CN110616157A - Fusarium oxysporum and application thereof - Google Patents
Fusarium oxysporum and application thereof Download PDFInfo
- Publication number
- CN110616157A CN110616157A CN201911087485.1A CN201911087485A CN110616157A CN 110616157 A CN110616157 A CN 110616157A CN 201911087485 A CN201911087485 A CN 201911087485A CN 110616157 A CN110616157 A CN 110616157A
- Authority
- CN
- China
- Prior art keywords
- fusarium oxysporum
- peanut
- pathogenicity
- fusarium
- rot
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/18—Testing for antimicrobial activity of a material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/77—Fusarium
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Toxicology (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Botany (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a fusarium oxysporum, belonging to the technical field of separation of pathogenic microorganisms. The Fusarium oxysporum of the invention is Fusarium oxysporum Hs-f (Fusarium sp.) and is deposited in 29 months in 2019 on the following days: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:18130 and an address of: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province. The pathogenic fungus of the peanut rot disease is obtained by separating and purifying the seed kernels of the peanut rot disease, and a tieback experiment proves that the pathogenic fungus has high pathogenicity and no tissue specificity and has pathogenicity on flower roots, stems, leaves and seed kernels.
Description
Technical Field
The invention belongs to the technical field of pathogenic microorganism separation, and particularly relates to fusarium oxysporum and application thereof.
Background
Peanuts are a temperature-loving leguminous crop which blooms on the ground and then shoots into the ground to fruit, and are oil and economic crops widely planted worldwide. But is susceptible to soil-borne diseases due to the nature of underground results. A plurality of peanut soil infectious diseases are reported, including fungal diseases, bacterial diseases, nematode diseases and the like. The fungal diseases mainly comprise stem rot, root rot, fruit rot and the like. These fungal diseases often result in peanut seedling death or underground root rot. The large-area rotting and yield reduction and even the top harvest of peanuts caused by fungal diseases are mostly reported, and the situation that the rotting and yield reduction of peanuts is aggravated in the northern production area is in the next year, so that the screening, the culture and the pathogenicity research of pathogenic fungi of the rotting and disease-causing peanut become more important, the method is a precondition and a basis for researching the mechanism of resisting the fungal rotting and disease-preventing peanut and breeding disease-resistant varieties, and is also a key for preventing and controlling the rotting and disease of the peanuts.
Due to the growth characteristics of the underground peanut fruiting, the diversity of the attached bacteria, endophytes and fungus communities in the soil on the surfaces of peanut pods and rhizosphere soil is higher, and the screening difficulty of pathogenic fungi is increased. Moreover, most fungi have the characteristics of long growth cycle and slow passage, so that in order to quickly obtain a pure culture with stable pathogenicity, a proper selective culture method is required to be adopted to shorten the passage cycle. In addition, the screening and identification of the disease-resistant germplasm of the peanut must be combined with field experiments, and a large amount of pathogenic fungi are needed, which undoubtedly improves the difficulty of the rapid and mass propagation technology of the pathogenic fungi.
Disclosure of Invention
Aiming at the problems in the prior art, the invention aims to provide a fusarium oxysporum which is a pathogenic bacterium for screening and separating peanut rot disease, provide a culture method of the pathogenic bacterium, and realize rapid and mass propagation so as to meet the mass demand of peanut disease-resistant germplasm screening, and has important significance for screening peanut rot disease-resistant varieties.
In order to achieve the purpose, the invention adopts the following technical scheme:
a strain of Fusarium oxysporum, Fusarium oxysporum Hs-f (Fusarium sp.), deposited at 29.08 months in 2019 in: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:18130 and an address of: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.
On the basis of the scheme, the fusarium oxysporum is separated from peanut materials suffering from rot disease in a production test base of the Qingdao Laixi peanut.
On the basis of the scheme, the colony morphology of the fusarium oxysporum is as follows: fusarium oxysporum is cultured on a PDA culture medium plate, aerial hyphae are white and flocculent, a culture medium is changed from red to purple red in 30 days of culture, a plurality of loose flocculent sclerotia with the diameter of 1.5 mm are generated on aged hyphae, and two conidia of a large sickle shape and a small oval shape are generated.
On the basis of the scheme, the Fusarium oxysporum ITS sequence is shown in SEQ ID No. 1.
SEQ ID No.1：
GATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACATTCAGAAGTTGGGGTTTAACGGCGTGGCCGCGACGATTACCAGTAACGAGGGTTTTACTACTACGCTATGGAAGCTCGACGTGACCGCCAATCAATTTGAGGAACGCGAATTAACGCGAGTCCCAACACCAAGCTGTGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTTATTTATGGTTTTACTCAGAAGTTACATATAGAAACAGAGTTTAGGGGTCCTCTGGCGGGCCGTCCCGTTTTACCGGGAGCGGGCTGATCCGCCGAGGCAACAAGTGGTATGTTCACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGG
On the basis of the above protocol, the fusarium oxysporum has high pathogenicity to peanut rot and no tissue specificity.
On the basis of the scheme, the pathogenicity of the fusarium oxysporum to the peanut is as follows: the stem rot rate reaches more than 50%, the fruit rot rate reaches more than 50%, and the root rot rate reaches more than 30%.
The fusarium oxysporum is applied to screening of disease-resistant peanut germplasm.
The technical scheme of the invention has the advantages
The pathogenic fungus of the peanut rot disease is obtained by separating and purifying the seed kernels of the peanut rot disease, and a tieback experiment proves that the pathogenic fungus has high pathogenicity and no tissue specificity and has pathogenicity on flower roots, stems, leaves and seed kernels.
The specific implementation mode is as follows:
terms used in the present invention have generally meanings as commonly understood by one of ordinary skill in the art, unless otherwise specified.
The present invention will be described in further detail with reference to the following data in conjunction with specific examples. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.
Example 1: separation, screening and purification of bacterial strain
Two materials with serious rot disease incidence are selected for flower cultivation 917 and 918 in the harvest period in the Qingdao Lexi peanut production test base, and 3 plants with the rot rate of more than 50% are respectively selected. Mixing the diseased fruits of 5 plants, placing into a sealing bag, storing at low temperature with a foam box containing an ice bag, taking back to the laboratory, and storing in a refrigerator at 4 deg.C for use.
The two peanut materials are respectively selected 5 diseased fruits at random as experimental materials, and three groups of repeated experiments are respectively carried out. All experimental procedures were performed aseptically. The diseased fruit was rinsed 5 times with sterile water, soil and surface attachments were removed, and then the shell was cut with sterile scissors on a clean bench with sterile filter paper to remove water. Sterilizing semen Juglandis with yellow and black colorCutting the blade into 0.5cm pieces, placing into a triangular flask containing 10mL of PDA liquid culture medium with pH of 6.5, shaking overnight at 25 deg.C and 180rpm in a shaking table, centrifuging at 3000g for 3min, and collecting supernatant according to 10%-1、10-3、10-5After gradient dilution, streaking and separation are carried out on a plate. Selecting single colonies with different forms, continuously streaking, purifying and culturing, wherein the purifying method comprises the steps of selecting the single colonies by using an inoculating needle, inoculating the single colonies into 10ml of liquid PDA culture medium with the pH value of 6.5, carrying out overnight culture at 25 ℃, centrifuging for 1 minute at 3000g, removing the liquid culture medium, then re-suspending the thalli by using 0.5ml of liquid PDA culture medium, and inoculating the thalli on 10 solid PDA culture media by using a scratching method to increase the purifying amount; until a pure culture is obtained. The pure cultured microorganisms are identified and classified by combining the traditional morphological identification method and the molecular biology identification method (ITS sequence sequencing). 5 strains were obtained which could be associated with peanut rot and were present in both peanut materials.
Pathogenicity experiments were performed on these 5 strains, respectively: selecting 40 susceptible peanut varieties and 5 isolated peanut tissues. The results show that: the PPRF-01 strain has high pathogenicity to 28 selected 40 infected varieties and pathogenicity to cotyledon, stem, root and fresh seed; the PPRF-02 strain has high pathogenicity on 25 selected 40 susceptible varieties and has pathogenicity on cotyledon, stem, root and fresh seed. The PPRF-03 strain has high pathogenicity on 22 selected susceptible varieties of 40 varieties and has pathogenicity on cotyledon, stem and fresh seed. The PPRF-04 strain has high pathogenicity to 32 selected 40 susceptible varieties and has pathogenicity to cotyledon, stem and root. Hs-f (PPRF-05) is a highly pathogenic strain, the pathogenic rate of 5 peanut tissues of 40 selected susceptible peanut varieties can reach 100%, the stem rot rate of a field inoculation experiment reaches more than 50%, the fruit rot rate reaches more than 50%, and the root rot rate reaches more than 30%.
Wherein Hs-f has the morphological characteristics that: the Fusarium oxysporum is cultured on a PDA culture medium plate, aerial hyphae are white and flocculent, a culture medium is changed from red to purple red in 30 days of culture, a plurality of loose flocculent sclerotia with the diameter of 1.5 mm are generated on aged hyphae, and two kinds of conidia, namely large sickle-shaped conidia and small elliptic conidia, are generated.
ITS sequencing of Hs-f: and selecting a single colony to perform ITS region PCR amplification detection, selecting a sample with a bright and single electrophoresis band, storing and sequencing. The sequencing results were submitted to the NCBI database for blastn comparison, and based on the results, sequence annotation was performed and submitted to GenBank for registration, seq id no: MH 368499. ITS ITS sequence was aligned to have 100% similarity to Fusarium oxysporum. The strain is identified to be Fusarium oxysporum (Fusarium sp.) by combining morphological characteristics, is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, has the unit address of No. 3 Xilu 1 of Beijing, Chaoyang, and has the preservation date of 2019, 08 and 29 days and the preservation number of CGMCC No. 18130.
The ITS sequence of Hs-f is shown as follows:
SEQ ID No.1：
GATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACATTCAGAAGTTGGGGTTTAACGGCGTGGCCGCGACGATTACCAGTAACGAGGGTTTTACTACTACGCTATGGAAGCTCGACGTGACCGCCAATCAATTTGAGGAACGCGAATTAACGCGAGTCCCAACACCAAGCTGTGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTTATTTATGGTTTTACTCAGAAGTTACATATAGAAACAGAGTTTAGGGGTCCTCTGGCGGGCCGTCCCGTTTTACCGGGAGCGGGCTGATCCGCCGAGGCAACAAGTGGTATGTTCACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGG
example 2: rapid culture method of Hs-f
As the Hs-f strain grows slowly on the PDA solid culture medium and the spore production time is about 15 days, the subculture conditions of the Hs-f strain are improved.
First, a single colony was picked and inoculated into a 10ml centrifuge tube containing 5ml PDA liquid medium, and shake-cultured in a shaker at 25 ℃ and 180rpm for 8 h. Then 5ml of the culture solution is transferred into a triangular flask containing 50ml of PDA liquid culture medium, and the mixture is subjected to shake culture at the temperature of 25 ℃ and the rpm of 180 overnight. And finally, coating the enriched culture solution on a PDA culture medium plate with the diameter of 9cm, airing on a super clean bench, repeatedly coating twice, airing, and placing in an incubator for dark culture overnight at 25 ℃. And the pH of the PDA liquid medium used was 6.5. The pure cultures thus obtained were rapidly passaged to 50 generations, preserving strains with stable pathogenicity. And selecting strains with stable pathogenicity after 50 passages for preservation.
Provides a method for rapid and mass propagation for meeting the large demand of screening peanut disease-resistant germplasm on pathogenic fungi.
Firstly, activating the cryopreserved strain, inoculating 0.1ml of the cryopreserved strain into a 10ml centrifuge tube containing 5ml of PDA liquid culture medium, and performing shake culture in a shaking table at 25 ℃ and 180rpm for 8 h. Then 5ml of the culture solution is transferred into a triangular flask containing 50ml of PDA liquid culture medium, and the mixture is subjected to shake culture at the temperature of 25 ℃ and the rpm of 180 overnight. And finally, coating the enriched culture solution on a PDA culture medium plate with the diameter of 9cm, airing on a super clean bench, repeatedly coating twice, airing, and placing in an incubator for dark culture overnight at 25 ℃. The mycelium can be spread over the whole plate in 3-4 days by the method, and the growth vigor is good. Whereas it takes 15 days with the conventional culture method.
Example 3: hs-f strain pathogenicity identification method
Respectively sterilizing and washing infected fresh peanut seeds, peanut seedling root systems, peanut seedling stem parts, peanut seedling cotyledon and peanut leaves, carrying out minimally invasive treatment, placing the treated peanut seeds, peanut seedling root systems, peanut seedling cotyledon and peanut leaves into a culture dish, and inoculating a pathogenic fungus mycelium block with the diameter of 0.3cm to realize co-culture of peanut tissues and pathogenic fungi. Dark culture is carried out in an incubator at 25 ℃, and infection pathogenic conditions are observed and counted after 5 days: the inoculated fresh seeds and other tissues have yellow and black inoculated points to decay and spread.
Hs-f bacteria have strong pathogenicity on peanut tissues and fresh seeds, wherein the pathogenicity rate on fresh peanut seeds, seedling roots, seedling stems, seedling cotyledons and leaves exceeds 50%, and the Hs-f bacteria have strong pathogenicity.
The pathogenicity of the pathogen to each tissue of the peanut is counted as follows:
TABLE 1 Hs-f pathogenicity to various tissues of peanut
| Tissue of | Pathogenicity |
| Fresh peanut seed | Over 80 percent |
| Root system of seedling | Over 50 percent |
| Stem of seedling | Over 80 percent |
| Seedling cotyledon | Over 90 percent |
| Peanut leaf | Over 50 percent |
The pathogenicity identification contrast test is carried out on the bacterium block cultured by the traditional method and the method, and the result shows that the pathogenicity of the bacterium block cultured for 4 days is stronger on peanut cotyledons than that of the bacterium block cultured for 15 days by the traditional method, and the lesion spots formed at the inoculation point are larger; the scab formed at the inoculation point is larger at the stem part of the peanut; compared with the traditional method, the pathogenicity of the fresh seeds, the peanut leaves and the peanut roots is not obviously changed.
The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.
Sequence listing
<110> institute for peanut research in Shandong province
Qingdao city environmental sanitation development center
<120> Fusarium oxysporum and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 519
<212> DNA
<213> Fusarium oxysporum (Fusarium sp)
<400> 1
gatatgctta agttcagcgg gtattcctac ctgatccgag gtcaacattc agaagttggg 60
gtttaacggc gtggccgcga cgattaccag taacgagggt tttactacta cgctatggaa 120
gctcgacgtg accgccaatc aatttgagga acgcgaatta acgcgagtcc caacaccaag 180
ctgtgcttga gggttgaaat gacgctcgaa caggcatgcc cgccagaata ctggcgggcg 240
caatgtgcgt tcaaagattc gatgattcac tgaattctgc aattcacatt acttatcgca 300
ttttgctgcg ttcttcatcg atgccagaac caagagatcc gttgttgaaa gttttgattt 360
atttatggtt ttactcagaa gttacatata gaaacagagt ttaggggtcc tctggcgggc 420
cgtcccgttt taccgggagc gggctgatcc gccgaggcaa caagtggtat gttcacaggg 480
gtttgggagt tgtaaactcg gtaatgatcc ctccgcagg 519
Claims (7)
1. A Fusarium oxysporum strain, which is Fusarium oxysporum Hs-f (Fusarium sp.) and is deposited in 29 months in 2019 on the following days: the China general microbiological culture Collection center (CGMCC) has a collection number of CGMCC NO:18130 and an address of: west road No.1, north zhou yang ward, beijing, the requested depository is peanut institute of shandong province.
2. The Fusarium oxysporum of claim 1, wherein the Fusarium oxysporum is isolated from a rot disease peanut material at a Laisia glauca peanut production testing facility.
3. The Fusarium oxysporum of claim 1, having a colony morphology of: the aerial hyphae are white flocculent, the culture medium is changed from red to purple red during 30 days of culture, a plurality of loose flocculent sclerotia with the diameter of 1.5 mm are generated on the aged hyphae, and two conidia, namely a large sickle-shaped conidium and a small oval conidium, are generated.
4. The Fusarium oxysporum of claim 1, wherein the Fusarium oxysporum ITS sequence is set forth in SEQ ID No. 1.
5. The Fusarium oxysporum of claim 1, wherein the Fusarium oxysporum is highly pathogenic to peanut rot and is tissue-free.
6. The Fusarium oxysporum of claim 1, wherein the pathogenicity of the Fusarium oxysporum to peanuts is: the stem rot rate reaches more than 50%, the fruit rot rate reaches more than 50%, and the root rot rate reaches more than 30%.
7. Use of Fusarium oxysporum of any one of claims 1-6 in screening of disease-resistant germplasm of peanut.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911087485.1A CN110616157B (en) | 2019-11-08 | 2019-11-08 | Fusarium oxysporum and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911087485.1A CN110616157B (en) | 2019-11-08 | 2019-11-08 | Fusarium oxysporum and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110616157A true CN110616157A (en) | 2019-12-27 |
| CN110616157B CN110616157B (en) | 2020-11-24 |
Family
ID=68927443
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911087485.1A Active CN110616157B (en) | 2019-11-08 | 2019-11-08 | Fusarium oxysporum and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110616157B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111471794A (en) * | 2020-05-06 | 2020-07-31 | 兰州百源基因技术有限公司 | Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium graminearum |
| CN112159763A (en) * | 2020-09-17 | 2021-01-01 | 中国医学科学院药用植物研究所云南分所 | Bacterial strain of pathogenic bacteria of winter jasmine seedling blight and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014078900A1 (en) * | 2012-11-23 | 2014-05-30 | Hexima Limited | Anti-pathogenic methods |
| CN106119155A (en) * | 2016-06-24 | 2016-11-16 | 中国科学院南京土壤研究所 | For preventing and treating bacterial strain WXX 2 and the microbial inoculum of Roots of Peanut maize ear rot |
-
2019
- 2019-11-08 CN CN201911087485.1A patent/CN110616157B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014078900A1 (en) * | 2012-11-23 | 2014-05-30 | Hexima Limited | Anti-pathogenic methods |
| CN106119155A (en) * | 2016-06-24 | 2016-11-16 | 中国科学院南京土壤研究所 | For preventing and treating bacterial strain WXX 2 and the microbial inoculum of Roots of Peanut maize ear rot |
Non-Patent Citations (3)
| Title |
|---|
| M. I. OSUINDE AND O. O. DAIBO: "Wilt disease of Arachis hypogaea L. in Ekpoma, Edo", 《AUSTRALIAN JOURNAL OF EXPERIMENTAL AGRICULTURE》 * |
| S. AYO ODUNFA: "Fusarium species associated with groundnut fruit and soil in Nigeria", 《TRANSACTIONS OF THE BRITISH MYCOLOGICAL SOCIETY》 * |
| 车建美 等: "尖孢镰刀菌(Fusarium oxysporum) 培养特性的研究", 《华东六省一市生物化学与分子生物学学会2006年学术交流会》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111471794A (en) * | 2020-05-06 | 2020-07-31 | 兰州百源基因技术有限公司 | Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium graminearum |
| CN112159763A (en) * | 2020-09-17 | 2021-01-01 | 中国医学科学院药用植物研究所云南分所 | Bacterial strain of pathogenic bacteria of winter jasmine seedling blight and application thereof |
| CN112159763B (en) * | 2020-09-17 | 2022-03-22 | 中国医学科学院药用植物研究所云南分所 | Bacterial strain of pathogenic bacteria of winter jasmine seedling blight and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110616157B (en) | 2020-11-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110616157B (en) | Fusarium oxysporum and application thereof | |
| CN111073827B (en) | Bacillus beilesensis JTB8-2 and application thereof in biological control of orobanche meloidogyne | |
| CN109749953B (en) | Bacillus cereus, microbial inoculum and preparation method and application thereof | |
| CN104450551A (en) | Bacillus subtilis DPPG-26 for preventing and treating damping off and application thereof | |
| CN114164137B (en) | Streptomyces diastochromogenes for resisting banana vascular wilt and application thereof | |
| CN106119134B (en) | Helminthosporium flavum Y28 and application thereof in preventing and treating fruit tree rot | |
| CN114806896A (en) | Alternaria alternata, herbicide and application thereof | |
| CN112280709B (en) | Streptomyces and streptomyces secondary metabolite Nanchangmycin and preparation method and application thereof | |
| CN107858300B (en) | Bacillus amyloliquefaciens 2YN11 for disease prevention, growth promotion, quality improvement and stress resistance of tomatoes and application thereof | |
| CN110643551B (en) | Stenotrophomonas rhizophila S11 for preventing and treating rice blast and application thereof | |
| CN111363691B (en) | Paenibacillus polymyxa and application thereof | |
| CN108587969B (en) | Preparation and application of verticillium dahliae strain HCX-01 capable of preventing and treating cotton verticillium wilt | |
| CN114032182B (en) | Fungus with functions of antagonizing pathogenic bacteria of garlic root rot and promoting growth | |
| CN108441443B (en) | Strain for preventing and treating plant nematodes and application thereof | |
| CN110669819A (en) | Method for identifying pathogenicity of peanut rot pathogenic fungi | |
| CN114292759B (en) | Fusarium oxysporum with function of preventing and treating tobacco continuous cropping obstacle | |
| CN113832038B (en) | Fusarium equisetum (Fusarium equiseti) K2017-696 and application thereof | |
| CN110699264B (en) | Rapid culture method of pathogenic fungi of peanut rot | |
| CN107325973B (en) | Beauveria bassiana strain with strong pathogenicity on corylus avenae sinensis and application thereof | |
| CN115537358A (en) | Bacillus belgii YFB3-1 and separation, screening and identification method and application thereof | |
| CN116240126A (en) | Multifunctional bacillus belgium SB10 and application thereof | |
| CN112063558B (en) | Pseudomonas strain and application thereof | |
| CN111304135B (en) | Bacillus and application thereof in plant disease control | |
| CN110982764A (en) | Bacillus tequilensis S12 for preventing and treating rice blast and application thereof | |
| CN114107132B (en) | Bacillus subtilis strain HM-1 and microbial agent and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |