacetate (OAA), may limit the productivity of the cadaverine biosynthetic pathway. The cadaverine biosynthetic pathway in M. trichosporium OB3b is divided in the tricarboxylic acid (TCA) cycle starting from OAA. Another study that enhances cadaverine production has been known to enhance oxaloacetate by inhibiting the expression of phosphoenolpyruvate carboxylase (PEPCK), as well as the expression of phosphoenolpyruvate carboxylase (PEPC) and pyruvate carboxylase (PYC). M. trichosporium OB3b has a gene encoding PEPC and does not have a gene encoding PEPCK, so it can reduce the effort for redesigning the synthetic pathway for lysine and cadaverine production compared to E. coli and C. glutamincum. .

Since M. trichosporium Ob3b lacks the pyc gene encoding pyruvate carboxylase, Methylomonas sp. We tried to redesign the flux from pyruvate to oxaloacetate by selecting the pyc gene derived from DH-1. The pyc gene was cloned into an expression vector containing lysA to construct a plasmid pAWP89-lysA-pyc, which was transformed into a wild-type strain to obtain a recombinant OB3b/lysA-pyc strain.

As a result, the L-lysine titer (21.66±0.018 mg/L) of the OB3b/lysA-pyc strain was 1.45 times higher than that of the OB3b/lysA strain (14.87±0.021 mg/L) (Table 4). To evaluate the effect of co-expression of lysA and pyc genes on cadaverine production, the plasmid pAWP89-lysA-pyc was transformed into an OB3b/LdcC strain, and then a recombinant OB3b/cad3 strain was obtained. As a result of culturing for 6 days using OB3b/cad3, cadaverine of 41.937±0.278 mg/L was produced, which is a result of a 12.9-fold increase in productivity compared to the initial strain OB3b/LdcC ( FIG. 4B ).

<2-4> Analysis of cadaverine production in M. trichosporium OB3 by cadaverine-lysine reverse transporter

The cadB gene is known to encode a cadaverine-lysine inverse receptor. The function of cadB is not only to export the product cadaverine out of the cell, but also to bring the substrate lysine into the cell (Ma et al., 2017). The overexpression of cadB in M. trichosporium OB3b was expected to improve cadaverine productivity, so a transformed strain OB3b/cad4 was prepared. The maximum titer of cadaverine in the transformed strain OB3b/cad4 was observed to be about 53.56±0.155 mg/L, and the productivity of cadaverine was about 0.201±0.002 mmol/g DCW/day, which was comparable to that of OB3b/LdC and OB3b/cad3 strains. In comparison, cadaverine productivity was improved by 16.5 times and 1.3 times, respectively (Table 4 and FIG. 4B). The secretion efficiency of cadaverine was improved by 21.7% compared to strain OB3b/cad3, and it was confirmed that overexpression of cadB in M. trichosporium OB3b improves cadaverine productivity.

<2-5> Productivity analysis of recombinant M. trichosporium OB3b strain in bioreactor

Production of cadaverine was confirmed in a 1L fed-batch incubator. The OB3b/cad4 strain was cultured in a fed-batch incubator. For fed-batch culture, 10% CH ₄ and 40% air were continuously provided. The OB3b/cad4 strain used for inoculation was cultured under the same conditions in flask culture.

Result, while from about 2.797 after the maximum OD ₆₀₀ for 6 days in the flask cultures, the maximum cell density of the bioreactor is OD ₆₀₀ were about 5.726 the growth of cells in a bioreactor (8 day culture) faster than flask culture, Batch Culture After 8 days, the titer of cadaverine was 192.09 mg/L ( FIG. 5 ).

<110> University-Industry Cooperation Group of Kyung Hee University <120> Transformed methanotrophs for producing cadaverine and uses it <130> PN1910-474 <160> 19 <170> KoPatentIn 3.0 <210> 1 <211> 3258 <212> DNA <213> Unknown <220> <223> pyc gene from Methylomonas sp. DH-1 <400> 1 atgttacgca aaatcctgat cgccaatcgc ggcgagattg ccgtccgcat cattcgcgcc 60 tgcgccgaaa tgggcatccg ttccgcagcg atctattccg aagccgaccg ctttgccctg 120 cacgtcaaaa aggccgacga gtcttattac atcggcagcg agccgttggc gggttacctg 180 aatatctacg gcttggtcga cttggctctg cgcaccggtt gcgatgcgat tcatccgggc 240 tacggcttcc tgtcggaaaa cgcccaattt gccaaagcct gtcaggagcg cggattagtc 300 tttatcgggc cgtcggcgga agtcatccag cgcatgggcg acaagactga agcgcgggcg 360 gcgatgaaag ctgccggcct gccggtgacg cccggttccg acggcaacct cgaaaatgtc 420 gagcaggcct tgcaggtggc cgagcagatc ggctacccga tcatgttgaa agccacctcc 480 ggcggcggcg gccgtggcat ccgccgttgc gataaccccg acgagttgcg gcaaaattat 540 caacgcgtca tttccgaagc gaccaaggcc ttcggcagtg ccgacgtgtt tctggaaaaa 600 tgcgtcgtca atccgattca tattgaggtg caagtgttgg ccgaccaatt cggcaacact 660 atccatttgt acgaacgcga ttgctcggta cagcgccgca accaaaaact gatcgaaatc 720 gcgccgtcgc cgcaactcga cgaggcccaa cgccaatact tgggcggttt ggcggtgatg 780 gcggctaaag ccgtcggcta caccaacgcc ggtactgtcg agtttttatt ggacagcaat 840 ggccgtttct atttcatgga aatgaatacc cgcgtgcagg tcgaacacac gatcaccgaa 900 actattaccg gtgtcgacat cgtcgaggaa cagattcggg tcgccgccgg tctgccgcta 960 cgtttcaagc aggaagaaat cgtcagacgc ggttatgcaa tccagtttcg ggtcaacgcc 1020 gaggacccga aaaacaattt cctgcccagc ttcggccaca tttcccgtta ctacgcgccc 1080 ggcggccccg gcgtgcgcac cgacaccgcg atttataccg gctacgaagt gccgccgttt 1140 tacgattcga tgctggccaa agtcatcgtc agcgcgatga cctgggaaga tgccatcaat 1200 cgcggcgagc gggccttgaa ggacatgggt ttgttcggca tcaaaaccac gattccctat 1260 tacctgcgga tactggccca ccccgatttt cgccgcggcc gcttcaacac cggtttcgtc 1320 gaagccaatc ccgatttaat caattattcc aacaaaccgc gcccggaaat tctggccagc 1380 gtgctggcgg ccgttgtcgc ttcccatacc ggcctctaag ccaaggaaac tctcatgagc 1440 aaagtgtatg taaccgacgt tattctgcgc gacgcccacc agtcgctgat cgccacccgg 1500 atgcgcaccg aagacatgtt gccggcttgc acgatgttgg acgacatcgg ctattggtcg 1560 ttggaatgct ggggcggcgc cacctttgat gcctgcttgc gcttcttgaa agaagaccct 1620 tgggagcgct tgagcaaact gaaagcagcc ctgccaaata ccaaattgca gatgctgctg 1680 cgtggccaaa atctgctcgg ttatcgtcac tattccgacg acgtggtgcg taagttcgtc 1740 gagaccgccg cccgcaacgg catggacgta ttccgcatct tcgacgcgct gaacgatatt 1800 cgtaacttgg aaaccgccat cgaagccacc cgcgaggccg gcaaacatgc ccagggcacg 1860 atttgctaca ccaccagtcc ggtacacgat atcgccagtt tcatcaaact gggtaaaggt 1920 ttggccaacc tgggctgtaa ctcgattgcg atcaaggaca tggccggctt gttgacgcca 1980 tacatcgccg gcgaaatggt caaagctctg aaagacgccg tcgatttgcc gttgcatttg 2040 cactgccatg ctacggccgg cttagcggaa atgtgccaga tcaaggccat cgaagccggc 2100 tgcgagcacg tcgataccgc gctgtcgtcc tgggccggcg gcaccagcca tccaccgacc 2160 gaaagcctgg tcaccgcgtt gcgcggcacc gattacgaca cggggctgga tttggataaa 2220 ctgcaagcgg tgaacgacta tttcgccgaa gtccgcaaaa aataccgccg cttcgaaagc 2280 gaatttaccg gcatcgacac ccgcgtccac atcttccaag tcccgggcgg catgatctcc 2340 aacctggcca accaattgaa agaacgcaac gcactggacc ggatcgacga ggtgtataaa 2400 gaaatcccgg aagtccgcaa agacctgggc tatccgccat tggtgacacc aacctcgcaa 2460 atcgtcggca cccaggcggt gttgaacgtg ctgatcggca agcgttacga gaccatcagc 2520 aacgaggtta aacgctacct gcacggcggc tacggcaagg cgccggcgcc ggtcaatccg 2580 caattgctgg ccaaggcggt cggtaaagag gaaatcatcg aatgccggcc ggccgatttg 2640 ctcaagcccg agttcgagca tcttcgtggc gaaatcgccc atctggcgtt gaacgacgag 2700 gacgtactga gttacgcgat gtttccggaa atcggcaaac aattcctgga attgcgttcg 2760 aacgacaacc tagtgccgga gccgttggaa ttggaggctg cgcctaaacc gggcgaggtc 2820 aaaaaagccc cgaccgaatt caacgtggcg ttgcacggcg agcaatacca cgtcaaagtt 2880 accggcgccg gcccgaaaaa ccaaagcctg cggcattttt acttcaccgt ggacggcatg 2940 ccggaagaaa tcgtcatcga gaccttggac gaaatcgtac tggacggcgg cgcccatggc 3000 gcggtgcaaa gcgcaatcgc cagcaagcgc cgccggccca gcgagccggg cgatgtggtg 3060 accagcatgc cgtgcaacat catcgacgtg ctggtcaagg agggacagaa agtcaacgcc 3120 ggccaggcct tgctggtcac cgaagcgatg aaaatggaga ccgaaatcac ggcaccgatt 3180 gccggcgtgg ttaaagccat ttacgtcgcc aaaggcgatg cggttaaccc caacgaggtg 3240 ttggtggaaa taaattga 3258 <210> 2 <211> 1269 <212> DNA <213> Unknown <220> <223> lysA gene from M. trichosporium OB3b <400> 2 atgcatcatt tcgactatcg cgccggcgtc ctccacgccg aggacgtggc cctgccgaag 60 atcgccgagg acgtcggcgc gcccttctac tgctatagcg cggcgacgat ccggcggcac 120 ttcaccgtct tttccgccgc tttcgcgggg ctcgacgcgc tcgtctgcta tgcggtgaag 180 gccaattcca atcaggccgt gctcgccctg ctcgccggac tcggcgccgg catggacgtc 240 gtctccggcg gcgagctgcg ccgcgcccgc gccgccggcg ttcccgcgag caagatcacc 300 ttctccggcg tcggcaagac ggcgcaggag atcgcgctcg cgatcgacga aggcatcttc 360 tgcttcaatg tggagtccga gccggagctc gaggcgatcg ctgcgatcgc tgcggcgaag 420 gggagacgcg cccatatctc tctgcgcgtc aatccggacg tcgacgccaa gacccacgcc 480 aagatctcga ccggcctcgc cgagaataaa ttcggcgtgc ccttgtcgcg cgcccgcgac 540 atttacgcgc aggcggcgcg gctgccggga ctcgacatcg tcggcgtcga catgcacatc 600 ggctcgcaga tcactgatct tcgccccttc gacgcggcct tttccctgct cgccgagctc 660 gtcgtcggcc tgcgcgccga cggacacgcg atctcccatg tcgatctcgg cggcggcctc 720 ggcattccct atcacgccgg cgaggacccg gcctcctatc atccagaccg ctatgcggag 780 atcgtgcgcc gccatatggg cgcgctcggc tgcaagctcc tgttcgagcc cggccggctc 840 atcgtcggca atgccggcgt gctggtgacg cgcgtcctct atgtgaagca gggcgaggcc 900 aagaccttcg tcatcgtcga cgccggcatg aacgatctcg tccgtccgac cctctacgac 960 gcctggcacg agatcattcc ggtgaccgag cccgcgcggg ggcggaacga gattctcgcc 1020 gatgtcgtcg ggccggtgtg cgagaccggc gattacattg cgctcggccg ctcgatcccg 1080 gcgccggcgc agggcgatct gctcgcggtt ctgacctccg gggcctatgg cgccgtgcag 1140 gcgggaacct ataattcgcg gccgctcatt cccgaggtgc tggtcgacgg cgcgcgctgg 1200 gcggtggtgc gcgcgcgtcc gagcatagag agcctcatcg cgctcgacag cgttcccgat 1260 tggctgtga 1269 <210> 3 <211> 2142 <212> DNA <213> Unknown <220> <223> ldcC gene from E. coli <400> 3 atgaacatca ttgccattat gggaccgcat ggcgtctttt ataaagatga gcccatcaaa 60 gaactggagt cggcgctggt ggcgcaaggc tttcagatta tctggccaca aaacagcgtt 120 gatttgctga aatttatcga gcataaccct cgaatttgcg gcgtgatttt tgactgggat 180 gagtacagtc tcgatttatg tagcgatatc aatcagctta atgaatatct cccgctttat 240 gccttcatca acacccactc gacgatggat gtcagcgtgc aggatatgcg gatggcgctc 300 tggttttttg aatatgcgct ggggcaggcg gaagatatcg ccattcgtat gcgtcagtac 360 accgacgaat atcttgataa cattacaccg ccgttcacga aagccttgtt tacctacgtc 420 aaagagcgga agtacacctt ttgtacgccg gggcatatgg gcggcaccgc atatcaaaaa 480 agcccggttg gctgtctgtt ttatgatttt ttcggcggga atactcttaa ggctgatgtc 540 tctatttcgg tcaccgagct tggttcgttg ctcgaccaca ccgggccaca cctggaagcg 600 gaagagtaca tcgcgcggac ttttggcgcg gaacagagtt atatcgttac caacggaaca 660 tcgacgtcga acaaaattgt gggtatgtac gccgcgccat ccggcagtac gctgttgatc 720 gaccgcaatt gtcataaatc gctggcgcat ctgttgatga tgaacgatgt agtgccagtc 780 tggctgaaac cgacgcgtaa tgcgttgggg attcttggtg ggatcccgcg ccgtgaattt 840 actcgcgaca gcatcgaaga gaaagtcgct gctaccacgc aagcacaatg gccggttcat 900 gcggtgatca ccaactccac ctatgatggc ttgctctaca acaccgactg gatcaaacag 960 acgctggatg tcccgtcgat tcacttcgat tctgcctggg tgccgtacac ccattttcat 1020 ccgatctacc agggtaaaag tggtatgagc ggcgagcgtg ttgcgggaaa agtgatcttc 1080 gaaacgcaat cgacccacaa aatgctggcg gcgttatcgc aggcttcgct gatccacatt 1140 aaaggcgagt atgacgaaga ggcctttaac gaagccttta tgatgcatac caccacctcg 1200 cccagttatc ccattgttgc ttcggttgag acggcggcgg cgatgctgcg tggtaatccg 1260 ggcaaacggc tgattaaccg ttcagtagaa cgagctctgc attttcgcaa agaggtccag 1320 cggctgcggg aagagtctga cggttggttt ttcgatatct ggcaaccgcc gcaggtggat 1380 gaagccgaat gctggcccgt tgcgcctggc gaacagtggc acggctttaa cgatgcggat 1440 gccgatcata tgtttctcga tccggttaaa gtcactattt tgacaccggg gatggacgag 1500 cagggcaata tgagcgagga ggggatcccg gcggcgctgg tagcaaaatt cctcgacgaa 1560 cgtgggatcg tagtagagaa aaccggccct tataacctgc tgtttctctt tagtattggc 1620 atcgataaaa ccaaagcaat gggattattg cgtgggttga cggaattcaa acgctcttac 1680 gatctcaacc tgcggatcaa aaatatgcta cccgatctct atgcagaaga tcccgatttc 1740 taccgcaata tgcgtattca ggatctggca caagggatcc ataagctgat tcgtaaacac 1800 gatcttcccg gtttgatgtt gcgggcattc gatactttgc cggagatgat catgacgcca 1860 catcaggcat ggcaacgaca aattaaaggc gaagtagaaa ccattgcgct ggaacaactg 1920 gtcggtagag tatcggcaaa tatgatcctg ccttatccac cgggcgtacc gctgttgatg 1980 cctggagaaa tgctgaccaa agagagccgc acagtactcg attttctact gatgctttgt 2040 tccgtcgggc aacattaccc cggttttgaa acggatattc acggcgcgaa acaggacgaa 2100 gacggcgttt accgcgtacg agtcctaaaa atggcgggat aa 2142 <210> 4 <211> 1335 <212> DNA <213> Unknown <220> <223> cadB gene from E. coli <400> 4 atgagttctg ccaagaagat cgggctattt gcctgtaccg gtgttgttgc cggtaatatg 60 atggggagcg gtattgcatt attacctgcg aacctagcaa gtatcggtgg tattgctatc 120 tggggttgga ttatctctat tattggtgca atgtcgctgg cgtatgtata tgcccgactg 180 gcaacaaaaa acccgcaaca aggtggccca attgcttatg ccggagaaat ttcccctgca 240 tttggttttc agacaggtgt tctttattac catgctaact ggattggtaa cctggcgatt 300 ggtattaccg ctgtatctta tctttccacc ttcttcccag tattaaatga tcctgttccg 360 gcgggtatcg cctgtattgc tatcgtctgg gtatttacct ttgtaaatat gctcggcggt 420 acttgggtaa gccgtttaac cactattggt ctggtgctgg ttcttattcc tgtggtgatg 480 actgctattg ttggctggca ttggtttgat gcggcaactt atgcagctaa ctggaatact 540 gcggatacca ctgatggtca tgcgatcatt aaaagtattc tgctctgcct gtgggccttc 600 gtgggtgttg aatccgcagc tgtaagtact ggtatggtta aaaacccgaa acgtaccgtt 660 ccgctggcaa ccatgctggg tactggttta gcaggtattg tttacatcgc tgcgactcag 720 gtgctttccg gtatgtatcc gtcttctgta atggcggctt ccggtgctcc gtttgcaatc 780 agtgcttcaa ctatcctcgg taactgggct gcgccgctgg tttctgcatt caccgccttt 840 gcgtgcctga cttctctggg ctcctggatg atgttggtag gccaggcagg tgtacgtgcc 900 gctaacgacg gtaacttccc gaaagtttat ggtgaagtcg acagcaacgg tattccgaaa 960 aaaggtctgc tgctggctgc agtgaaaatg actgccctga tgatccttat cactctgatg 1020 aactctgccg gtggtaaagc atctgacctg ttcggtgaac tgaccggtat cgcagtactg 1080 ctgactatgc tgccgtattt ctactcttgc gttgacctga ttcgttttga aggcgttaac 1140 atccgcaact ttgtcagcct gatctgctct gtactgggtt gcgtgttctg cttcatcgcg 1200 ctgatgggcg caagctcctt cgagctggca ggtaccttca tcgtcagcct gattatcctg 1260 atgttctacg ctcgcaaaat gcacgagcgc cagagccact caatggataa ccacaccgcg 1320 tctaacgcac attaa 1335 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pAWP89-Tac-For <400> 5 tagttgtcgg gaagatgcgt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pAWP89-Tac-Rev <400> 6 agctgtttcc tgtgtgaata 20 <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ldcC-For <400> 7 tattcacaca ggaaacagct atgaacatca ttgccattat gggac 45 <210> 8 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> ldcC-Rev <400> 8 gcatcttccc gacaactatt atcccgccat ttttaggact c 41 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> cadA-K12-For <400> 9 tattcacaca ggaaacagct atgaacgtta ttgcaatatt 40 <210> 10 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cadA-K12-Rev <400> 10 gcatcttccc gacaactatt attttttgct ttctt 35 <210> 11 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> lysA-For <400> 11 gggaacaaaa gctgggtaca tgcatcattt cgactatcg 39 <210> 12 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> LysA-Rev <400> 12 cgaggggggg cccggtactc acagccaatc gggaacgc 38 <210> 13 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> lysC-For <400> 13 gggaacaaaa gctgggtaca tggctcgtct ggtgatgaa 39 <210> 14 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> LysC-Rev <400> 14 cgaggggggg cccggtactc aggccgcgtc cagcccat 38 <210> 15 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> Pyc-For <400> 15 ggtatcgata agcttgatat cgtcacggcg cagctgcgcc ctaccgctgt taaaggagac 60 attttatgtt acgcaaaatc ctgat 85 <210> 16 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Pyc-Rev <400> 16 gatcccccgg gctgcaggtc aatttatttc caccaaca 38 <210> 17 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Ptac-ldc-BamHI-For <400> 17 ttgacctgcc agcccggggt tgacaattaa tcatcggct 39 <210> 18 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Ptac-ldc-BamHI-Rev <400> 18 gccgctctag aactagtgtt atcccgccat ttttagga 38 <210> 19 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> cadB-XbaI-For <400> 19 ggcgggataa cactagtttt aaccaacagt ttttctacct aaaggaggcg ttttatgagt 60 tctgccaaga agat 74

Claims (9)

Cadaverine with activated pyruvate carboxylase, diaminopimelate decarboxylase, lysine decarboxylase and cadaverine-lysine antiporter protein Transformed methylosinus trichosporium to produce a (Methylosinus trichosporium) OB3b. According to claim 1, wherein the gene encoding the pyruvate carboxylase (pyruvate carboxylase) ( Pyc ) is represented by the nucleotide sequence of SEQ ID NO: 1, diaminopimelic acid carboxylase (diaminopimelate decarboxylase) encoding a gene ( lysA ) is a transformed methylosinus trichosporium (Methylosinus trichosporium) OB3b that is represented by the nucleotide sequence of SEQ ID NO: 2. According to claim 1, wherein the lysine carboxylase (lysine decarboxylase) coding gene ( ldcC ) will be represented by the nucleotide sequence of SEQ ID NO: 3 transformed methyl losinus trichosporium (Methylosinus trichosporium) OB3b. The method according to claim 1, wherein the cadaverine-lysine antireceptor protein (cadaverine-lysine antiporter protein) encoding gene (cadB ) is represented by the nucleotide sequence of SEQ ID NO: 4 transformed methylosinus tricosporium (Methylosinus) trichosporium) OB3b. delete delete According to claim 1, wherein the transgenic methyl rosinus trichosporium (Methylosinus trichosporium) OB3b is to produce cadaverine using methane, transgenic methyl osinus trichosporium OB3b. A method for producing cadaverine, comprising the step of culturing the transformed methylosinus trichosporium OB3b of claim 1 in a culture medium containing methane. The method of claim 8, further comprising recovering cadaverine from the culture medium.

Images