CN107090410B - Mycorrhizal fungus for producing plant hormone and application thereof in promoting plant growth - Google Patents

Abstract

A mycorrhizal fungus for producing plant hormone and application thereof in promoting plant growth belong to the field of agricultural microorganisms, wherein the collection number of the mycorrhizal fungus R49 is CGMCC No. 13883. Zeatin, gibberellin, abscisic acid and auxin are detected in the culture solution and the mycelium of the strain, and the content of the culture solution is far higher than that of the mycelium, so that the strain promotes the growth of host plants by secreting various hormones, and the strain has low host specificity, can be widely applied to rapid propagation and rapid growth culture of seedlings, and is simple, practical, green and environment-friendly.

Description

Mycorrhizal fungus for producing plant hormone and application thereof in promoting plant growth

Technical Field

The invention belongs to the field of agricultural microorganisms, and particularly relates to a mycorrhizal fungus for producing plant hormone and application thereof in promoting plant growth.

Background

Mycorrhiza is a reciprocal symbiotic complex formed by mycorrhizal fungi in soil and higher plant nutrition root systems. In the symbiotic system, plant roots provide a living place for mycorrhizal fungi to synthesize photosynthetic products, and the mycorrhizal fungi can activate soil nutrients and supply the soil nutrients to plants; some mycorrhizal fungi can produce plant hormones, such as auxin, cytokinin, gibberellin and the like, to promote the growth and development of plants; antibiotics can also be generated to inhibit the growth of pathogenic bacteria at the roots of plants. In summary, the beneficial effects of mycorrhiza formation on host plants are manifold. Among them, the mycorrhiza has the ability to synthesize plant hormones which plays a leading role in its various beneficial effects, and is an important index for screening excellent strains in production practice. Therefore, the mycorrhizal fungi for efficiently synthesizing the plant hormone is screened from the root of the plant, developed into a mycorrhizal preparation, applied to seedling cultivation, seedling growth in forestry and forestation in barren mountains, simple, practical, green and environment-friendly, and becomes a research hotspot in the field of current agricultural microorganisms.

Disclosure of Invention

The invention aims to provide a mycorrhizal fungus for producing phytohormone and application thereof in promoting plant growth. The strain can effectively promote the growth of blueberry seedlings and poplar seedlings.

The invention is realized by the following technical scheme:

a mycorrhizal fungus R49 for producing plant hormone is classified and named Lophiostoma sp, and the collection number of the mycorrhizal fungus R49 is CGMCC No. 13883.

The invention also provides a preparation method of the mycorrhizal fungi R49 inoculant, wherein the mycorrhizal fungi R49 is inoculated to a PDA flat plate, and the PDA flat plate is inversely cultured for 10 days at the temperature of 28 ℃; punching the bacterial block by a puncher, inoculating the bacterial block into the PDA culture solution after subpackaging, and performing shake culture at 28 ℃ for 15-20 days at the rotating speed of 180 rpm; preparing the subpackaged PDA culture solution: subpackaging PDA culture solution into containers, adding glass balls, and autoclaving.

The invention also provides a seedling growth promoting preparation containing the mycorrhizal fungi R49 fermentation liquid.

The invention also provides application of the mycorrhizal fungus R49 in a seedling growth promoting preparation.

Compared with the prior art, the invention has the beneficial effects that:

zeatin, gibberellin, abscisic acid and auxin are detected in both the culture solution and the mycelium of the strain, and the content of the culture solution is far higher than that of the mycelium, so that the strain can promote the growth of host plants by secreting various hormones.

The strain has obvious growth promotion effect, has low host specificity, can be widely applied to rapid propagation and fast growth culture of nursery stocks, and is simple, practical, green and environment-friendly.

Drawings

FIG. 1 inoculation effect of mycorrhizal fungi R49 on blueberry tissue culture seedlings; a control group, B inoculation mycorrhizal fungi R49 group;

fig. 2 colonization of mycorrhizal fungi R49 within blueberry roots: a, the arrow indicates the intracellular hypha of R49; b, the arrow indicates the R49 microsclerotia in the cell; FIG. 3 morphological features of the mycorrhizal fungus R49 colony;

FIG. 4 hyphal characteristics of the mycorrhizal fungus R49;

FIG. 5 Effect of inoculation of mycorrhizal fungus R49 on the plant height of poplar;

FIG. 6 Effect of inoculation of mycorrhizal fungus R49 on poplar ground diameter, chlorophyll content and dry weight.

Strain preservation information: the strain is R49 which is classified and named Lophiostoma sp; the strain is preserved in China general microbiological culture Collection center (CGMCC) of China general microbiological culture Collection center (CGMCC) at 11 months 4 and 2017, and the preservation address is as follows: the preservation number of the Xilu No.1 Hospital No. 3 of Beijing Chaoyang district is: CGMCC No. 13883.

Detailed Description

The technical solution of the present invention is further explained by the following examples, but the scope of the present invention is not limited in any way by the examples.

Example 1

Separating and purifying endophytic fungi at the root of blueberry, comprising the following steps:

1. the root system of the cultivated blueberry with the soil sample is collected from the tobacco terrace breast mountain blueberry plantation. Washing the root segments of the blueberries by using clear water, and then transferring the root segments of the blueberries to an ultra-clean workbench for the following operations: soaking the root segments in 10% (mass ratio) hydrogen peroxide for 8min, and slightly turning over with sterile forceps for several times during the soaking period to ensure thorough disinfection; rinsing with sterile water for 2-3 times, transferring into 6% (mass ratio) sodium hypochlorite, soaking for 15 min, and rinsing with sterile water for 2 times; the filter paper absorbs the residual liquid on the surface of the root segment. Shearing the sterilized root segments into 0.5cm long root segments with sterile scissors, inoculating into prepared PDA plate, and culturing in 25 deg.C incubator in dark inverted manner. The formula of the PDA plate comprises: 0.6% potato extract powder, 2% glucose, 2% agar, pH 5.6. Sterilized at 115 ℃ for 20 minutes, cooled to 60 ℃ and added with sterile ampicillin (50ug/mL) and streptomycin sulfate (100ug/mL) at the final concentrations in PDA medium.

2. When fungus grows out of the tissue incision, the tissue incision is picked into a PDA (personal digital assistant) plate without penicillin and streptomycin by using an inoculation needle as soon as possible, purified and cultured in a constant-temperature incubator at 25 ℃ in a dark inversion mode, and a pure bacterial colony is obtained after 3-5 times of transfer.

Example 2

Screening of growth-promoting beneficial mycorrhizal fungi, specifically comprising the following steps:

1. cultivation of blueberry seedlings

(1) Blueberry bud differentiation

And (4) selecting blueberry tissue culture seedlings with good growth state and plant height of 4-5cm for rapid propagation. Cutting the blueberry plants in the tissue culture bottle from the base part by using sterile scissors in a super clean workbench to form stem sections of 2-3cm, then connecting the stem sections to the tissue culture bottle containing a differentiation culture medium by using sterile tweezers, and inoculating 3-4 stem sections into each bottle, and uniformly dispersing and placing. The culture medium is WPM culture medium as basic culture medium, sucrose 20g and agar 5-10g are added into each liter of WPM culture medium, the added phytohormone is zeatin 1.0-3.0mg, the culture medium pH is 5.0-5.5, the content of culture container is 10-30%, and the culture container is sterilized at 121 ℃ for 20min under high pressure. The culture conditions are set to 23-25 ℃, the light intensity of 2000-3000lx, the illumination time is 8-16 h/day, and the culture time is 40-60 days.

(2) Blueberry rooting culture

And (4) selecting the blueberry tissue culture seedlings with the height of 5-6cm and good growth state in a super clean workbench for rooting culture. Cutting off the base of the blueberry tissue culture seedling by using sterile scissors, inserting the cut plant into a rooting culture medium with a filter paper ball by using sterile forceps, wherein the inserting depth of the plant is proper to the condition that the bottom of the plant is just immersed into the culture medium, and 6-10 blueberry seedlings are inoculated into each bottle of liquid culture medium. The culture medium is 1/2WPM culture medium as basic culture medium, then adding sucrose 20g and indolebutyric acid 1-2.5mg, fixing volume to 1 liter, adjusting pH of the culture medium to 5.0-5.5, pouring the prepared liquid culture medium into a tissue culture bottle filled with filter paper balls, wherein the filling amount of the culture container is 10-30% (volume ratio), and autoclaving at 121 ℃ for 20 min. The filter paper balls are paved at the bottom of the tissue culture bottle so as to fix the blueberry seedlings. The culture conditions are set to 23-25 ℃, the light intensity of 2000-3000lx, the illumination time is 8-16 h/day, and the culture time is 40-60 days.

2. Preparation of the inoculant

15 endophytic fungi purified according to example 1 were selected, inoculated on PDA plates, and cultured in an inverted state at 28 ℃ for 10 days. Beating 3 blocks of each strain with the diameter of 5mm, respectively inoculating into the PDA culture solution after subpackaging, and performing shake culture at 28 ℃ for 15-20 days at the rotating speed of 180 rpm. Preparing the subpackaged PDA culture solution: the PDA culture solution is subpackaged into 500mL triangular flasks, each flask is subpackaged with 100 plus 200mL, 10-20 glass spheres are placed, and autoclaving is carried out at 121 ℃ for 20 min.

3. Inoculating blueberry tissue culture seedling, and screening growth-promoting mycorrhizal fungi

(1) Preparation of Co-culture matrices

Cutting moss, washing with clear water, soaking in distilled water overnight to allow it to absorb water, packaging into tissue culture bottles with a container content of 15-25% (volume ratio), and autoclaving at 121 deg.C for 30 min.

(2) Co-culture of strain and blueberry tissue culture seedling

Inoculating rooted blueberry seedlings into the prepared co-culture medium by using sterile forceps, and respectively adding 4-6mL of the prepared strain inoculants by using a liquid transfer gun. Before sucking, the inoculant needs to be shaken and mixed evenly. The front end of the pipette tip is cut off by 2-3mm and sterilized before use. After inoculation, the blueberry seedlings are cultured for 80 days at 25 ℃ under the light intensity of 2000-3000lx and the illumination time of 8-16 hr/day, and then the influence of the inoculated strains on the growth of the blueberry seedlings is observed. Each strain is repeated for 3 times, and each time, 5 bottles of blueberry tissue culture seedlings are repeated.

The results show that one strain of fungus R49 was screened. Compared with a non-inoculated control, the blueberry seedlings inoculated with the strain are obviously robust, have a large tillering number, large and dark green leaves and developed root systems. (FIG. 1). And taking part of the root section, and detecting the planting condition of the fungus R49 at the root of the blueberry tissue culture seedling. Placing root segments inFixing in FAA fixing solution prepared in advance for 12 hours, and decolorizing after washing. The decoloring method comprises the steps of transparentizing by 10 percent (g/ml) KOH and 10 percent (mass ratio) H₂O₂Bleaching, 1% (mass ratio) HCl acidification, 0.05% (g/ml) Trypan blue staining and 50% (volume ratio) glycerol decolorization. And randomly selecting blueberry root segments, and observing under a microscope. As shown in fig. 2, hyphae and microsclerotia were visible in the cortical cells of the blueberry roots, indicating that R49 could invade the host plant roots. In addition, only the strain which is the same as the inoculant is separated from the root sample of the inoculated blueberry seedling, and the growth advantage of the inoculated blueberry seedling is further proved to be caused by the root colonization of the fungus R49 blueberry.

Example 3

The morphological and molecular biological identification of the strain R49 comprises the following steps:

1. selecting the above purified strain, inoculating into PDA plate, and culturing and activating in 28 deg.C incubator for 1-2 weeks. The bacterial cake was punched out from the outermost layer of the colony using a sterile punch with a diameter of 0.5cm, inoculated onto a new PDA plate, cultured in a constant temperature incubator at 28 ℃ for 1 week, and the morphology of the colony was observed. FIG. 3 shows that the surface of the colony is grey white, the back is brown yellow, the colony is oval, the hyphae are compact, the middle is convex, the edge is provided with wrinkles, and the center of the surface of the colony quilt is provided with a dark crack.

2. Picking a small amount of purified single colony hyphae by using an inoculating needle, putting the single colony hyphae on a glass slide on which a drop of physiological saline is dripped to prepare a temporary loading piece, and observing the hyphae structure of the endophytic fungi under a microscope. FIG. 4 shows that hyphae have different curves and septa and branch branches, which can produce spores.

3. And (4) performing molecular biological identification on the strains. Using all-type gold

Extracting the genome DNA of the cultured hyphae by using a Plant Genomic DNAkit kit, wherein an amplification primer is ITS 1: 5'-TCC GTA GGT GAA CCT GCG G-3' and ITS 4: 5'-TCC TCC GCT TAT TGA TAT GC-3' are provided. The PCR reaction system (25. mu.L) included: 2.5 μ L10 XPCR buffer (containing Mg)²⁺)，2μL dNTP(2.5mM each)，1.5μL ITS1 (10. mu.M), 1.5. mu.L ITS4 (10. mu.M), 0.2. mu.L of LTaq enzyme, 2. mu.L of genomic DNA, 15.3. mu.L of ddH 2O. The amplification reaction procedure was: pre-denaturation at 94 deg.C for 3min, and circulating for 1 time; denaturation at 94 deg.C for 1min, annealing at 51 deg.C for 1min, extension at 72 deg.C for 1min, and circulating for 35 times; finally, extension is carried out for 10min at 72 ℃. The PCR amplification product was sent to Beijing Liu He Hua Dagenescience and technology Co. The obtained sequence of the endogenous Transcribed Spacer between rDNA genes, namely the ITS sequence (Internally Transcribed Spacer), is subjected to Blastn alignment with the sequence in the national center for Biotechnology information database (NCBI, http:// www.ncbi.nlm.nih.gov /), is most similar to Lophiostoma sp (No. KJ921913), and the maximum similarity is 97%. The strain is R49 in serial number, is identified as Lophiostoma sp, has been preserved in China general microbiological Culture Collection Center (CGMCC) in combination with morphology, and has the preservation number of CGMCC No. 13883.

And (3) sequencing results:

CGGGAGGCCCTGTCTGAACCCTATGTCATTGTCGCACCTCGCGTTTCCTCGGCGGGCTCGCCCGCCAACGAGGACCCCATACCAAACCCATTGCAGTATTGCAGTACACGTCTTACAAACAATCAATCAAAACTTTCAACAACGGATCTCTTGGTTAGGGCATCGATGAAGAACGCATCGAAATGCGATAATCAGTGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATCCCTTAGGGCATGCCTGTTCGAGCGTCATGTAAATCCTCAGGCACCGCTTGAAGTTAGGCGCCTGTTCCGCCGCGCGCGCGGACTCGCCTCGAAGAGATTGGCGGACTGTGTGTTGGCCACGAGCGCAGCAGACCACGCGGCTCGTGCCCTCCCGCGCAGGCGCTCCAGGAAGCGACCCCCCCAATTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA。

example 4

The method for measuring the content of the phytohormone in the fermentation liquor of the strain R49 comprises the following specific steps:

1. and (4) extracting the plant hormone. 3 blocks of 5mm fungal mass were punched out of a PDA plate of R49, inoculated into a 250mL Erlenmeyer flask containing 50mL of PDA culture solution, shake-cultured at 28 ℃ for 10 days at a rotation speed of 180rpm, and seed solutions were prepared. The cells were inoculated into a 500mL Erlenmeyer flask containing 100mL of fresh PDA culture medium at a ratio of 10% (v/v). 6 replicate bottles were set, 3 for measuring the hormone content in the mycelium and the broth, and 3 additional bottles of mycelium were dried and the dry weight of the mycelium was recorded. Vacuum filtering the mycelium of the above culture solution, washing with sterile water for 3 times, drying with filter paper, adding 5mL 80% (v/v) glacial methanol into small mortar, grinding for 10min, transferring to 100mL conical flask, adding 20mL 80% glacial methanol, shaking, standing at 0 deg.C for 40hr, and shaking occasionally. After filtration, the filtrate was concentrated to 10mL under reduced pressure, filtered through a 0.45 μ M filter membrane, and 3 bottles of the resulting filtered supernatants were mixed for on-machine determination of phytohormone content in the mycelia. Filtering the obtained mycelium culture solution, mixing with the effluent liquid of the washed mycelium, compressing to 10mL, filtering through a 0.45 mu M filter membrane, mixing in 3 bottles, and using the obtained clear liquid for measuring the phytohormone content in the fermentation liquid on a machine.

3. And (4) measuring the plant hormone. Indole Acetic Acid (IAA) and Gibberellin (GA) in the sample were measured by high performance liquid chromatography (HPLC, Agilent 1200, U.S.A.)₃) Zeatin (Z) and abscisic acid (ABA) content. The chromatographic column is ZORBAX SB-C18, analytical4.6 × 150 mm; mobile phase: 20% CH3CN, 20% CH3OH, 60% H₂O，H₃PO₄Adjusting the pH value to 3.0; flow rate: 0.7 mL/min; detector UV 254nm × 0.1 AuFg. The obtained separation chromatogram of the sample to be tested is characterized by retention time and quantified peak height, and hormone content in each sample is calculated by SPSS software and a standard curve equation (table 1). The result shows that the strain R49 can secrete a plurality of hormones such as zeatin, gibberellin, abscisic acid and auxin, particularly the content of the zeatin and the gibberellin is obvious, the secretion amount in a culture solution is obviously higher than that of the mycelium, the difference is obvious, the plant hormones generated by the fungus can be released to the outside of cells, and the hormones can enter plant tissues to play a role through a mycorrhizal symbiotic system.

TABLE 1 content of phytohormones in mycelium and culture broth of Strain R49

Example 5 inoculation effect of R49 on poplar seedlings, the specific steps were as follows:

1. cultivation of poplar seedlings

In a clean bench, stem sections of 4-5cm are cut from the tissue culture seedlings of the poplar by using sterile scissors, and the stem sections are inserted into a rooting culture medium for rooting culture. The poplar rooting culture medium is MS solid culture medium added with naphthylacetic acid (NAA) in 0.1mg/L and pH5.8-6.0, and through autoclaving at 121 deg.c for 20min, the mixture is packed in culture bottle in 10-30% (v/v) of the culture bottle. The culture conditions are set to 23-26 ℃, the light intensity of 2000-3000lx, the illumination time is 8-16 h/day, and the culture time is 30 days. And (3) selecting the poplar rooted seedlings with the height of 10cm and the number of leaves of 8-10, and carrying out domestication and transplantation. The culture medium is vermiculite and nutrient soil, and is prepared by mixing at a volume ratio of 1:1, sterilizing at 121 deg.C for 3hr in a high pressure steam sterilization pot, and packaging into plastic nutrition bowls sterilized with 75% alcohol, wherein the diameter of the nutrition bowl is 12cm, and the height is 20 cm. And (3) placing the transplanted living poplar seedlings in a greenhouse at the temperature of 18-25 ℃ under natural illumination for growing.

2. Strain R49 promotes poplar seedling growth

And (4) selecting poplar seedlings with consistent growth vigor for inoculation effect analysis. The inoculation example group and the control group were set with 15 pots (3 replicates, 5 pots/replicate) per group. Inoculation example group: 10mL of R49 bacterial solution was poured into each pot, and the inoculum was prepared as in step 2 of example 2. Control group: no bacterial solution was added. Culturing poplar seedling in glass greenhouse under natural illumination and environment humidity of 60-80% and conventional management. Plant heights were recorded in both groups every 20 days, and above-ground biomass dry weight and chlorophyll content of top mature healthy leaves were determined after 80 days. FIG. 5 shows that the plant heights of the poplar seedlings of the inoculation example group began to show superiority at 40 days of inoculation compared with the control group, and the superiority was increasingly significant at 60 days and 80 days. The aerial dry weight, root dry weight and leaf chlorophyll content of the poplar seedling strain of the inoculation example group after 80 days were also significantly higher than those of the control group (fig. 6). The results show that R49 has little specificity to the host, can also obviously improve the photosynthetic capacity of poplar leaves and promote the growth of poplar seedlings. The strain can be widely applied to rapid propagation and fast growth culture of nursery stocks, and is simple, practical, green and environment-friendly.

SEQUENCE LISTING

<110> university of Ludong

<120> a mycorrhizal fungus for producing plant hormone and application thereof in promoting plant growth

<130> do not

<160>1

<170>PatentIn version 3.3

<210>1

<211>490

<212>DNA

<213>Lophiostoma sp.

<400>1

cgggaggccc tgtctgaacc ctatgtcatt gtcgcacctc gcgtttcctc ggcgggctcg 60

cccgccaacg aggaccccat accaaaccca ttgcagtatt gcagtacacg tcttacaaac 120

aatcaatcaa aactttcaac aacggatctc ttggttaggg catcgatgaa gaacgcatcg 180

aaatgcgata atcagtgtga attgcagaat ttagtgaatc atcgaatctt tgaacgcaca 240

ttgcgccctt tggtatccct tagggcatgc ctgttcgagc gtcatgtaaa tcctcaggca 300

ccgcttgaag ttaggcgcct gttccgccgc gcgcgcggac tcgcctcgaa gagattggcg 360

gactgtgtgt tggccacgag cgcagcagac cacgcggctc gtgccctccc gcgcaggcgc 420

tccaggaagc gaccccccca attttgacct cggatcaggt agggataccc gctgaactta 480

agcatatcaa 490

Claims (4)

1. A mycorrhizal fungus R49 for producing plant hormone is classified and named Lophiostoma sp, and the collection number of the mycorrhizal fungus R49 is CGMCC No. 13883.

2. A method for preparing an inoculant of mycorrhizal fungi R49 according to claim 1, wherein the mycorrhizal fungi R49 is inoculated to PDA plates and cultured in an inverted state at 28 ℃ for 10 days; punching the bacterial block by a puncher, inoculating the bacterial block into the PDA culture solution after subpackaging, and performing shake culture at 28 ℃ for 15-20 days at the rotating speed of 180 rpm; preparing the subpackaged PDA culture solution: subpackaging PDA culture solution into containers, adding glass balls, and autoclaving.

3. A seedling growth promoting formulation comprising a fermentation broth of the mycorrhizal fungus R49 of claim 1.

4. Use of the mycorrhizal fungus R49 of claim 1 in the preparation of a seedling growth promoting formulation.

Images