CN117736879A - Pink auricularia polytricha ZJFME001 strain and application thereof - Google Patents

Abstract

The application discloses a pink Auricularia polytricha ZJFME001 strain and application thereof, wherein the preservation number of the pink Auricularia polytricha (Auricularia cornea) ZJFME001 strain is as follows: CGMCC No.:40900, the gene sequence is SEQ ID: no.1. The new auricularia polytricha variety has pink color, high rehydration rate, rich crude polysaccharide, ergosterol and protein, rich nutrient substances, low fat and selenium content, and the composition of the nutrient components is superior to that of auricularia polytricha, auricularia auricula-judae and auricularia auricula-judae with wrinkles in the current market.

Description

Pink auricularia polytricha ZJFME001 strain and application thereof

Technical Field

The application relates to the technical field of auricularia polytricha, in particular to a pink auricularia polytricha ZJFME001 strain and application thereof.

Background

Auricularia polytricha (Auricularia cornea Ehrenb.) belongs to the basidiomycetes phylum, the agaricus phylum (agaricomomycins), the agaricus phylum (agaricomomycetes), the agaricus order (Auricus), the Auriculariaceae (Auricularia ). The genus Auricularia, auricularia auricula-judae and its lower strain belong to the safe edible variety.

The wild Auricularia polytricha is widely distributed in Zhejiang, fujian, jilin, jiangsu, guizhou, yunnan, shandong, guangdong, hainan, henan, qinghai, anhui and Sichuan places. The artificial cultivation of auricularia polytricha in China starts from the beginning of the 80 th century, the cultivation mode is changed from log cultivation to material generation cultivation by utilizing agricultural and forestry byproducts, the auricularia polytricha nowadays enters a rapid development period, and the auricularia polytricha is one of main cultivated edible fungi in China.

At present, the cultivation area is 17 provinces (directly administered city, autonomous region) throughout the country, and the total output of the auricularia polytricha in China is about 168.64 ten thousand tons according to statistics of China edible fungus society in 2017, so that the auricularia polytricha is the sixth main cultivated edible fungus in China. The auricularia polytricha polysaccharide has the functions of inhibiting tumor, resisting oxidization, resisting thrombus, reducing blood fat and the like, and has the potential of being developed into a new medicine. The auricularia polytricha is sold in dry and fresh products in the market, the edible mode is a stir-fried food or a hot pot material, and along with the deep research of auricularia polytricha products, more and more auricularia polytricha deep-processed foods such as auricularia polytricha preserves, jellies, cans and the like are developed, so that the added value of auricularia polytricha is increased, and the dietary structure of people is improved. Therefore, the auricularia polytricha has good industrial development prospect.

In recent years, the yield and quality of auricularia polytricha are affected to a certain extent due to the degradation of strains, diseases and insect pests and environmental pollution, and the quality requirements of the auricularia polytricha commodity in the markets at home and abroad are more and more strict.

The south climate is warm and moist, and diseases and insect pests are easy to occur when the auricularia polytricha is cultivated, so that the yield and quality of the whole auricularia polytricha industry are affected; the cultivation mode is also single-side opening or fruiting at two ends, the ear pieces are huge, and the taste is poor. The new auricularia polytricha variety auricularia polytricha adopts a new small-hole hanging bag cultivation mode, and the quality of the product is greatly improved although the yield is slightly reduced. Meanwhile, the existing auricularia polytricha has single component and low content, and the content of the nutritional components is insufficient to meet the growing edible requirement, so that the new auricularia polytricha variety is bred, and the method has great significance and market requirements.

The information disclosed in the background section is only for enhancement of understanding of the general background of the invention and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person of ordinary skill in the art.

Disclosure of Invention

Aiming at the technical problems, the application provides a pink auricularia polytricha ZJFME001 strain and application thereof, wherein the color of the auricularia polytricha new strain is pink, the dry-wet ratio is low, the rehydration rate is high, and the auricularia polytricha is rich in more crude polysaccharide, ergosterol and protein, the nutrient substances are more abundant, the fat is low, the selenium is contained, and the composition of the nutrient components is superior to that of auricularia polytricha, auricularia auricula and auricula-judae on the current market.

The application provides a pink Auricularia polytricha ZJFME001 strain, wherein the preservation number of the pink Auricularia polytricha strain (Auricularia cornea) ZJFME001 strain is as follows: CGMCC No.:40900, the gene sequence is SEQ ID: no.1.

Preferably, the foaming ratio is 9 to 10 times;

preferably, the crude polysaccharide content in the fresh food of the auricularia polytricha ZJFME001 strain is 9.20g/100g; fat content is 0.4g/100g; selenium content is 0.023mg/kg; iron content was 30.4mg/kg; the potassium content is 1096mg/100g; sodium content is 40.2mg/100g; the calcium content is 212mg/kg; zinc content is 9.4mg/kg; the ergosterol content is 0.553mg/g; the total amount of amino acid is 6.35g/100g.

The application also provides a preparation method of the fermentation liquor of the pink auricularia polytricha ZJFME001 strain, which comprises the following steps:

inoculating the pink auricularia polytricha ZJFME001 strain into the sterilized liquid culture medium, and shaking-culturing at 25 ℃ for 6-12 days to obtain ZJFME001 strain liquid.

Preferably, the liquid culture medium is composed of 5g of bean powder, 3g of corn powder, 3g of peptone, 20g of glucose, 1g of magnesium sulfate and 2g of dipotassium hydrogen phosphate;

preferably, the sterilization condition of the liquid culture medium is 121 ℃ and 0.15Mpa for 30min;

preferably, the strain is inoculated in an amount of 1% or more by volume of the liquid medium.

The application also provides a method for industrially cultivating the pink auricularia polytricha ZJFME001 strain, which comprises the following steps:

1) Filling cultivation materials in the cultivation bags, sterilizing, inoculating ZJFME001 strain, and performing dark cultivation for 20-25 days under the conditions of 17-20 ℃ and 50-60% of air humidity;

2) After hypha grows fully, fruiting management is carried out, and cultivation is continued for 5-7 days at the temperature of 24-26 ℃ under the air humidity of 80% -85%;

3) When primordia grow, the humidity is increased to 90% -95%, the illumination is started for 2-3 hours and stopped for 1-2 hours at 24-26 ℃, the culture is continued for 10-20 days, and the pink auricularia polytricha ZJFME001 strain is obtained.

Preferably, the cultivation material comprises 70 parts of wood dust, 15 parts of cotton seed hulls, 13.9 parts of wheat bran, 0.5 part of gypsum, 0.5 part of lime and 0.1 part of potassium dihydrogen phosphate.

Preferably, the cultivation material consists of 19 parts of corncob, 40 parts of cotton seed hulls, 30 parts of wood chips, 10 parts of wheat bran and 1 part of gypsum.

Preferably, the size of the cultivation bag is 5 x 18 x 35cm or 5 x 15 x 55cm.

Preferably, when the size of the cultivation bag used is 5 x 18 x 35 cm; the inoculation step is to punch 4 holes on the surface of the cultivation bag, inoculating 5-10 ml of fermentation liquor of pink auricularia polytricha ZJFME001 strain in each hole, and sticking a breathable film on the surface of each hole for sealing after inoculation;

and (3) after hypha grows fully in fruiting management, adopting a single-side opening or two-head fruiting mode.

Preferably, when the size of the cultivation bag is 5 x 15 x 55cm, the inoculation step is inoculation at the cultivation bag mouth;

and (3) after hypha grows fully in fruiting management, punching by using a puncher, and adopting a small-hole hanging bag cultivation mode.

The strain has various planting methods, can realize industrialized planting, is beneficial to improving the yield, and can reduce the probability of being infected by infectious microbe and improve the yield because the strain has the effect of inhibiting mould.

The application also provides a drying method of the pink auricularia polytricha ZJFME001 strain, which comprises the following steps: and (3) drying the collected pink auricularia polytricha ZJFME001 mushroom at 90-120 ℃ for 6-10 hours to obtain a auricularia polytricha dry product.

The edible fungi dried under the condition can better retain various nutritional ingredients in the edible fungi, and the edible fungi dried under the condition has better rehydration property.

The beneficial effects that this application can produce include:

1) The pink auricularia polytricha ZJFME001 strain and application thereof provided by the application have the advantages that the strain is not bright in color and pink, the color variety of auricularia polytricha is increased, the color character of fruiting bodies is stable, meanwhile, the nutrition components are rich, the fat content is low, the strain also has good taste, the growth of mixed bacteria can be effectively inhibited in the cultivation process, and the prepared strain is fast in spawn running, less in pollution and strong in hypha; the color of the fruiting body is pink, and the stable character and high yield are achieved; not only can open on one side or fruiting at two ends, but also can be suitable for a small-hole hanging bag cultivation mode. The auricularia polytricha is suitable for large-scale and industrial cultivation, is rich in nutrient substances, low in fat and high in rehydration ratio of dry products, and has high application value.

2) The pink auricularia polytricha ZJFME001 strain and application thereof provided by the application have the foaming rate of 9-10 times, namely 9-10 kg of 1kg of dry product can be foamed. The characteristics of the strain are beneficial to improving the income of mushroom farmers, simultaneously meeting the consumption needs of consumers, simultaneously realizing large-scale and industrialized cultivation, and having high yield and higher application value.

3) The pink auricularia polytricha ZJFME001 strain and the application thereof provided by the application solve the problem of single variety, so that consumers select one more strain, the auricularia polytricha industry development can be forcefully promoted, and the edible fungus industry development is promoted. With the rapid development of the auricularia polytricha industry, the novel pink auricularia polytricha variety preserved by the invention is pink in color and is more attractive than the white and dark brown varieties in the current market. The cultivation mode can be a single-side opening or two-end fruiting mode of the traditional auricularia polytricha, and also can be a small-hole hanging bag cultivation mode of the auricularia polytricha, and is rich in nutrient substances, low in fat, high in rehydration ratio of dry products and the like, so that the pink bred by us can be welcomed by consumers once being pushed to the market, and is welcomed by mushroom farmers, and the auricularia polytricha has huge market potential.

The pink Auricularia polytricha (Auricularia cornea) ZJFME001 disclosed by the invention has the following preservation units: china general microbiological culture Collection center (CGMCC), address: beijing, chaoyang area, north Chenxi Lu No.1, 3; the preservation date: 2023, 10, 19, deposit number: CGMCC No.40900.

Drawings

Fig. 1 is a schematic diagram of a phylogenetic tree of the pink auricularia polytricha ZJFME001 provided by the present application;

fig. 2 is a photograph of fruiting of pink auricularia polytricha in the examples of the present application; a. b) cultivation mode of example 3; b. c) cultivation mode of example 4;

Detailed Description

The invention is described in further detail below with reference to the drawings and examples, but is not limited in any way to any changes or modifications made based on the teachings of the invention, which fall within the scope of the invention.

Examples

Materials and instruments used in the examples below were commercially available unless otherwise specified; the detection method is the existing method unless specified.

The potatoes used in the culture medium in the following examples were all treated as follows:

cutting potato into pieces, adding water, boiling for 30min (with proper water supply for controlling firepower), filtering with gauze, adding water to 1000ml, packaging into triangular flask, and sterilizing with high temperature steam.

Example 1 isolation and characterization of Strain ZJFME001

1. Variety breeding and preserving

Collecting pink Auricularia auricula-judae fruiting body growing in Pingyuan county of Mei, guangdong in 6 th and 7 th of Zhang Junbo 2023, inoculating tissue blocks of the collected fruiting body in a super-fungus table through a culture medium inclined surface test tube, wherein the culture medium is as follows: 20g of agar powder, 20g of glucose and 200g of potato; culturing in dark at 25deg.C for 7 days, purifying, culturing for about 14 days, selecting test tube strain with good growth condition, preparing culture strain, sterilizing and bagging at 120deg.C under 0.15Mpa to obtain culture bag (wood chip 70 parts cotton seed hull 15 parts, wheat 13.9 parts, gypsum 0.5 parts, lime 0.5 parts, and potassium dihydrogen phosphate 0.1 parts). Respectively inoculating a strain ZJFME001 at openings at two ends of a cultivation bag, and then culturing at 25 ℃ under the air humidity of 50% -60% until the fungus bags grow fully to cultivate mushroom; selecting a slice region with better pink sub-entity characters after fruiting, and continuing to pick sub-entity tissue separation strains;

the separation and screening operation is repeated for 3 times to cultivate fruiting and select and finally obtain a strain ZJFME001 with pink cultivated fruiting, high yield and good resistance.

And (5) preserving a bevel test tube: culturing the test tube inoculated with the strain ZJFME001 at 25deg.C until mycelia grow over two thirds of the test tube, and preserving in a refrigerator at 4deg.C; wherein the culture medium filled in the test tube with the volume of 1/3 of that of the test tube is 20g of agar powder, 20g of glucose and 200g of potato.

Cutting mycelium blocks in a culture tube, placing in a freezing tube filled with sterile distilled water, and storing in a refrigerator at 4deg.C.

2. Identification of Strain ZJFME001

Extracting genome DNA of ZJFME001 hypha and cultivated fruiting body by CTAB method, and detecting after GelRed staining by 1% agarose gel electrophoresis; the extracted total DNA was used as a template, and the sequence of Internal Transcribed Spacer (ITS) was amplified using Mix reagent (Hunan Optimu Biotechnology Co., ltd.) and ITS4 (5 '-TCCTCCGCTTATTGATATGC-3') and ITS5 (5 '-GGAAGTAAAAGTCGTAACAAGG-3') as primers.

The PCR amplification system was (25. Mu.L): 2 XMix 12.5. Mu.l, 10. Mu.M primers 0.5. Mu.l each, ddH ₂ O11. Mu.L, and DNA template 0.5. Mu.L. The reaction procedure is: pre-denaturation at 95 ℃ for 5min, entering 35 amplification cycles: denaturation at 95℃for 40sec, annealing at 50℃for 40sec, extension at 72℃for 1min, extension at 72℃for 10min, and preservation at 4 ℃; detecting after electrophoresis by 1% agarose gel, to the Optimus of the family Praeparata the technique completes sequencing.

The obtained ZJFME001 hypha and the sequencing result of fruiting bodies of cultivated mushrooms are subjected to bidirectional splicing to obtain a ZJFME 001-hypha-598 bp sequence (shown as SEQ ID: no. 1).

The hyphal nucleotide sequence of strain ZJFME001 (SEQ ID: no. 1) was determined:

GCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGCCAAAGCTTTAAAAATAATGTGTCCACAGAGGGACGGCTGTAAGCAGCACCGCTGAAGAGGCCTAAGGCATTGGCGCAGATAATTATCACACCGTCGCCCAGCACTCTAAAAGCGCCAGCTAATGCATTTCAAGACGAGCCGGTTACGGCACAGTCCAAGTCCACCACGGGCGACTGTTACATCGCAAGGGTGAGGGTTTACGTGACACTCAAACAGGCATGCTCCATGGAATACCAAGGAGCGCAAGATGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTTACTTTTTATGGTTTTGTTAACATTCGAGACTGAGTTGTTGCATTTGAAAGCGGCAGCGACCGAAGCCGCAACCGAAAAGGTGCACAGGTGTGGGGTCTTGCTCCAGCGTGCAGCCCTGTGAAGGGCGCACAGCTGAACGATCGGGTTAAAAGCCCAAAATCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGT

submitting the sequence to GeneBank, carrying out homology search by using BLAST (ww.ncbi.lm.nih.gov/BLAST), carrying out similarity analysis on the sequence with each strain in a database, and ensuring that the sequence identity (Identities) with each strain of Auricularia cornea in the database reaches 98.5-100%.

ITS sequences downloaded from a GeneBank database, and using MEGA7 software to construct an NJ phylogenetic tree, using default parameters, bootstrap test 1000 times, yielding a phylogenetic tree. From phylogenetic tree (figure 1), it can be seen that hyphae and fruiting bodies of ZJFME001 are gathered together with auricularia polytricha homozygotic species in GeneBank database, and the support rate of branches of homozygotic species is 84%, so that the result of BLAST comparison and phylogenetic tree is combined, and the sequenced ZJFME001 is auricularia polytricha (Auricularia cornea).

The obtained strain is sent to China general microbiological culture collection center (CGMCC) for preservation.

Example 2 preparation method of liquid strain of auricularia auricula ZJFME001 strain

Step 1, preparing fermentation liquor according to 5g of bean flour, 3g of corn flour, 3g of peptone, 20g of glucose, 1g of magnesium sulfate and 2g of dipotassium hydrogen phosphate, filling the fermentation liquor into a 500ml triangular flask, sterilizing for 30min at 121 ℃ and 0.15Mpa, and cooling for later use;

and 2, inoculating the ZJFME001 mother strain of the auricularia auricula in an amount which is 1% of the volume of the fermentation broth after cooling, and shaking and culturing for 6 days at 25 ℃ after inoculating to obtain ZJFME001 strain liquid.

Example 3 industrialized cultivation method of Auricularia auricula-judae ZJFME001

The industrial cultivation method comprises the following steps:

step 1, weighing 19 parts of corncob, 40 parts of cotton seed hulls, 30 parts of wood dust, 10 parts of wheat bran and 1 part of gypsum, mixing to obtain a cultivation material, and measuring the water content of the obtained cultivation material to be 60%;

step 2, filling cultivation materials into mushroom fungus bags with the length of 5 x 15 x 55cm to obtain cultivation bags, sterilizing the cultivation bags for 120min at the temperature of 121 ℃ and the pressure of 0.15Mpa, and taking out and cooling after sterilization is finished;

step 3, inoculating the strain ZJFME001 culture solution when the cultivation bag is cooled to about 25 ℃, punching 4 holes at intervals on the surface of a long bag with the length of 5 x 15 x 55cm, inoculating 5-10 ml of liquid strain in each hole, sticking a breathable film on each hole for sealing after the inoculation, and carrying out dark cultivation for 21 days under the conditions of 17-20 ℃ and 50-60% of air humidity; no pollution is found in the process, and the infectious microbe infection rate is 0, which indicates that the bacterial growth is fast and the pollution is less.

Step 4, tearing off a long bag ventilation film on the 5 x 15 x 55cm after hypha grows fully, and adopting a single-side opening or two-end fruiting mode, and raising the air humidity in the cultivation environment to 80% -85%, and continuing to cultivate for 5-7 days at 24-26 ℃;

and 5, when primordia grow, the humidity is increased to 90% -95%, the temperature is 24-26 ℃, the light is turned on for 2-3 hours, the cultivation is continued for 17 days until the auricularia polytricha fruiting body grows up, the auricularia polytricha opens, the auricularia polytricha turns pink, and the auricularia polytricha can be picked.

Example 4 industrialized cultivation method of Auricularia auricula-judae ZJFME001

The difference from example 3 is that: the cultivation material comprises 70 parts of wood dust, 15 parts of cotton seed hulls, 13.9 parts of wheat bran, 0.5 part of gypsum, 0.5 part of lime and 0.1 part of potassium dihydrogen phosphate. Dark culture for 20 days in step 3. A fungus bag with the size of 5 x 18 x 35cm is used, and is inoculated at a cultivation bag opening during inoculation. In the step 4, after hypha grows fully, 5 x 18 x 35 fungus bags are punched by a puncher, and a small hole hanging bag cultivation mode is adopted; the culture was continued for 18 days in step 5.

Example 5 industrialized cultivation method of Auricularia auricula-judae ZJFME001

The difference from example 3 is that: dark culture for 25 days in step 3. The culture was continued for 10 days in step 5.

Example 6 industrialized cultivation method of Auricularia auricula-judae ZJFME001

The difference from example 3 is that: dark culture for 20 days in step 3. The culture was continued for 20 days in step 5.

Example 7 determination of nutrient substances of Auricularia auricula-judae strain ZJFME001

The fruiting body of the mature auricularia auricula ZJFME001 obtained by the cultivation method in the example 3 is dried, and the sample is sent to the quality supervision and test center of the Kunming edible fungi of the national supply and marketing company to detect partial nutrient substances, and the detection method and the detection result are shown in the following table:

table 1: edible fungus ZJFME001 part of nutrient

The auricularia polytricha disclosed in the 'quality evaluation of black fungus sold in the market', xu Juan, qin, xu Yanjun and the like, the biological characteristics and the nutritional quality of the 'Qian-Run-Er No. 1' of the auricularia polytricha are compared, the fungus physical journal, 2023,42 (07): 1517-1529.DOI: 10.13346/j.mycosystem.220381, and the nutritional ingredients content of the auricularia polytricha are as follows: the crude polysaccharide content of the existing black fungus is 76.98mg/g, and the crude polysaccharide content of the auricularia polytricha is 53.37-136.8 mg/g; the ergosterol content of the black fungus is 0.1359-0.8936mg/g, and the ergosterol content of the black fungus is 0.4177mg/g; the protein content of the black fungus is 3.2% -13.7%, and the protein content of the auricularia polytricha is 7.0%; the crude fat content of the black fungus is 4.54%, and the crude fat content of the auricularia polytricha is 3.65%.

As can be seen from the table, the nutrient substance of the strain ZJFME001 provided by the application has the following properties than Auricularia polytricha, auricularia polytricha and Auricularia polytricha in the current market: rich selenium, high ergosterol content and lower fat content.

Example 8 Auricularia auricula-judae ZJFME001 anti-pollution capability detection

Step 1, according to the formula: 20g of agar powder, 5g of bean powder, 3g of corn powder, 3g of peptone, 20g of glucose, 1g of magnesium sulfate and 2g of dipotassium hydrogen phosphate to prepare a culture medium, and pouring the culture medium into a 9cm flat plate for later use;

step 2, respectively inoculating mould and auricularia polytricha strains to a flat plate for culture at 25 ℃ for standby after hyphae grow fully;

step 3, punching bacterial colonies on the culture-completed mould which is Penicillium (Penicillium) (the formula of a culture medium comprises 20g of agar powder, 20g of glucose and 200g of potato, and standing and culturing at 25 ℃ for 72 hours) and the auricularia polytricha by using a 0.5cm puncher to obtain bacterial blocks;

step 4, treatment group 1: respectively inoculating mould fungus blocks and auricularia polytricha fungus blocks on two symmetrical sides of the central line of the same 9cm flat plate; control group: mould fungus blocks are singly connected with a flat plate to be used as a control group;

culturing at 25deg.C for 5 days, and measuring radius R of mold growth on the plates of the treatment group ₁ 3.5cm; measurement of mould colony diameter R on control plate _CK 4.5cm;

therefore, the auricularia auricula ZJFME001 has antagonistic effect on mould, can effectively resist the infection of mould, reduce the probability of mixed bacterial pollution in the cultivation process, and effectively improve the yield.

Comparative example 1: auricularia polytricha fungus mildew-resistant pollution capability detection

Reference treatment: the Auricularia polytricha strains on the market were collected and cultured according to the isolated culture method of the collected fruiting bodies in example 1: inoculating tissue blocks of the collected fruiting body in the super-fungus table through a medium-enriched inclined-plane test tube, culturing in dark at 25 ℃ for 7 days for purification, culturing for about 14 days, selecting test tubes with good growth vigor, preparing culture strains, culturing at 25 ℃, and culturing to obtain mushroom after fungus bags grow fully.

The steps 1-4 in example 8 are repeated according to the treatment mode of treatment group 1 to obtain treatment group 2 and R of treatment group 2, wherein the auricularia polytricha strain with the best characteristics (the best characteristics are that hyphae grow fastest and vigorous and the cultivation yield is high) when the auricularia polytricha is selected ₁ 4.2cm，R _CK 4.5cm；

Compared with the existing auricularia polytricha strain, the auricularia polytricha ZJFME001 provided by the application has a better anti-mildew effect, and can effectively inhibit the growth of mildew.

The bacteriostasis rates of the strains in example 8 and comparative example were calculated as follows: antibacterial ratio = R _CK -R ₁ /R _CK The obtained auricularia polytricha ZJFME001 has a bacteriostasis rate of 22.2% and a control market auricularia polytricha strain of 6.7%.

The above example 5 shows that the strain ZJFME001 of Auricularia auricula-judae of the invention is not easy to pollute and has high antibacterial rate.

Example 9 preparation method of Auricularia auricula-judae ZJFME001 dried product

The agaric ZJFME001 harvested in example 3 was dried for 10 hours using a mushroom dryer set to a temperature of 90 ℃ to produce a dried product.

And (3) determination of a rehydration ratio: 1kg of the obtained dry product is weighed, immersed in warm water for 4 hours at room temperature, the weight of the rehydrated product is measured, the rehydration of the dry product is repeated 10 times, the average value is 9.4kg, and the rehydration ratio of the dry product=the weight of the rehydrated product/the weight of the dry product, so that the rehydration ratio of the dry product is obtained. The results obtained were: 9.4 times.

EXAMPLE 10 preparation method of auricularia auricula ZJFME001 dried product

The agaric ZJFME001 harvested in example 3 was dried for 6 hours using a mushroom dryer set to a temperature of 120 ℃ to produce a dried product.

And (3) determination of a rehydration ratio: 1kg of the obtained dry product is weighed, immersed in warm water for 4 hours at room temperature, the weight of the rehydrated product is measured, the rehydration of the dry product is repeated 10 times, the average value is 9.6kg, and the rehydration ratio of the dry product=the weight of the rehydrated product/the weight of the dry product, so that the rehydration ratio of the dry product is obtained. The results obtained were: 9.6 times.

Comparative example 2 determination of dried Auricularia polytricha

After the dried auricularia polytricha obtained in comparative example 1 was obtained by the method in example 9, the same quality auricularia polytricha was used to obtain a dried auricularia polytricha, and the same conditions were used to carry out rehydration, and the rehydration ratio of the dried auricularia polytricha was measured, and the average value of the obtained results is: 8.3 times.

From the rehydration rate results obtained in comparative example 2 and example 9, it is known that the rehydration ratio of the auricularia polytricha ZJFME001 provided by the application is higher than that of the auricularia polytricha dry product of the existing variety.

Example 11

The difference from example 2 is that the fermentation time is 12 days.

Although the present invention has been described with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications may be made to the embodiments described, or equivalents may be substituted for elements thereof, and any modifications, equivalents, improvements and changes may be made without departing from the spirit and principles of the present invention.

Claims (10)

1. A pink auricularia polytricha ZJFME001 strain, characterized in that the pink auricularia polytricha strain (Auricularia cornea) ZJFME001 strain has a deposit number of: CGMCC No.:40900, the gene sequence is SEQ ID: no.1.

2. The pink auricularia polytricha ZJFME001 strain according to claim 1, wherein the foaming rate is 9-10 times;

preferably, the crude polysaccharide content in the fresh food of the auricularia polytricha ZJFME001 strain is 9.20g/100g; fat content is 0.4g/100g; selenium content is 0.023mg/kg; iron content was 30.4mg/kg; the potassium content is 1096mg/100g; sodium content is 40.2mg/100g; the calcium content is 212mg/kg; zinc content is 9.4mg/kg; the ergosterol content is 0.553mg/g; the total amount of amino acid is 6.35g/100g.

3. A process for preparing a fermentation broth of the strain ZJFME001 of auricularia polytricha in pink according to claim 1 or 2, comprising the steps of:

inoculating the pink auricularia polytricha ZJFME001 strain into the sterilized liquid culture medium, and shaking-culturing at 25 ℃ for 6-12 days to obtain ZJFME001 strain liquid.

4. A method according to claim 3, characterized in that the liquid medium used consists of 5g of bean flour, 3g of corn flour, 3g of peptone, 20g of glucose, 1g of magnesium sulfate, 2g of dipotassium hydrogen phosphate;

preferably, the sterilization condition of the liquid culture medium is 121 ℃ and 0.15Mpa for 30min;

preferably, the strain is inoculated in an amount of 1% or more by volume of the liquid medium.

5. A method for the industrial cultivation of the pink auricularia polytricha ZJFME001 strain according to claim 1 or 2, characterized by comprising the following steps:

1) Filling cultivation materials in the cultivation bags, sterilizing, inoculating ZJFME001 strain, and performing dark cultivation for 20-25 days under the conditions of 17-20 ℃ and 50-60% of air humidity;

2) After hypha grows fully, fruiting management is carried out, and cultivation is continued for 5-7 days at the temperature of 24-26 ℃ under the air humidity of 80% -85%;

3) When primordia grow, the humidity is increased to 90% -95%, the illumination is started for 2-3 hours and stopped for 1-2 hours at 24-26 ℃, the culture is continued for 10-20 days, and the pink auricularia polytricha ZJFME001 strain is obtained.

6. The method of claim 5, wherein the cultivation material comprises 70 parts of wood chips, 15 parts of cotton seed hulls, 13.9 parts of wheat bran, 0.5 part of gypsum, 0.5 part of lime and 0.1 part of potassium dihydrogen phosphate.

7. The method of claim 5, wherein the cultivation material comprises 19 parts of corncob, 40 parts of cotton seed hulls, 30 parts of wood chips, 10 parts of wheat bran and 1 part of gypsum.

8. The method of claim 5, wherein the size of the bags is 5 x 18 x 35cm or 5 x 15 x 55cm.

9. The method of claim 8, wherein when the size of the cultivation bag used is 5 x 18 x 35 cm; the inoculation step is to punch 4 holes on the surface of the cultivation bag, inoculating 5-10 ml of fermentation liquor of pink auricularia polytricha ZJFME001 strain in each hole, and sticking a breathable film on the surface of each hole for sealing after inoculation;

after hypha grows fully in fruiting management, a single-side opening or two-head fruiting mode is adopted;

preferably, when the size of the cultivation bag is 5 x 15 x 55cm, the inoculation step is inoculation at the cultivation bag mouth;

and (3) after hypha grows fully in fruiting management, punching by using a puncher, and adopting a small-hole hanging bag cultivation mode.

10. A method for drying the pink auricularia polytricha ZJFME001 strain according to claim 1 or 2, comprising the following steps: and (3) drying the collected pink auricularia polytricha ZJFME001 mushroom at 90-120 ℃ for 6-10 hours to obtain a auricularia polytricha dry product.