CN117701570A - Preparation method and application of liver cancer cell model with high migration level - Google Patents

Abstract

The invention discloses a preparation method and application of a liver cancer cell model with high migration level. The invention provides LncMER52D, and the nucleotide sequence of the LncMER52D is sequence 1. The application of LncMER52D in preparing liver cancer cell models for screening liver cancer drugs is also provided; the liver cancer cell model is a cell model with increased migration and/or invasion levels. The invention discovers LncMER52D, after being over-expressed, the LncMER52D can improve migration and/or invasion of liver cancer cells, and a liver cancer cell model with high migration level is obtained and is used for screening liver cancer drugs.

Description

Preparation method and application of liver cancer cell model with high migration level

Technical Field

The invention belongs to the technical field of biology, and relates to a preparation method and application of a liver cancer cell model with high migration level.

Background

Hepatocellular carcinoma (hepatocellular carcinoma, HCC) is one of the common malignancies, with global morbidity in the sixth place and mortality in the third place, next to lung and colorectal cancer. In China, the death rate of the liver cell cancer is second to that of the lung cancer, and the number of the liver cancer dead per year is about 38.3 ten thousand, which accounts for more than 50% of the world liver cancer death number. And according to epidemiological investigation and statistics, new cases of Chinese liver cancer are still increasing.

The main causes of HCC include excessive drinking, aflatoxin B1 contamination, and chronic infection with hepatitis B or c virus, among others. In recent decades, although HCC has made great progress in surgery, radiotherapy and chemotherapy, molecular targeted therapy, etc., the current situation of poor prognosis of HCC patients has not been fundamentally changed due to its high invasion, high metastasis and high recurrence. The exact molecular mechanism that causes the occurrence and development of liver cancer is not completely known at present. Thus, the study of the mechanisms of HCC development and the search for effective early diagnostic and therapeutic biomarkers is now an important research direction for HCC.

HERVs are residues of retroviruses inherited to date in a Mendelian manner that infect humans in ancient times and integrate into the host genome, accounting for about 8% of the human genome. HERV can be divided into three families, which are: class I family is a gamma retrovirus like element; class II family is a β retrovirus-like element, also known as HERV-K superfamily; class III family is a foamy virus like element, a foamy virus like element. A complete HERVs genome structure comprises long terminal repeats at both ends, simply LTRs, which typically contain functional regulatory elements such as promoters, enhancers, transcription factor binding sites, and four intermediate open reading frames (gag, pro, pol, env). The gag gene encodes matrix, capsid and nucleocapsid elements, the pro gene encodes protease, the pol gene determines the production of reverse transcriptase and integrase, and the env gene encodes surface and transmembrane proteins, which are capable of encoding retroviral-like particles. Most HERVs elements in the human genome have lost the complete open reading frame and the ability to package viral particles due to mutation, insertion, deletion and rearrangement, but these residual gene fragments still play an important functional role.

The functions exerted by HERVs can be largely divided into physiological and pathological functions. A large number of researches show that HERVs have important physiological functions, can maintain the pluripotency of cells, and are involved in the development of embryos and the formation of the placenta. Furthermore, studies have shown that aberrant activation of HERVs is associated with a variety of diseases, and in particular, has been shown to be closely related to the occurrence of a variety of cancers.

Long non-coding RNA (IncRNA) refers to RNA transcripts that are greater than 200 nucleic acids in length and do not function to encode proteins. LncRNAs lack a complete open reading frame and cannot encode proteins, which were once thought to be "noise" and "garbage" generated during genome transcription and are not considered important. However, more and more researches in recent years show that LncRNAs have a variety of other important molecular functions in cells, and can regulate the expression of genes at the epigenetic level, the transcriptional and posttranscriptional levels, and participate in pathological and physiological processes of organisms through 4 actions of signals, baits, guidance, scaffolds and the like.

More and more LncRNAs are found to be aberrantly expressed in tumors, and become new hot spots for current tumor research due to their important role in tumorigenesis and development. LncRNAs participate in the processes of tumor cell growth, apoptosis, migration, invasion and the like, and play roles of oncogenes or tumor suppressor genes in the processes of tumor generation and development. lncRNAs can be used as biomarkers for tumor diagnosis and prognosis prediction, for example: MALAT1 is the first lncRNA found to be associated with metastasis and was initially found in lung adenocarcinoma tissue. Many studies have shown that MALAT1 is highly expressed in a variety of cancers, including liver cancer, non-small cell lung cancer, colorectal cancer, breast cancer, etc., and is closely related to recurrent metastasis of malignant tumor and poor prognosis of patients, and is considered as a oncogene. However, the function and mechanism of action of most LncRNA in liver cancer are not clear yet to be further studied.

Disclosure of Invention

The invention aims to provide a preparation method and application of a liver cancer cell model with high migration level.

In a first aspect, the present invention provides LncMER52D, the nucleotide sequence of which is sequence 1.

In a second aspect, the invention provides an application of LncMER52D or a nucleic acid molecule thereof or a recombinant vector or recombinant bacteria expressing the nucleic acid molecule in the first aspect in preparing a liver cancer cell model for screening liver cancer drugs; the liver cancer cell model is a cell model with increased migration and/or invasion levels.

In a third aspect, the present invention provides the use of LncMER52D or a nucleic acid molecule thereof of the first aspect or a recombinant vector or recombinant bacterium expressing said nucleic acid molecule in any of the following:

1) Preparing a product for promoting migration of liver cancer cells;

2) And preparing a product for promoting liver cancer cell invasion.

In a fourth aspect, the present invention provides a product, the active ingredient of which is LncMER52D or a nucleic acid molecule thereof of the first aspect or a recombinant vector or recombinant bacterium expressing the nucleic acid molecule.

The function of the product described above is at least one of the following:

1) Promoting migration of liver cancer cells;

2) Promoting liver cancer cell invasion.

In a fifth aspect, the present invention provides a method for preparing a liver cancer cell model with increased migration and/or invasion levels, comprising the steps of: introducing the LncMER52D nucleic acid of the first aspect into liver cancer cells to obtain a liver cancer cell model.

The migration and/or invasion levels of the liver cancer cell model described above are higher than those of the liver cancer cells.

Experiments prove that LncMER52D can be used for improving migration and/or invasion of liver cancer cells after being over-expressed, so that a liver cancer cell model with high migration level is obtained, and the LncMER52D is used for screening liver cancer drugs.

Drawings

FIG. 1 shows the electrophoresis pattern of pcDNA 3.1+LncMER52D plasmid.

FIG. 2 shows the fluorescent quantitative PCR detection of LncMER52D expression level.

Fig. 3 shows the function of LncMER52D in scratch experiments.

FIG. 4 shows the function of LncMER52D in Transwell migration and Transwell invasion experiments.

Detailed Description

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Example 1 discovery of LncMER52D fragment

The inventors have found that LncMER52D has a nucleotide sequence of sequence 1 through extensive studies.

Sequence 1:

TCAGCCAGCAGTACAGCCATGGTGCCCACCCCACGAGGGCTCTGGGTTTCTATGCCTCTGGAGGTGGCTCTGCACGTGGTCACTCATGGCTGGGTCCCCAGTTCCACCCTGCATCAGGGTAATGCTGAACCTGAAACTCCCAGTGGCTGGGCCCGGGGCCCGTGATCCACTCCTGGAGGTGCCCCATGGGTAGGACCTTGAGCCAGGTGAGGGTGAGCCCCAGGATGGAGATCACAGTGATGTCGCCCCTGCCCTGGATGCCAGCCTGGGCCCAGCGAGGACTTGGAGCCCTCGGCCCAGGTTGCGAGGGTGTGCGGCCGGGGTTGCATGCTCCATGGAGCCGGCAGGAGCTGGGAGCAGGCAGCAGTCCAAGCTGGGGCTGTGGACCCAGGCCTCCCTCTGCTCTTGGGGGTTGGGAGCGGGCAGGAGCCCTGCCCATCCCCAGGCACAGCTGCAACTGCCCAAGTCAGTGCTGTGGACCTAGGCATCTCTGTACTCTTTGGGACCTGGGAAGGGCCCCCACCCCGGGCCTGCAGGCTCAGAAGTGCCTGCTCCCACTGCCTGGTTTCTCCTCACTGTTAGTGCCTGCTCCTATCTTGGAGCAATGTGGGGCAGAGCCCAGGTGCTGTCACAGCCTGGCCAGAGGTGCACATGCTTGGGACAGCACTGACACAACAGCCCCCTGTCGCCTTGATCCCCTCTGGATTTTGGGCACCAAGAAGCACAAGAGGGAGCCAAAGAGGGTGCTGAGGACAGCCTGGCACTGGCCTGCAGTTGCCACTTGGTGCAAGCAGCCTGGGTACCATGGACTGCTACACGGACTGCTGCAGGATCCTGGGTGGAAGGGGGCAGGTCCCTGGTGAGGCCCCACCTTCAGGCCAGGGAGGGCCTGAAGGCTGAGGGCTGGGCTTCCAGTCCCATTGACTGAAGTGGGAGCTTGTGGTGCCTTTTCCAGGCCTACCCATGGCTGCCCATGGACCAATCAGCACATGTTTCCTCCCTTTGAGTCCCATAAAAGCCCCAGGATCAGCCAGAACAGAACAGACCATGGGACAACCAGCTGCAGAGAGGAGCTACTCTCTGTGCTAGGAGCTGAACACATGATGGGACACCCTGGCTGCAGAAAGGAGCTGCCCCCTGCAGGATACTGAGCTGTTCTATGACTCACTAAAGCTTCTCTTCATCTTGCTCACCCTTCACTTGTCTGCATATCTCATTCTTCCTAGTTGCAGGACAAGAACTTGGGGCCTGCCGAATGGCAAGGCTAAAAGAACAGTAACACAAACAGGGCTGAAACATGCCCCTTGCTTGCCACATTGTGGGTGAAGGGAAGGAGAGAGGAGCTGTGGCCCTTTGAGGAGCCTAGACCTGGGAACTCCCTGAGCCAGAGCTGTGACTCCCTCTTTGGGGCCCTATGGTTCCTGATGTCTCCGAGCTCCTGGACATCAATGCATTCCCTGGTGATAGCCAGGGAAGCTGCTGTGATGCACCTGGTCCAGCTACACCCTTGCAGAGAGCTGGTGCCCATGCTGCACCTGGAGCTGCCCGTGCCACAGCAGCAGCTGGTGTGTCTGACTGCTCAGTGGCCAGGCCCCACACTTGCTCACACACCCCTCGCTGCTCCACGTATGACTGACAGTCTCCCTTGGAGGCGTGGGATCCAGGTCACTAGCTGAGCGCAGCCTGCCAGTCTGAGTGGGTGGAACAAGCCCAGTGGGCCCTAGCAAAACTTGGGGCAAGGGCACCACTGGCCACAAATTTCCAGCCAGAAAAGCGACACCCCAAAGATCCCATAGCATTATTACATCTTTTTGCCCCTACAATGGGTAAAAGACTATGTTCAAAATTTTCATCATGTTTTGAAATATATTGGTTCTCTTTTGTGCAG

EXAMPLE 2 investigation of LncMER52D fragment function

1. Construction of an overexpression stably transformed cell line of LncRNA of interest

1. Construction of expression plasmid

1) The pcDNA 3.1 (+) plasmid (vast plasmid P0157) was digested simultaneously. The enzyme digestion system is shown in Table 1, and is placed in a water bath kettle at 37 ℃ for enzyme digestion for 4 hours.

Table 1 shows the cleavage system

2) Designing a primer sequence for amplifying the full length of LncMER52D, adding homologous sequences at two ends of a linearization carrier at the 5' end of a forward and reverse amplification primer of LncMER52D, and amplifying from a liver cancer cell (Huh-7) cDNA template. The amplification system is shown in Table 2 below.

Table 2 shows the amplification system

The amplification primer sequences are as follows:

primer F ctagcgtttaaacttaagcttTCAGCCAGCAGTACAGCCATG

Primer R gtaccgtcgactgcagaattcCTGCACAAAAGAGAACCAA

Reaction conditions: heating to 98deg.C for 2min for pre-denaturation; melting at 98 ℃ for 10s; annealing at 60 ℃ for 5s; extending at 72 ℃ for 2min for 40s, wherein the total time is 35 cycles; extending at 72deg.C for 10min, and preserving at 4deg.C. After amplification, the PCR products were detected by electrophoresis using a 1% agarose gel.

3) Cutting glue, recovering and purifying

The enzyme-digested product obtained in 1) and the PCR product obtained in 2) were added to a 6×loading buffer (NEB, B7024S), and electrophoresis was performed at a voltage of 100V for a duration of 40min. The area containing the target band was excised and placed into a 1.5mL centrifuge tube. The band of interest was purified according to the instructions provided by Wizard gel and PCR product purification kit (Promega, A9282) and finally eluted by the addition of 30. Mu.L of Nuclease-Free Water. Collecting the purified product, and preserving at-20 ℃ to obtain the pcDNA 3.1 (+) vector after enzyme digestion and the amplified target fragment LncMER52D.

4) The amplified target fragment LncMER52D obtained in 3) and the digested pcDNA 3.1 (+) vector were ligated according to the ligation system shown in Table 3. Connecting in a water bath kettle at 37 ℃ for 30min.

Table 3 shows the connection system

5) 10. Mu.L of the above-mentioned ligation product was added to 50. Mu.L of Stbl3 competent cells, and the mixture was subjected to manipulations as indicated in the instructions of competent cells (full gold, CD 521-01), after 16 hours, the plate was observed for the presence of colonies, and single colonies at the edges were picked up and placed in a disposable sterilized shaking tube, 5mL of LB liquid medium containing ampicillin antibiotics was previously added thereto, and the shaking tube was placed in a shaking table and shake-cultured overnight at 37℃and 200 rpm/min.

6) 100. Mu.L of the bacterial liquid was aspirated to extract the plasmid.

The result of the electrophoresis test is shown in FIG. 1, and all 3 lanes are the extracted plasmids.

The extracted plasmid was sent to sequencing, which was obtained by replacing the fragment between HindIII and EcoRI cleavage sites of pcDNA 3.1 (+) vector with the coding nucleic acid (sequence 1) of LncMER52D fragment, and was named pcDNA 3.1+LncMER52D.

2. Plasmid transfection

1) The Huh-7 cells (Punocai, CL-0120) concentration was appropriately adjusted using DMEM medium (Thermo Fisher Scientific, 2186870) containing 10% fetal bovine serum (Thermo Fisher Scientific, 26010074) and no diabody, and 12-well plates were inoculated with 1mL and left for 24h to give a cell confluency of about 90%.

2) The plasmid pcDNA 3.1+LncMER52D (concentration: 1235 ng/. Mu.L) obtained in the above 1 was diluted with 50. Mu.LOpti-MEI low serum medium (Thermo Fisher Scientific, 2085152) to obtain a diluted plasmid; mu.L of Lipofectamine 2000 (Invitrogen, 200011668-019) was diluted in 50. Mu.L of Opti-MEI low serum medium, gently mixed and incubated at room temperature for 5min to give diluted Lipofectamine 2000.

3) The diluted plasmid obtained in the above 2) and Lipofectamine 2000 were mixed (total volume: 100. Mu.L, gently mixed, and left at room temperature for 20min to obtain a transfection solution.

mu.L of the transfection solution was added to each well of the well plate obtained in 1), and the mixture was gently shaken. DMEM medium containing 10% fetal bovine serum and 1% pen-Strep double antibody (Thermo Fisher Scientific, 2199828) was changed 6h after transfection.

4) G418 screening was performed 48h after transfection.

3. G418 screening of stably transfected cell lines

Cells were passaged 48h after transfection. DMEM complete medium containing 400. Mu.g/mL G418 (Gibco, 10131027) was added and screened for 1 week with 2-day changes. And (3) freezing the screened cells in liquid nitrogen for preservation to obtain a stable transgenic cell line Huh-7-LncMER52D.

In the same manner, huh-7 cells were transfected with the empty vector pcDNA 3.1 (+) to obtain the control cell line Huh-7-3.1+.

2. Fluorescent quantitative PCR (polymerase chain reaction) verification of stably transfected cell line

Fluorescent quantitative PCR was performed on the stably transfected cell line Huh-7-LncMER52D obtained above and the control cell line Huh-7-3.1+ to detect the expression level of LncMER52D. The method comprises the following specific steps:

1. total RNA extraction

RNA extraction was performed using MiniBEST Universal RNA Extraction Kit (TAKARA, 9767) as follows:

1) Cells to be tested on the 12-well plate were aspirated from the culture and washed once with 1 XPBS. Then 350. Mu.L of lysis Buffer RL (50 XDT Solution was added) was added to the cultured cells, and the cells were left horizontally for a while to uniformly distribute the lysate on the cell surface and lyse the cells, and then the cells were blown off by a pipette. And finally transferring the lysate containing cells into a centrifuge tube, repeatedly blowing and sucking by using a pipetting gun until no obvious precipitate exists in the lysate, and standing the lysate at room temperature for 2min.

2) gDNA Eraser Spin Column was placed on a 2mL collection tube. The lysate was transferred into gDNA Eraser Spin Column. Centrifuge at 12000rpm for 1min.

3) gDNA Eraser Spin Column is removed. The filtrate in a 2mL collection tube was retained. 350. Mu.L of 70% ethanol was added and the solution was mixed well using a pipette.

4) The mixture was immediately transferred in its entirety into RNA Spin Column (collection tube containing 2 mL). Centrifuge at 12000rpm for 1min, discard the filtrate. RNA Spin Column was returned to the 2mL collection tube.

5) mu.L of Buffer RWA was added to RNA Spin Column, centrifuged at 12000rpm for 30s, and the filtrate was discarded. 600. Mu.L of Buffer RWB was added to RNA Spin Column, centrifuged at 12000rpm for 30s, and the filtrate was discarded. 600 μl of Buffer RWB was added to the RNA Spin Column again, centrifuged at 12000rpm for 30s, and the filtrate was discarded.

6) RNA Spin Column was re-placed on a 2mL collection tube and centrifuged at 12000rpm for 2min. The RNA Spin Column was placed in a 1.5mL centrifuge tube, 70. Mu.L of RNase Free dH2O was added to the center of the RNA Spin Column membrane, and the mixture was allowed to stand at room temperature for 5 minutes. RNA was eluted by centrifugation at 12000rpm for 2min. The collected RNA was stored in a-80℃refrigerator.

2. cDNA Synthesis

Using PrimeScript ^TM RT reagent Kit with gDNA Eraser (TAKARA, RR 047A) cDNA synthesis is carried out as follows:

1) Genomic DNA removal reaction

The reaction system was prepared on ice as follows: 5X gDNA Eraser Buffer. Mu.L, gDNA Eraser 1. Mu.L, total RNA 5. Mu.L, RNase Free dH2O up to 10. Mu.L. Placing the reaction system in a PCR instrument at 42 ℃ for 2min; preserving at 4 ℃.

2) Reverse transcription reaction

The reaction system was prepared on ice as follows: 10. Mu.L of the reaction solution, primeScript RT Enzyme Mix I. Mu.L of the reaction solution, 1. Mu.L of RT primer Mix, 5X PrimeScript Buffer. Mu.L of RNase Free dH2O 4. Mu.L. The reaction conditions were as follows: 42 ℃ for 15min;85 ℃,5s; preserving at 4 ℃.

3. Fluorescent quantitative PCR detection

The obtained cDNA synthesized by different monoclonal cells was diluted 5-fold with RNase Free water. Fluorescent quantitative PCR assays were performed according to the following primers:

MER52D-F：TCTTCATCTTGCTCACCCTTCAC；

MER52D-R：GCTCGGAGACATCAGGAACCAT；

β-actin-F：CCACGAAACTACGTTCAACTCC；

β-actin-R：GTGATCTCCTTCTGCATCCTGT。

the reaction system is as follows: TB Green Premix Ex Taq (2X) 10. Mu.L, primer F (10. Mu.M) 0.4. Mu.L, primer R (10. Mu.M) 0.4. Mu. L, cDNA template 2. Mu.L, RNase Free water 7.2. Mu.L.

The reaction conditions were as follows: heating to 95 ℃ for 30s of pre-denaturation; melting at 95 ℃ for 5s; annealing at 60 ℃ for 20s; a total of 40 cycles; extending at 72deg.C for 3min, and preserving at 4deg.C.

4. Data processing

3 complex holes of each group of samples are repeated, 3 independent detection is carried out respectively, beta-actin is taken as an internal reference gene, and the relative expression quantity of each sample is obtained through a 2-delta CT calculation method. The normalized data of each group were analyzed by single factor variance analysis using GraphPad Prism 8.0 and plotted. P <0.05 was significantly different.

As shown in FIG. 2, the result of the fluorescent quantitative PCR detection of the expression level of LncMER52D shows that the expression level of LncMER52D in the stably transfected cell line Huh-7-LncMER52D (shown as LncMER52D in the figure) is higher than that of the control cell line Huh-7-3.1+ (shown as pcDNA 3.1+), indicating that the stably transfected cell line Huh-7-LncMER52D is a stably expressed cell line over-expressing the LncMER52D gene. The differences were statistically significant (P < 0.001).

3. Stable transfected cell line phenotype validation

1. Scratch test

1) Firstly, uniformly scribing transverse lines in a 12-hole plate by using a marker pen, wherein the total number of the transverse lines is 3, and the transverse lines cross through holes;

2) The cell line Huh-7-LncMER52D and the cell Huh-7-3.1+ of the negative control group of the cell line Huh-7-LncMER52D which is stably over-expressed after the two identification are paved in a 6-well plate;

3) When the coverage rate of the waiting cells reaches 99%, scribing is carried out on the bottom of the 12-hole plate by using a gun tip of a 200uL gun head, the used force is as consistent as possible, and a straight line with a relatively consistent width is scribed at one time;

4) Washing each scratched hole with PBS for 3 times, adding fresh culture medium after washing, and then photographing under a microscope;

mobility= (initial scratch area-24 h scratch area)/initial scratch area

Migration area ratio = mobility of experimental group/mobility of control group

The experimental group is a cell line Huh-7-LncMER52D which stably overexpresses LncMER52D, and the control group is a negative control group cell Huh-7-3.1+.

The results of the scratch experiments are shown in FIG. 3, the left graph is a photograph, and the right graph is a statistical graph of the migration area ratio, and it can be seen that the migration ability of the stably transformed cell line Huh-7-LncER 52D (shown as LncER 52D) is significantly enhanced (P < 0.001) compared with the control cell line Huh-7-3.1+ (shown as pcDNA 3.1 (+)).

2. Transwell migration experiment

1) The stably transformed cell line Huh-7-LncMER52D and the control cell line Huh-7-3.1+ (denoted as pcDNA 3.1+) in the T75 flask were removed from the incubator and observed under a microscope for cell morphology and density, and when the cell density reached about 90%, the cell morphology was good and the edges were clear and high, the cells were digested with cell digests (Invitrogen, 11668-019).

2) After digestion, the treated cells were collected by centrifugation at 1500rpm, the supernatant was discarded, resuspended in 1ml PBS, the supernatant was discarded by centrifugation again, the cells were gently and evenly blown with 500. Mu.L of medium without serum and without diantigen, 50. Mu.L was aspirated to measure the cell density, and the cell density was adjusted to 2X 10. Sup.5.

3) 600. Mu.L of medium containing 10% serum was added to a 24-well plate (Corning, 3422) well.

4) The Transwell chamber was placed in the well, taking care that no air bubbles could exist between the membrane at the bottom of the Transwell chamber and the medium.

5) 200. Mu.L of the cell suspension with the adjusted cell density was added to the Transwell chamber, and the plates were placed in a cell incubator for culturing for 24 hours.

6) After culturing for 24 hours, the cells in the cells were removed, rubbed off with a cotton swab, and rinsed 3 times with PBS.

7) The cells were placed in 4% tissue cell fixative (Solebao, P110) and fixed for 30min.

8) After fixation, the cells were removed and stained with 1% crystal violet staining solution (soribao, G1062) for 20min.

9) The Transwell upper chamber was washed 3 times with double distilled water, the background staining of crystal violet was washed off, dried and observed under a microscope. Randomly selecting 5 visual fields for photographing, and counting the number of stained penetrating cells (namely the number of migration cells).

As shown in the migration chart and the middle chart of FIG. 4, it can be seen that the stably transfected cell line Huh-7-LncMER52D (shown as LncMER 52D) has significantly increased number of migrating cells (P < 0.001) compared to the control cell line Huh-7-3.1+ (shown as pcDNA 3.1+) in the chart.

3. Transwell invasion assay

1) Coating a substrate film: 50mg/L Matrigel was incubated with serum-free DMEM/F at 1:99 dilution on the upper surface of the transwell cell bottom membrane (the whole procedure was noted on ice, otherwise Matrigel would solidify above 10 ℃), in a cell incubator for 1h, and the supernatant was aspirated.

2) The stably transformed cell line Huh-7-LncMER52D and the control cell line Huh-7-3.1+ (denoted as pcDNA 3.1+) in the T75 flask were removed from the incubator and observed under a microscope for cell morphology and density, and when the cell density reached about 90%, the cell morphology was good and the edges were clear and high, the cells were digested with cell digests (Invitrogen, 11668-019).

3) After digestion, the treated cells were collected by centrifugation at 1500rpm, the supernatant was discarded, resuspended in 1ml PBS, the supernatant was discarded by centrifugation again, the cells were gently and evenly blown with 500. Mu.L of medium without serum and without diantigen, 50. Mu.L was aspirated to measure the cell density, and the cell density was adjusted to 2X 10. Sup.5.

4) 600. Mu.L of medium containing 10% serum was added to a 24-well plate (Corning, 3422) well.

5) The Transell chamber was placed in the well, taking care that no air bubbles could exist between the membrane at the bottom of the Transell chamber and the medium.

6) 200. Mu.L of the cell suspension with the adjusted cell density was added to the Transwell chamber, and the plates were placed in a cell incubator for culturing for 24 hours.

7) After culturing for 24 hours, the cells in the cells were removed, rubbed off with a cotton swab, and rinsed 3 times with PBS.

8) The cells were placed in 4% tissue cell fixative (Solebao, P110) and fixed for 30min.

9) After fixation, the cells were removed and stained with 1% crystal violet staining solution (soribao, G1062) for 20min.

10 Washing the Transwell upper chamber with double distilled water for 3 times, washing off the background dyeing of crystal violet, and observing under a microscope after airing. Randomly selecting 5 visual fields for photographing, and counting the number of stained penetrating cells (namely the number of invasive cells).

As shown in the left and right panels of FIG. 4, the stably transfected cell line Huh-7-LncMER52D (shown as LncMER 52D) had significantly increased numbers of invading cells (P < 0.0001) compared to the control cell line Huh-7-3.1+ (shown as pcDNA 3.1+).

Claims (6)

1. LncMER52D has the nucleotide sequence 1.

2. The use of LncMER52D or nucleic acid molecule thereof or recombinant vector or recombinant bacterium expressing the nucleic acid molecule of claim 1 in the preparation of hepatoma cell model for screening hepatoma drugs; the liver cancer cell model is a cell model with increased migration and/or invasion levels.

3. Use of LncMER52D or a nucleic acid molecule thereof or a recombinant vector or recombinant bacterium expressing said nucleic acid molecule of claim 1 in any of the following:

1) Preparing a product for promoting migration of liver cancer cells;

2) And preparing a product for promoting liver cancer cell invasion.

4. A product comprising the LncMER52D or the nucleic acid molecule thereof of claim 1 or a recombinant vector or recombinant bacterium expressing the nucleic acid molecule as an active ingredient.

5. The product according to claim 4, wherein:

the function of the product is at least one of the following:

1) Promoting migration of liver cancer cells;

2) Promoting liver cancer cell invasion.

6. A method of preparing a liver cancer cell model with increased levels of migration and/or invasion comprising the steps of: introducing the LncMER52D nucleic acid of claim 1 into a liver cancer cell to obtain a liver cancer cell model.