CN117701397B

CN117701397B - Coprinus courtyard Coprinus for promoting germination of rhododendron seeds and application thereof

Info

Publication number: CN117701397B
Application number: CN202311283424.9A
Authority: CN
Inventors: 李小军; 潘长能; 王静
Original assignee: South Central University for Nationalities
Current assignee: South Central Minzu University
Priority date: 2023-03-16
Filing date: 2023-10-07
Publication date: 2024-05-31
Anticipated expiration: 2043-10-07
Also published as: CN117701397A

Abstract

The invention belongs to the technical field of biology, and particularly discloses a Coprinus cinerea of Coprinus for promoting germination of rhododendron seeds, which is preserved in China center for type culture collection (China center for type culture collection), wherein the preservation date is 2023, 1 month and 10 days, and the preservation number is CCTCC M2023060; the invention also provides an application of the coprinus comatus for promoting germination of the rhododendron seeds. The fungus is obtained through mycorrhiza separation, and a symbiotic fungus-Coprinus courtyard Coprinus capable of effectively promoting germination of the rhododendron seeds is successfully found through a large number of screening, the infection capacity is strong, the fungus is dominant, the germination time of the rhododendron seeds can be greatly shortened, and the germination rate of the rhododendron seeds is improved.

Description

Coprinus courtyard Coprinus for promoting germination of rhododendron seeds and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a Coprinus cinerea of Coprinus for promoting germination of rhododendron seeds and application thereof.

Background

Orchid is one of the most precious wild plant resources in the world and has great economic value. Most of orchid plants are famous medicinal plants, have high medicinal value, and along with the rapid development of modernization of traditional Chinese medicines, the market demand for orchid medicinal plants is increasing. However, the orchid seeds are tiny, only have undifferentiated primordium, have no endosperm, and are difficult to germinate under natural conditions, so that the artificial cultivation of the orchid is quite difficult. Research shows that in natural state, special fungi and orchid seeds are required to form symbiotic relation, and orchid seeds can germinate.

The azalea (CREMASTRA APPENDICULATA) is a plant of the genus azalea of the family orchidaceae, is a rare and rare medicinal plant, and the dried pseudobulb is called Indian iphigenia bulb, has the effects of clearing heat, detoxicating, promoting blood circulation, removing blood stasis, resisting tumor and the like, has high medicinal value and has huge medicinal material market demand. But the germination of the azalea seeds is not easy, and the growth period is too long, so that the resources are scarce.

The rhododendron is a decumbent orchid, and the variety and quantity of mycorrhizal fungi are quite rich, which also inevitably leads to a complex relationship between mycorrhizal fungi and rhododendron plant bodies. Based on the characteristic of abundant variety and quantity of the rhododendron mycorrhizal fungi, researchers have conducted a great deal of research, and have proved that mycorrhizal fungi can form symbiotic relation with rhododendron seeds so as to promote germination. According to the invention, through a large number of researches, fungi are obtained by separating from mycorrhizal fungi, and the fungi which effectively promote the germination of the azalea seeds are successfully screened out, so that the fungi have strong infection capability and are dominant bacteria, the germination time of the azalea seeds can be greatly shortened, and the germination rate of the azalea seeds is improved.

Disclosure of Invention

The invention aims to provide a fungus strain capable of effectively promoting germination of azalea seeds; fungus is obtained through mycorrhiza separation, and the fungus and the azalea seeds are subjected to symbiotic culture, so that a novel fungus-Coprinus cinerea of the Coprinus for effectively promoting germination of the azalea seeds is successfully screened out.

The aim of the invention is achieved by the following technical scheme:

The invention provides a Coprinus cinerea strain for promoting germination of rhododendron seeds, which is preserved in China center for type culture collection, and has the preservation date of: 2023, 1 and 10 days, with a preservation number of CCTCC M2023060, which is classified and named Coprinellus xanthothrix and belongs to Coprinus courtyard Coprinus (Coprinellus xanthothrix);

The fungus (Coprinus cinereus) strain is obtained by separating a rhododendron mycorrhizal fungus group, cleaning and sterilizing rhododendron mycorrhizal collected in the field, cutting the rhododendron mycorrhizal fungus group by a sterile knife, placing a cut surface on a PDA culture medium, separating edge fungus hyphae after hyphae grow out, culturing to obtain 20 strains, purifying for 4 times respectively to obtain pure strains, respectively using the strains in rhododendron seed germination experiments, and screening out a strain capable of obviously promoting the rhododendron seed germination.

And (3) reactivating the strain capable of obviously promoting germination, inoculating the activated pure strain on a PDA culture medium for pure culture, and carrying out morphological observation on colonies. The growth rate of the bacterial colony on the PDA culture medium is 0.312+/-0.004 mm/h, the bacterial colony is round and light yellow, and the aerial hypha is sparse and thick. The colony edge is neat, the primary mycelium is white and clings to the surface of the culture medium, and the aged mycelium is light yellow and thin. The mycelia are observed to grow outwards in a dendritic mode under a microscope, and the primary mycelia are silvery white, glossy, dense and obvious under the microscope.

Extracting strain DNA from the re-activated strain by using a fungus genome DNA extraction kit, and performing PCR amplification by using ITS1/ITS4 sequences as primers. The PCR product was sent to Shanghai Bioengineering Co.Ltd for purification sequencing.

Sequencing results were as follows: the amplification primers are general ITS1 and ITS4;

Forward primer ITS1: TCCGTAGGTGAACCTGCGG, shown as SEQ ID NO. 2;

reverse primer ITS4: TCCTCCGCTTATTGATATGC, shown as SEQ ID NO. 3;

the amplification sequence is as follows:

ATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATTG

TCAAGGTATTGTCCTCGCGGACGGTTAGAAGCGAGTCTGATCCTCGTCCAC

GGCGTAGATAATTATCACACCAATAGACGGAAGTTCAGTATGAACTCGCTAA

TGCATTTCAGGGGAGCGGACCGCCGTGAGGCAGCCTGCACAAACCCCCAC

ATCCAAGCCTCGAAGAACAGTTCAGAAAACTGGTGAGGTTGAGAATTTAA

TGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCG

TTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATT

TCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTT

GTATAGTGTTTTATAGGCTGAGAAGCCCATTGACTACATTCTGCATCATACTA

TTGGGGTGTGTAAAAAGACGTAGAGCCTGGAAATTCGAGGGGAGCCGTGT

GACGGGCAACCCTCGCATCCGCCCCATGAAGGGCGAGAGGTATCCAGACC

TACAGTCGGTGCACAGGTGGAAAGATAAAAATGGCGGGCGTGCACATTGC

TCCGAGGAGCCAGCTACAACCAAGACACCATAGTTATTCGTTAATGATCCTTCCGCAGGTTCACCTACG, shown as SEQ ID NO. 1; the PCR length is about 681 bp;

the sequences determined were submitted to the NCBI database (accession number: OR 186295) for BLAST alignment, where sequences were more than 99% identical to sequences in the database, and were considered to be of the same genus and species. The sequence identity of the fungus to the sequence of Coprinus comatus in the database is greater than 99%, so the fungus is considered Coprinus comatus (Coprinellus xanthothrix).

In addition, the applicant obtained a fruiting body of this fungus in oat medium, which meets the characteristics of Coprinus comatus in the garden, but is clearly distinguished from other known Coprinus fungi, hereinafter referred to as "Coprinus comatus".

In the present invention, the method for the expanded culture of Coprinus comatus strain in courtyard preferably comprises the steps of:

Inoculating the Coprinus cinereus strain in PDB liquid culture medium, and culturing until mycelia grow up in a laboratory vessel. The inoculation amount is preferably that a small piece of 0.5cm x 0.5cm of Coprinus comatus seeds is taken to correspond to 100mLPDB liquid culture medium.

The invention also provides a product for germination of azalea seeds, which comprises the Coprinus comatus strain and acceptable auxiliary materials. The product preferably comprises a plant bacterial fertilizer and a microbial agent. The preparation methods of the plant bacterial fertilizer and the microbial agent are not particularly limited, and the preparation methods of the plant bacterial fertilizer and the microbial agent which are well known in the art can be adopted.

For example, in the method for producing the microbial agent, it is preferable to inoculate the mycelia of Coprinus cinereus obtained by the above-mentioned expansion culture onto a medium, and mix the mycelia after the mycelia grow on the medium, thereby obtaining the microbial agent. The plant bacterial fertilizer is preferably obtained by inoculating mycelium of Coprinus cinereus in a culture medium, and mixing with nutritional ingredients after the mycelium grows up in the culture medium. The culture medium is preferably PDA culture medium; the nutrient components preferably comprise nutrient elements or organic fertilizers and the like.

The invention also provides an application of the Coprinus comatus in promoting germination of rhododendron simsii seeds, which comprises the following steps:

Inoculating the Coprinus cinereus strain in a culture medium, and performing enlarged culture for later use;

The culture medium comprises the following components: agar medium, soil, wood, corncob, straw, wheat bran, cotton seed hull, leaf and straw.

Co-culturing the strain obtained by the expansion culture in a symbiotic culture medium;

The symbiotic culture medium comprises one or a combination of more of agar culture medium, soil, wood, corncob, straw, wheat bran, cotton seed hulls, leaves and straw.

The invention also provides application of the product for germination of the azalea seeds in promoting germination of the azalea seeds.

Compared with the prior art, the invention has the advantages that:

The invention provides a Coprinus cinerea of Coprinus and application thereof for promoting germination of rhododendron seeds. Experiments prove that the fungus colony has a growth rate of 0.312+/-0.004 mm/h on a PDA culture medium, has a high growth rate, is dominant and has a high infection capacity; the fungus is subjected to symbiotic culture with azalea seeds on an oat culture medium, the occurrence of protocorms is observed from about 13 to 20 days, and the germination rate is calculated to be 45.85 +/-2.4 percent; starting 45-50 days, observing to form a large number of protocorms, and generating buds; the result shows that the symbiotic culture of the fungus and the azalea seeds can promote the germination of the azalea seeds, greatly shorten the germination time of the azalea seeds and improve the germination rate of the azalea seeds. In addition, the method has simple process, low cost and short production period, and can fully improve economic benefit.

Drawings

In order to more clearly illustrate the technical solutions of the present invention, the applicant will briefly introduce the drawings used in the description of the embodiments or the prior art, it being obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort to a person skilled in the art.

FIG. 1 is a graph of symbiotic culture of Coprinus comatus and Rhododendron simsii seeds on agar medium (20 days);

FIG. 2 is a graph of symbiotic culture of Coprinus comatus and Rhododendron simsii seeds on agar medium (45 days);

FIG. 3 is a diagram showing the cultivation of azalea seed on agar medium;

FIG. 4 is a colony morphology of Coprinus comatus in a garden;

FIG. 5 is a microstructure of Coprinus comatus in a garden;

FIG. 6 is a diagram of fruiting bodies of Coprinus comatus in garden;

FIG. 7 is a microstructure of Coprinus comatus and Rhododendron simsii seed;

FIG. 8 is a graph of symbiotic cultivation of Coprinus comatus and Rhododendron simsii seeds in nutrient soil.

Detailed Description

The following applicant makes clear and complete description of the technical solution in the embodiment of the present invention with reference to fig. 1 to 7, and describes the present invention in detail. These examples are provided only for illustrating the present invention and are not intended to limit the scope of the claimed invention.

The fungi used in the examples below were isolated from mycorrhizal fungi and were pure strains; the invention provides a Coprinus cinerea strain for promoting germination of rhododendron seeds; in order to isolate fungi from healthy roots of azalea, a fungus promoting germination of azalea seeds, coprinus cinerea, is obtained by screening.

Example 1, isolation, purification, identification and symbiotic experiments with azalea seeds of Coprinus genus Coprinus promoting germination, the specific steps are as follows:

1 materials and methods

1.1 Medium

The fungus culture medium used in this example was Potato Dextrose Agar (PDA) and the preparation method was: firstly, cleaning potatoes, peeling, weighing 200g, cutting into small pieces, adding water, boiling for 30min, filtering with eight layers of gauze to obtain filtrate, adding 15g of agar powder into the filtrate, stirring and mixing uniformly, slightly cooling, supplementing water to 1000mL, subpackaging in a conical flask, adding plugs and wrapping, sterilizing at 121 ℃ for 20min, taking out and shaking uniformly, pouring the PDA culture medium cooled to about 40 ℃ into a sterile culture dish, and storing for standby after solidification.

The fungal symbiotic culture medium used in this example was oat agar medium (OMA) and was prepared by the following method: weighing 3g of oatmeal, adding water, boiling for 30min, adding 15g of agar powder, stirring, mixing, cooling slightly, supplementing water to 1000mL, subpackaging in conical flask, adding stopper, wrapping, sterilizing at 121deg.C for 20min, taking out, shaking, pouring OMA culture medium cooled to about 40deg.C into sterile culture dish, and storing after solidification.

1.2 Test strains

The fungus used in this example was obtained by separating the mycorrhizal fungus of azalea, wherein azalea was collected in the field of Chongqing, and the mycorrhizal fungus of azalea was washed with distilled water to remove surface impurities; then 75% ethanol (75% is volume fraction, the description is omitted) is used for surface disinfection for 30s, and then distilled water is used for washing the ethanol; sterilizing the surface of 0.1% mercuric chloride for 3min, and washing with distilled water to remove mercuric chloride; then the surface is disinfected for 3min by 2 percent sodium hypochlorite, and the surface is washed three times by sterile water. Cutting completely sterilized mycorrhiza with a sterile knife, placing the cut surface on the PDA culture medium prepared in the step 1, placing the edge mycorrhiza on a 1.5% water agar culture medium after hyphae grow out, separating to obtain 20 strains of fungi, purifying four times to obtain pure strains, placing a part of pure strains on a new PDA culture medium for standby, and simultaneously, storing a part of pure strains in a PDA culture medium inclined surface test tube for standby.

1.3 Plant Material

The azalea seed liquid used in this example is prepared from uncracked mature azalea pods by surface disinfection: sterilizing the surface with 75% ethanol for 30s, and washing with distilled water for three times; disinfecting the surface of the mercury powder with 0.1% of mercuric chloride for 5min, and flushing the mercury powder with distilled water for three times; and then sterilizing the surface of the fruit with 2% sodium hypochlorite for 1min, flushing the fruit with sterile water for three times, opening the sterilized fruit pod to release seeds, and preserving the seeds in a 0.1% sterile water agar suspension for later use. .

1.4 Symbiotic culture

Spreading sterile filter paper with a central cut hole on the surface of an OMA culture medium, sucking 2mL of the completely sterilized rhododendron seed liquid obtained in the step 1.3 by using a sterile rubber head dropper, uniformly dispersing the sterile filter paper, picking pure mycelium blocks from a PDA culture medium, inoculating the mycelium blocks to the central hole, forming one group of bacteria, sealing the culture dishes by using a sealing film, and culturing in an artificial climate box.

1.5 Seed germination

The morphological changes of the seeds are observed under a stereoscopic microscope at regular intervals, and recorded by photographing. After culturing for 20 days, observing that the seeds in one group of dishes are expanded, white protocorms appear (see figure 1), identifying the seeds as the rhododendron seeds to germinate, calculating the germination rate to be 45.85 +/-2.4%, continuously growing the protocorms, observing that a large number of protocorms are formed in the germination group after culturing for 45 days, and the buds appear (see figure 2); the blank seeds of this example were not germinated (see fig. 3).

1.6 Identification of species

The PDA inclined surface test tube of the fungus which promotes germination is reactivated, the activated pure strain is inoculated on PDA culture medium for pure culture, and the colony is observed in morphology. The growth rate of the bacterial colony on the PDA culture medium is 0.312+/-0.004 mm/h, the bacterial colony is round and light yellow, and the aerial hypha is sparse and thick. The colony edge is neat, the primary mycelium is white and clings to the surface of the culture medium (see figure 4), and the aged mycelium is light yellow and thin. The mycelia are seen to grow outwards in a dendritic mode under a microscope, and the primary mycelia are silvery white, glossy and more dense and obvious under the microscope (see figure 5).

The PDA inclined surface test tube of the fungus which promotes germination is reactivated, the fungus genome DNA extraction kit is adopted to extract the strain DNA, and the ITS1/ITS4 sequence is used as a primer for PCR amplification. The PCR products were sent to the Shanghai Bioengineering Co., ltd for purification sequencing and the determined sequences were submitted to NCBI database for BLAST alignment.

The DNA extraction method adopts a marine Ezup column type fungus genome DNA extraction kit, and comprises the following steps:

Preparing materials: water bath, small-sized centrifuge (maximum centrifugal force is not less than 12000 Xg), 1.5mL centrifuge tube, absolute ethyl alcohol, isopropanol, beta-mercaptoethanol, RNaseA (20 mg/mL) and the like. The kit is started for the first time, and according to the specification of a bottle body label, isopropanol with corresponding amount is added into PWSolution for mixing uniformly (3:2), and absolute ethanol with corresponding amount is added into Wash Solution for mixing uniformly (1:2). Sealing and preserving at room temperature.

The mycelium was ground to a powder with liquid nitrogen and added to a 1.5mL centrifuge tube. 200 mu LBuffer Digestion and 2 mu L of beta-mercaptoethanol are added, and then 20 mu L of protease K solution is added, and the mixture is stirred and mixed uniformly. Water bath at 56 ℃ for 1h until the cells are completely lysed; adding 100 μL Buffer PF, mixing, and standing at-20deg.C for 5min; centrifuging at 10,000rpm for 5min at room temperature, transferring the supernatant to a new 1.5mL centrifuge tube; 200 mu L Buffer BD is added, and the mixture is fully inverted and uniformly mixed; adding 200 mu L of absolute ethyl alcohol, fully reversing and uniformly mixing; placing the adsorption column into a collecting pipe, adding the solution and semitransparent fibrous suspension into the adsorption column by using a liquid transfer device, standing for 2min, centrifuging at room temperature for 1min at 10,000rpm, and pouring out waste liquid in the collecting pipe; placing the adsorption column back into a collecting pipe, adding 500 mu LPWSolution, centrifuging at 10,000rpm for 30s, and pouring out the waste liquid in the collecting pipe; placing the adsorption column back into a collecting pipe, adding 500 mu L of Wash Solution, centrifuging at 10,000rpm for 30s, and pouring out the waste liquid in the collecting pipe; putting the adsorption column back into the collection tube again, centrifuging at 12,000rpm at room temperature for 2min, and leaving residual Wash Solution; the column was removed, placed in a new 1.5mL centrifuge tube, 50. Mu.L TE Buffer was added, and the mixture was allowed to stand still for 3min, centrifuged at 12,000rpm at room temperature for 2min, and the DNA solution was collected. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.

The PCR amplification method is as follows: PCR amplification of the ITS region was performed at 94℃for 4min, followed by 30 cycles of 94℃for 45s,55℃for 45s,72℃for 1min, and finally extension at 72℃for 8min.

Sequencing results were as follows: the amplification primers are common ITS1 and ITS4,

Forward primer ITS1: TCCGTAGGTGAACCTGCGG, shown as SEQ ID NO. 2;

reverse primer ITS4: TCCTCCGCTTATTGATATGC, shown as SEQ ID NO. 3;

the amplification sequence is as follows:

ATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATTG

TCAAGGTATTGTCCTCGCGGACGGTTAGAAGCGAGTCTGATCCTCGTCCAC

GGCGTAGATAATTATCACACCAATAGACGGAAGTTCAGTATGAACTCGCTAA

TGCATTTCAGGGGAGCGGACCGCCGTGAGGCAGCCTGCACAAACCCCCAC

ATCCAAGCCTCGAAGAACAGTTCAGAAAACTGGTGAGGTTGAGAATTTAA

TGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCG

TTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATT

TCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTT

GTATAGTGTTTTATAGGCTGAGAAGCCCATTGACTACATTCTGCATCATACTA

TTGGGGTGTGTAAAAAGACGTAGAGCCTGGAAATTCGAGGGGAGCCGTGT

GACGGGCAACCCTCGCATCCGCCCCATGAAGGGCGAGAGGTATCCAGACC

TACAGTCGGTGCACAGGTGGAAAGATAAAAATGGCGGGCGTGCACATTGC

TCCGAGGAGCCAGCTACAACCAAGACACCATAGTTATTCGTTAATGATCCTTCCGCAGGTTCACCTACG, shown as SEQ ID NO. 1; the PCR length is about 681 bp; the sequences obtained from the determination are submitted to the NCBI database (accession number: OR 186295) and BLAST aligned with fungal nucleotide sequences in the database, when the sequence is more than 99% identical to the sequences in the database, the same genus and species are considered. The sequence identity of the fungus to the sequence of Coprinus comatus in the database is greater than 99%, so the fungus is identified as Coprinus comatus (Coprinellus xanthothrix).

In addition, the applicant obtained the fruiting body of this fungus (see FIG. 6) by culturing in oat medium, which is in line with the characteristics of Coprinus comatus in courtyard, and which is clearly distinguished from other known Coprinus fungi.

The obtained Coprinus cinerea is preserved in China center for type culture collection, and the preservation date is as follows: 2023, 1.10.year, with a preservation number of CCTCC M2023060, which is classified as Coprinellus xanthothrix, belongs to Coprinus cinerea (Coprinellus xanthothrix).

1.7 Comparative experiments

The experiment adopts Coprinus comatus as a contrast, the activated Coprinus comatus is treated by the experiment method of the embodiment, and is subjected to symbiotic culture with the rhododendron simsii seed liquid on an OMA culture medium, 3 groups are treated, the morphological change of the seeds is observed under a stereoscopic microscope at regular intervals, and the photographing record is carried out.

After 20 days, part of the seeds are observed to swell, no further germination is observed continuously, no protocorm is observed (see figure 7), and after 50 days, no further germination is observed again, and the bacterium is considered to be incapable of promoting the germination of the azalea seeds.

Example 2, use of Coprinus cinerea in promoting germination of Coprinus cinerea seeds, in symbiotic medium-nutrient soil culture, comprising the following steps:

1 materials and methods

1.1 Medium

The fungus culture medium used in this example is PDB liquid medium, which is potato dextrose water medium, and the preparation method is: firstly, cleaning potatoes, peeling, weighing 200g, cutting into small pieces, adding water, boiling for 30min, filtering with eight layers of gauze to obtain filtrate, continuously heating, adding 20g of glucose, 3g of monopotassium phosphate, 1.5g of magnesium sulfate heptahydrate and 10mg of vitamin B1, continuously heating, stirring, uniformly mixing, slightly cooling, supplementing water to 1000mL, subpackaging into conical flasks, adding plugs, wrapping, sterilizing at 121 ℃ for about 20min, taking out, shaking, cooling and storing for later use.

The fungus symbiotic culture medium used in the implementation is nutrient soil, and the preparation method comprises the following steps: purchasing nutrient soil (comprising rooting powder, vermiculite, perlite, organic matter, etc.) from the net, and packaging into square plastic lunch boxes, placing three wood sticks in each box, adding water to saturation, covering with cover, sterilizing at 121deg.C for 30min, taking out, and stacking.

1.2 Test strains

The fungus used in this example was isolated and screened as in example 1, and the strain was Coprinus cinereus, a fungus of the genus Coprinus, and was stored in PDA medium.

Taking 0.5cm x 0.5cm small pieces of Coprinus comatus seeds, placing the small pieces in a conical flask filled with 100mL of PDB liquid culture medium, plugging a bottle mouth by using silica gel, finishing the process in an ultra-clean workbench so as to prevent the pollution by other fungi, culturing the small pieces on a shaking table at the rotating speed of 200r/min, and obtaining the PDB liquid culture medium of the Coprinus comatus seeds after hyphae grow fully basically for later use.

1.3 Plant Material

Same as in example 1

1.4 Symbiotic culture

Opening the lid of the lunch box in an ultra clean bench, uniformly spraying PDB liquid culture medium containing Coprinus comatus in the garden on nutrient soil and wood sticks, closing the lid, processing the 3 boxes by the same method, and culturing indoors; after the lunch box is full of hypha, the cover is opened, the rhododendron seed liquid is uniformly sprayed in the lunch box, and the cover is tightly covered.

1.5 Seed germination

Periodically observing the morphological change of the seeds, photographing and recording, observing after 15 days to find that the seeds in the lunch box swell, and identifying that the protocorms appear as the germination of the azalea seeds; after 40 days, it was observed again that shoots had formed (see FIG. 8. A), and as the culture time was prolonged, the shoots grew rapidly to form plants (see FIG. 8.B, FIG. 8. C), and it was confirmed that the seeds in this example could germinate and that shoots and plants could be formed.

Example 3, use of Coprinus cinerea in promoting germination of rhododendron simsii seeds, in co-cultivation of corncob as a co-cultivation medium, comprising the following steps:

1 materials and methods

1.1 Medium

The fungus culture medium used in this example was PDB liquid medium, as in example 2;

the fungus symbiotic culture medium used in the implementation is corncob, and the preparation method comprises the following steps: purchasing corncob from the net, cleaning with clear water, soaking in 1% lime water for disinfection and sterilization, taking out after one day, cleaning with clear water to remove lime water, placing sterilized corncob in self-sealing bags, placing 3-4 corncobs in each bag, and sealing for storage.

1.2 Test strains

The fungus used in this example was isolated and screened in example 1, and the strain was Coprinus comatus belonging to the genus Coprinus, the courtyard Coprinus comatus, and was stored in PDA medium.

Taking 0.5cm x 0.5cm small pieces of Coprinus comatus seeds, placing the small pieces in a conical flask filled with 100mLPDB liquid culture medium, plugging a bottle mouth with a silica gel plug, finishing the process in an ultra-clean workbench so as to avoid other fungus pollution, culturing the small pieces on a shaking table at the rotating speed of 200r/min, and obtaining the PDB liquid culture medium of the Coprinus comatus seeds after hyphae grow fully basically for later use.

1.3 Plant Material

Same as in example 1

1.4 Symbiotic culture

Opening a self-sealing bag in an ultra-clean bench, uniformly spraying PDB liquid culture medium of the Coprinus comatus in the courtyard on the corncob, closing the self-sealing bag, treating the 3 bags by the same method, and culturing indoors; after the corncob is fully grown by hypha, opening the self-sealing bag, uniformly spraying the rhododendron seed liquid on the corncob, and closing the self-sealing bag.

1.5 Seed germination

Periodically observing the morphological change of the seeds, photographing and recording, observing the seeds in the self-sealing bags after 17 days to expand, and identifying the seeds as germination of the azalea seeds when protocorms appear; after 45 days it was observed again that shoots had formed; it was confirmed that the seeds in this example can germinate and that shoots can be formed.

Example 4, use of Coprinus cinerea in promoting germination of Coprinus cinerea seeds, cultivation on symbiotic medium-wood, the specific steps are as follows:

1 materials and methods

1.1 Medium

The fungus symbiotic culture medium used in the embodiment is wood, and the preparation method comprises the following steps: removing surface impurities from decay wood collected outdoors, binding, sterilizing at 121deg.C for about 30min, taking out, cooling, placing into self-sealing bags, placing 3-4 pieces of wood in each bag, and sealing for storage.

1.2 Test strains

1.3 Plant Material

Same as in example 1

1.4 Symbiotic culture

Opening a self-sealing bag in an ultra-clean bench, uniformly spraying a PDB liquid culture medium of the Coprinus comatus in the courtyard on wood, closing the self-sealing bag, treating the 3 bags by the same method, and culturing indoors; after the mycelia are full of wood, opening the self-sealing bag, uniformly spraying the rhododendron seed liquid on the wood, and closing the self-sealing bag.

1.5 Seed germination

Periodically observing the morphological change of the seeds, photographing and recording, and observing the seeds after 13 days to find out that the self-sealing bags expand, and the protocorms appear, so as to identify the seeds as germination of the azalea; after 35 days, it was observed again that shoots had formed; it was confirmed that the seeds in this example can germinate and that shoots can be formed.

It will be apparent that the described embodiments are only some, but not all, embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

While the invention has been described with respect to specific embodiments thereof, it will be appreciated that the invention is not limited thereto, but is intended to cover modifications and alternatives falling within the spirit and scope of the invention as defined by the appended claims.

Claims

1. The coprinus for promoting germination of azalea seeds is characterized in that the coprinus for promoting germination is preserved in China center for type culture collection, and the preservation date is as follows: 2023, 1.10.year, with a preservation number of CCTCC M2023060, which is classified as Coprinellus xanthothrix, belongs to Coprinus cinerea (Coprinellus xanthothrix).

2. A product for germination of azalea seeds comprising the Coprinus cinerea of the genus Coprinus of claim 1 and acceptable excipients.

3. A product for germination of azalea seeds according to claim 2, wherein said product comprises a plant bacterial fertilizer and a microbial agent.

4. The use of Coprinus comatus in promoting germination of rhododendron parviflora seeds according to claim 1, characterized by the specific steps of:

(1) Inoculating the strain of Coprinus courtyard Coprinus into a culture medium, and performing expansion culture for later use;

(2) And placing the strain obtained after the expansion culture and the azalea seeds into a symbiotic culture medium for co-cultivation.

5. The use of Coprinus comatus according to claim 4 for promoting germination of Coprinus comatus seeds, wherein the symbiotic culture medium is one or a combination of several of agar medium, soil, wood, corncob, straw, wheat bran, cotton seed hulls, leaves, and straw.

6. Use of a product for germination of azalea seeds according to claim 2 or 3 for promoting germination of azalea seeds.