CN115927643A - Application of hsa _ circ _0001495 molecule in liver cancer treatment - Google Patents

Abstract

The invention belongs to the field of biological medicine, and relates to application of a circular RNA hsa _ circ _0001495 in liver cancer treatment, in particular to application of an hsa _ circ _0001495 molecule as a diagnosis marker in liver cancer treatment or application as a target in research and development of anti-cancer drugs; the hsa _ circ _0001495 molecule is a circRNA molecule highly expressed in liver cancer tissues, and the nucleic acid sequence of the circRNA molecule is SEQ ID NO.1. The products for diagnosing liver cancer comprise a chip, a kit, test paper or a high-throughput sequencing platform and the like. The anti-cancer drugs comprise gene drugs and chemical drugs for inhibiting the expression of hsa _ circ _ 0001495.

Description

Application of hsa _ circ _0001495 molecule in liver cancer treatment

Technical Field

The invention belongs to the field of biological medicines, and relates to application of an hsa _ circ _0001495 molecule in liver cancer treatment, in particular to application of the hsa _ circ _0001495 molecule as a diagnosis marker in liver cancer treatment or application as a target in research and development of anti-cancer drugs.

Background

Primary liver cancer is one of the most common malignant tumors in clinic, and the incidence rate is the fourth of the malignant tumors. Hepatocellular carcinoma is the most common one of primary liver cancers, accounting for about 85% -90%. Surgical resection, radiotherapy and chemotherapy are the most common means of treating liver cancer, but have limited effect on middle and late stage liver cancer patients. A large number of clinical results prove that the survival period of the liver cancer patient for early diagnosis and proper treatment is longer than that of the patient for diagnosis and treatment after the relevant symptoms appear. Therefore, the method is very important for early screening and prognosis judgment of liver cancer patients. The molecular mechanism of liver cancer is searched, and a new therapeutic target and means are searched, which has important significance for the clinical treatment of liver cancer.

Circular RNA (circular RNA) is a kind of non-linear single-stranded non-coding RNA, and the heads and the tails of the circular RNA are combined through covalent bonds to form a closed circular structure. The circular structure of the circRNA is not easily degraded by exonuclease, so that the circular structure is more stable and has longer half-life. circRNA is abundant, conserved, stably expressed in saliva, blood and exosomes, and exhibits tissue developmental stage specificity, which makes it promising as a cancer biomarker. In recent years, a number of studies have shown that circRNA plays an important role in the process of tumor development. The document (Gu Y, wang Y, he L, et al. Circular RNA circular IPO11 drive self-reverse of liver initiating cells via Hedgehog signaling [ J ]. Mol Cancer,2021,20 (1): 132) found that circular IPO11 is highly expressed in liver Cancer tumor tissue, and that circular IPO11 triggers its transcription by recruiting TOP1 to GLI1 promoters, leading to activation of the Hedgehog signaling pathway, driving self-renewal of liver CSCs, and promoting liver Cancer progression. Furthermore, huang et al (Huang G, liang M, liu H, et al, circRNA hsa _ circRNA _104348 proteins hepatocellular cancer promotion and modulation miR-187-3p/RTKN2 a and activivating Wnt/beta-catenin pathway [ J ]. Cell Death Dis,2020,11 (12): 1065) found that hsa _ circRNA _104348 is also significantly up-regulated in liver cancer tissues and cells, has _ circ _104348 directly targets miR-187-3p to promote proliferation, migration and invasion of liver cancer cells, and simultaneously inhibits apoptosis of liver cancer cells. The research results show that the circRNA is related to metastasis, recurrence, survival and the like of the liver cancer patient and is a promising marker for diagnosis and prognosis of the liver cancer patient. In addition, in the case of the circRNA, a complex signal path and a series of chain reactions which influence the regulation and control of liver cancer progress also need to be deeply excavated, so that theoretical guidance is provided for further exploring the pathogenesis of liver cancer.

We find that the novel circRNA is highly expressed in liver cancer tissues and blood, and the novel circRNA can inhibit the tumorigenicity of liver cancer cells through targeted regulation and control. Experimental results show that the novel circRNA is a potential molecular marker for early diagnosis and prognosis of liver cancer, is also an important molecular target for targeted therapy of liver cancer, and has important clinical significance for treatment of liver cancer.

Disclosure of Invention

In order to realize the purpose of the invention, the invention provides application of the hsa _ circ _0001495 molecule as a diagnostic marker in liver cancer treatment or as a target in research and development of anti-cancer drugs.

The hsa _ circ _0001495 molecule is a circRNA molecule highly expressed in liver cancer tissues, the nucleic acid sequence of the circRNA molecule is SEQ ID NO.1, and the specific information is as follows:

AATAATTGTGTGCCCAAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAAATGTACCCTCCAGAAATTGGTGACTTTGCTTTTGTGACTGACAACACTTATACTAAGCACCAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAACTTTGGTCTGGGTCGGCCTCTACCTTTGCACTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTCGAGCAA CATACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTATGACATGGTGCACTTTCCTCCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAAATTCTGGATAATGGTGAATGG。

the invention provides an application of hsa _ circ _0001495 molecules as diagnostic markers in preparing products for diagnosing liver cancer. As a preferable technical scheme of the invention, the product for diagnosing the liver cancer at least comprises a PCR amplification primer used for detecting the expression quantity of hsa _ circ _0001495 by using SYBR Green, a TaqMan probe, a double-hybrid probe or a composite probe.

In a specific embodiment of the present invention, the specific information of the sequences of the PCR amplification primers is as follows:

Forward primer TGGTGAATGGAATAATTGTGTGCC

Reverse primer AGGAAGTGCAAAGGTAGAGGC

furthermore, the products for diagnosing liver cancer comprise a chip, a kit, test paper or a high-throughput sequencing platform and the like; the preparation method of the product is a technical method known to the person skilled in the art.

The kit comprises a reagent for detecting the expression amount of hsa _ circ _0001495, wherein the reagent comprises a nucleic acid combined with hsa _ circ _0001495 or a DNA sequence thereof, and the nucleic acid comprises SYBR Green, taqMan probe, molecular beacon, double-hybrid probe or PCR amplification primer used when a composite probe detects the expression amount of hsa _ circ _ 0001495.

The chip comprises a reagent for detecting the expression level of hsa _ circ _0001495, wherein the reagent comprises a nucleic acid combined with hsa _ circ _0001495 or a DNA sequence thereof, and the nucleic acid comprises a probe capable of detecting the expression level of hsa _ circ _ 0001495.

The test strip comprises a reagent for detecting the expression level of hsa _ circ _0001495, wherein the reagent comprises a nucleic acid combined with hsa _ circ _0001495 or a DNA sequence thereof, and the nucleic acid comprises a probe capable of detecting the expression level of hsa _ circ _ 0001495.

As another invention point of the invention, the invention also provides the application of the hsa _ circ _0001495 molecule as a target in the development of anti-cancer drugs.

As a preferred technical scheme of the invention, the anti-cancer drugs comprise gene drugs and chemical drugs, such as inhibitors, which inhibit the expression of hsa _ circ _ 0001495.

Further, the inhibitor is not limited as long as it can inhibit the expression level of hsa _ circ _0001495 or inhibit the functional activity of hsa _ circ _ 0001495.

The inhibitor comprises hsa _ circ _0001495 molecules, repressible transcription regulatory factors or repressible targeted small molecule compounds.

The gene medicine or chemical medicine produced by the invention can be applied to one or more of liver cancer, lung cancer, colorectal cancer, gastric cancer, breast cancer and the like.

The gene medicine or chemical medicine comprises a pharmaceutically acceptable carrier in a clinically acceptable form.

Compared with the prior art, the invention has obvious technical effect

The hsa _ circ _0001495 molecule provided by the invention is abnormally and highly expressed in liver cancer tissues and blood, is related to the malignancy degree of tumors, and can be used as a marker for auxiliary diagnosis of liver cancer. In addition, experiments prove that the overexpression of hsa _ circ _0001495 can obviously promote the proliferation and invasion and migration of the liver cancer cells, and the knock-down of hsa _ circ _0001495 can obviously inhibit the invasion and migration of the liver cancer cells and can be used as a potential target spot for treating liver cancer.

Drawings

FIG. 1: hsa _ circ _0001495 is a circular RNA. Wherein, FIG. A is a schematic structural view of hsa _ circ _ 0001495; panel B shows the sequencing results for hsa _ circ _0001495 showing the linker sites; panel C shows the PCR results of hsa _ circ _0001495 in different liver cancer cell lines; panel D shows FISH experiments that hsa _ circ _0001495 is distributed mainly in the cytoplasm.

FIG. 2: detecting the expression level of hsa _ circ _0001495 in the clinical specimen. Wherein, the graph A is a graph of the detection result of the expression level of hsa _ circ _0001495 in liver tissue and liver cancer tissue of a liver cancer patient; FIG. B is a graph showing the results of measuring the expression level of hsa _ circ _0001495 in liver tissues and liver cancer tissues of liver cancer patients at different pathological stages, wherein Normal represents the liver tissues, and I, II, III, and IV represent the different pathological stages of the liver cancer tissues; FIG. C shows the results of measurement of the expression level of hsa _ circ _0001495 in blood of normal persons and in blood of patients with liver cancer; * P < 0.01, p < 0.001.

FIG. 3: after overexpression of hsa _ circ _0001495, proliferation, survival, invasion and migration of the liver cancer cell line SK-HEP-1 were promoted. Wherein, the picture A shows that after the lentivirus transfection, the hsa _ circ _0001495 overexpression is detected by qRT-PCR; FIG. B is a graph showing the results of a cell clone survival experiment; FIG. C is a diagram showing the results of a CCK-8 cell proliferation assay; lv-NC stands for negative control group; FIG. D is a graph showing the results of a transwell cell invasion migration experiment; lv-circ _0001495 represents overexpression set; * p < 0.05, p < 0.01.

FIG. 4: after the hsa _ circ _0001495 is knocked down, the invasion and migration of the hepatoma cell SK-HEP-1 are inhibited. Wherein, the graph A shows the effect of detecting the knockdown of hsa _ circ _0001495 by qRT-PCR; FIG. B is a graph showing the results of a transwell cell invasion migration experiment; si-NC stands for negative control group; si-circ _0001495 represents the knockdown hsa _ circ _0001495 group, p < 0.05, p < 0.01.

Detailed Description

The invention is further described below by way of examples, which include the use of materials and specific sources. It should be understood that these are exemplary only, and are not limiting upon the present invention. Materials of similar or identical nature or function to the reagents, types and models of instruments, or the like, as described below, may be used in the practice of the present invention. Unless otherwise indicated, the reagents used in the present invention may be any suitable commercially available reagent.

Human hepatoma cell line SK-HEP-1: purchased from the national academy of sciences cell bank of the culture Collection; MEM medium: purchased from Invitrogen under catalog number 11965-092; serum: from Gibco, catalog number 10099-141; pancreatin: available from Invitrogen under product catalog number 25300-354; the overexpression plasmid and siRNA of hsa _ circ _0001495 were constructed by Shanghai Jima Biotechnology GmbH. The methods in the following examples are general methods unless otherwise specified.

Example 1 detection of hsa _ circ _0001495 expression by real-time fluorescent quantitative PCR (qRT-PCR)

A schematic of the biological synthesis and structure of hsa _ circ _0001495 is shown in FIG. 1, where hsa _ circ _0001495 is formed by reverse splicing of exon 6,7 of the CCNB1 gene.

1. Collection of clinical samples

The laboratory collected liver cancer tissues and paracancer normal liver tissues of 35 primary liver cancer patients, blood samples of 7 liver cancer patients and blood samples of 6 normal people from Huai river hospital and Kaifeng tumor hospital affiliated to Henan university in 2018. The tissue and blood specimens were snap frozen by liquid nitrogen and transferred to a-80 ℃ freezer. The whole collection and subsequent experimental process meets the medical ethical and moral requirements and strictly follows the confidentiality principle of case data.

RNA extraction and real-time fluorescent quantitative PCR (qRT-PCR)

(1) Extracting RNA

And (3) quickly freezing the taken liver tissue, liver cancer tissue, blood sample and liver cancer cell line by liquid nitrogen, and storing in a refrigerator at-80 ℃ for later use. Taking a proper amount of frozen tissues, adding tri-regent, and cracking cells by using a tissue disruptor; adding BCP layered cell/tissue lysate, centrifuging at 12000g 15min at 4 ℃, transferring the supernatant into a new EP tube, adding 2-protocal (isopropanol) (2-protocal: supernatant = 1), mixing uniformly for 10 times, and standing for 10min to fully separate out RNA; 12000g,10min,4 ℃ centrifugation, abandoning the supernatant, adding 75 percent DEPC ethanol 1ml, washing RNA once, slightly blowing up, 7500g, 5min, 4 ℃ centrifugation; the supernatant was aspirated off, dried on a clean bench for 10min, 20ul of nuclease-free water was added and placed in a 55 ℃ water bath for 10min, after full dissolution, the OD260 and OD280 absorption values were determined, generally considering that A260/A280 between 1.8-2.1 could be initially determined as good total RNA quality, and stored in a-20 ℃ freezer.

(2) RNA reverse transcription cDNA

Sample adding sequence: h ₂ O-RNA-Random hexamer, reaction system is shown in Table 1.

TABLE 1 reaction System

Mixing, micro-separating, and placing the PCR tube in a PCR instrument at 65 deg.C for 5min.

The reaction system is shown in Table 2

TABLE 2 reaction System

After mixing, adding into the PCR tube, mixing and micro-separating. The PCR tube was placed in a PCR instrument at 42 ℃ for 90min and 95 ℃ for 5min. After the reaction, the cDNA was stored in a-20 ℃ refrigerator.

(3) Primer design

Primers for hsa _ circ _0001495 were designed using Primer Express Version3 software as follows:

Forward primer TGGTGAATGGAATAATTGTGTGCC

Reverse primer AGGAAGTGCAAAGGTAGAGGC

(4)real-time PCR

the cDNA was diluted to 4 ng/. Mu.L as a template for the fluorescent quantitative PCR reaction. Amplification was performed on an ABI 7500 fluorescent quantitative PCR instrument using forward primers, reverse primers and 2 XSSYBR Green qPCR mix for hsa _ circ _0001495, the reference gene.

The reaction system is shown in Table 3

TABLE 3 reaction System

The PCR conditions were: 20 seconds at 50 ℃; 10 minutes at 95 ℃;1 minute at 95 ℃;1 minute at 60 ℃ and 40 cycles were repeated; CT values of the sample hsa _ circ _ 0001495/internal reference gene amplification were determined.

3. Data processing and analysis

The ratio of the expression amounts of hsa _ circ _0001495 in liver tissues to that in liver cancer tissue samples was 2 ^-ΔΔCT The method carries out calculation. The specific results are shown in table 4 below:

TABLE 4 fluorescent quantitative PCR detection of expression levels of hsa _ circ _0001495 in liver and liver cancer tissues.

/>

In Table 4, "1-12" is the first stage liver cancer tissue case, "13-20" is the second stage liver cancer tissue case, "21-28" is the third stage liver cancer tissue case, and "28-35" is the fourth stage liver cancer tissue case.

Statistical analysis by SPSS software revealed that hsa _ circ _0001495 has significant differences in expression levels in liver and liver cancer tissues (P < 0.001).

The results are shown in FIG. 2, qRT-PCR results show that hsa _ circ _0001495 is significantly up-regulated in liver cancer tissue compared to normal liver tissue and correlated with liver cancer malignancy. In addition, the expression of hsa _ circ _0001495 in the blood of liver cancer patients is also significantly higher than that of normal persons. Therefore, hsa _ circ _0001495 can be used as a marker for detecting liver cancer.

Example 2 Lentiviral vectors overexpressing hsa _ circ _0001495 promote proliferation, survival, invasion and migration of hepatoma cells

1. Viral vector construction

The cDNA sequence of hsa _ circ _0001495 was inserted into a lentiviral expression vector to construct a viral vector overexpressing hsa _ circ _ 0001495. The sequence map of hsa _ circ _0001495 was provided by the inventors, and the viral vector was constructed by Shanghai Jima science and technology Co., ltd.

2. Cell lines and cell cultures

Taking SK-HEP-1 cells of human hepatoma cell line, culturing with MEM supplemented with 10% fetal calf serum and 1% double antibody based on 5% CO ₂ Culturing at 37 deg.C in incubator.

3. Viral transfection

(1) 18-24 hours before lentivirus transfection, adherent cells were plated at 1X 10 ⁵ The/well was plated in 24-well plates. The number of cells in lentivirus transfection was 2X 10 ⁵ About hole.

(2) The next day, the original medium was replaced with 2ml of fresh medium containing 6. Mu.g/ml polybrene, and an appropriate amount of virus suspension was added. Incubation was performed at 37 ℃.

(3) The culture was continued for 24 hours, and the virus-containing medium was replaced with fresh medium.

(4) And observing the fluorescence expression condition 72-96 h after infection.

(5) The cells were expanded in 12-well plates and cultured by selection with a medium containing 0.8. Mu.g/ml puromycin.

(6) The cells screened by puromycin are subjected to amplification culture, and after a part of cells are collected, the over-expression effect is detected by fluorescence quantitative PCR.

The qRT-PCR results of figure 3 show that the effect of lentiviral infection over-expressing hsa _ circ _0001495 (panel a) is significant.

4. Clone survival assay

(1) And (4) taking the cells of the experimental group and the control group for digestion and centrifugation, resuspending the cell sediment, and counting.

(2) The cell suspension is diluted to 150 cells/mL in an equal proportion gradient mode, 2mL of cell suspension is added into each hole of a 6-hole plate, 3 multiple holes are arranged, and the cell suspension is placed in a cell culture box for culture.

(3) After culturing for about two weeks, colonies of cells visible to the naked eye grew out. Washing with PBS for 3 times, fixing with 75% ethanol for 5min, discarding 75% ethanol, and air drying. 1mL of crystal violet staining solution was added to stain for 0.5h. The crystal violet staining solution was removed, washed 2 times with PBS, and the stained cell plates were photographed on white paper.

(4) Colony clone results analysis: colony clone numbers were counted and result trend comparisons were made.

5. Cell proliferation assay

(1) The digestion counts of the control and experimental groups of the stable transfected cells were counted.

(2) Add to 96-well plates labeled at different time points and each set was set with 3 multiple wells at each time point and put into a cell incubator.

(3) After 6h of cell adherence, 10 microliter of CCK-8 solution is added into a 96-well plate in a dark environment for incubation, and after 3h, the cells are taken out and measured on an enzyme-linked immunosorbent assay (ELISA) instrument for OD value at 450 nm.

(4) And measuring the OD values of the target cells at different time points by using the same method on a microplate reader, and drawing a curve according to the average value of the multiple wells at different time points.

Transwell cell migration assay

(1) Digesting and centrifuging the cells, discarding the culture medium, resuspending the cell precipitate with 1mL serum-free DMEM medium containing 0.05% -0.2% BSA, counting, and making the cells into the cells with the density of 2.5 × 10 ⁵ The cell suspension of (3).

(2) The chamber was first moistened with serum-free MEM, 600. Mu.L of empty MEM was placed in a 24-well plate, the chamber was gently placed in the well, and then 200. Mu.L of MEM medium was aspirated and gently dropped into the chamber.

(3) After the chamber is wet, the MEM medium above and below the chamber is discarded. After adding 600. Mu.L of MEM complete medium to a 24-well plate, gently placing the chamber in the well with forceps (without generating air bubbles at the bottom of the chamber), 100. Mu.L of the homogenized cell suspension, i.e., 25000 cells per well, was added dropwise to the chamber, and the plate was placed in an incubator for culture.

(4) The cell is taken out and the result is collected when the cell is cultured for 44h, the cell is firstly placed in a new external 24-plate, the cell is firstly and softly cleaned by PBS for three times according to the standard that the volume of the upper cell is 100 mu L and the volume of the lower cell is 600 mu L, then the cell is placed in 4 percent paraformaldehyde for fixing for 10min, then the cell is cleaned by PBS for three times, finally 0.2 percent crystal violet is used for staining for 20min, after the staining is finished, the slow running water is used for washing and the cotton swab is used for wiping the cells on the upper surface of the cell, then the microscope is used for photographing and observing the condition of the cells transferred to the lower part of the cell, each sample is randomly beaten for 5 times, and the statistics is carried out by calculating the average value.

7. Data processing and analysis

The results were statistically analyzed using SPSS 23.0 software. Graph Pad Prism 7.0 software was used for mapping. Statistical analysis was performed using paired t-tests as appropriate. Data are presented as mean ± standard deviation of at least three independent experiments, with P < 0.05 considered statistically significant.

The results in FIG. 3 show that overexpression of hsa _ circ _0001495 promotes hepatoma cell proliferation, survival, invasion and migration.

Example 3 knockdown of hsa _ circ _0001495 inhibits invasion and migration of hepatoma cells to demonstrate that hsa _ circ _0001495 can be a novel target for treatment of hepatoma

1. Construction of Small interfering RNAs (siRNAs)

Specific small interfering RNA (siRNA) targeting hsa _ circ _0001495 reverse splice site and negative control (si-NC) were synthesized from the gimar gene (shanghai), and a sequence map of hsa _ circ _0001495 was provided by the inventors.

siRNA transfection

50nM siRNA was transfected into hepatoma cells using Lipofectamine 3000 (Invitrogen, carlsbad, calif., USA). And (3) detecting the interference effect by fluorescent quantitative PCR.

The qRT-PCR results of figure 4 show that the effect of siRNA knock-down of hsa _ circ _0001495 (panel a) is significant.

The results in FIG. 4 show that inhibition of hepatoma cell invasion and migration was achieved after knock-down of hsa _ circ _ 0001495. Proves that hsa _ circ _0001495 can be used as a new target for targeted therapy of liver cancer.

The above-described embodiments are merely exemplary and are merely preferred embodiments of the present invention, and the scope of the present invention is not limited thereto, and those skilled in the art can make various modifications and variations without departing from the technical principle of the present invention, and these modifications and variations should be construed as the scope of the present invention.

Claims (6)

1. An application of the circular RNA hsa _ circ _0001495 in preparing liver cancer diagnosis products.

2. The loop RNA hsa _ circ _0001495 according to claim 1, wherein the loop RNA hsa _ circ _0001495 is derived from the 12 th site of the long arm of human chromosome 5 and is generated by the reverse splicing and circularization of exons 6 to 7, and has a length of 378bp and the nucleic acid sequence of SEQ ID No.1.

3. The use of hsa _ circ _0001495 according to claim 1 in the manufacture of a product for diagnosing liver cancer, wherein said product for diagnosing liver cancer comprises at least PCR amplification primers used in detecting the expression level of hsa _ circ _0001495 by SYBR Green, taqMan probes, two-hybrid probes or multiplex probes.

4. The use of hsa _ circ _0001495 according to claim 1 in the manufacture of a product for the diagnosis of liver cancer, wherein said product for the diagnosis of liver cancer further comprises a chip, a kit, a strip or a high throughput sequencing platform.

5. The application of the circular RNA hsa _ circ _0001495 as a target in the development of anti-cancer drugs, which is characterized in that the anti-cancer drugs comprise gene drugs or chemical drugs for inhibiting the expression of hsa _ circ _ 0001495.

6. The use of the hsa _ circ _0001495 molecule as a target in the development of anti-cancer drugs according to claim 5, wherein said genetic or chemical drugs are used to treat liver, lung, colorectal, gastric or breast cancer.

Images