CN109452089B

CN109452089B - White beech mushroom H7 and cultivation method thereof

Info

Publication number: CN109452089B
Application number: CN201811139186.3A
Authority: CN
Inventors: 余荣琳; 黄志勇; 胡卫红; 于潇
Original assignee: SHANGHAI XUERONG BIOTECHNOLOGY CO Ltd
Current assignee: SHANGHAI XUERONG BIOTECHNOLOGY CO Ltd
Priority date: 2018-09-28
Filing date: 2018-09-28
Publication date: 2020-11-24
Anticipated expiration: 2038-09-28
Also published as: CN109452089A

Abstract

The invention relates to the field of edible fungi, in particular to white beech mushroom H7 and a cultivation method thereof. The white beech mushroom H7 obtained by the method can be well adapted to the white beech mushroom liquid strain production mode, has obvious effects on shortening the fruiting period, improving the yield per unit, optimizing the product form and the like, and fills the blank of the white beech mushroom liquid strain cultivation mode. Compared with the white beech mushroom on the market, the white beech mushroom H7 has the following advantages: 1. the spawn running speed in the culture dish is fastest, the high-temperature resistance is best, and the growth vigor in the later culture period is also best; 2. preliminarily judging that the white beech mushroom H7 and other tested varieties are different white beech mushroom varieties through an antagonistic experiment; 3. in the culture and culture fruiting stage, the total culture period is shortest, the yield is highest, and the average yield per unit is more than 250 g/1100 mL; 4. in the aspect of agronomic characters, the H7 strain provided by the invention has the advantages of large primordium quantity, long and thin stipe, easy growth and high growth, and round and white mushroom cap.

Description

White beech mushroom H7 and cultivation method thereof

Technical Field

The invention relates to the field of edible fungi, in particular to white beech mushroom H7 and a cultivation method thereof.

Background

The white beech mushroom is called white snow mushroom, white crab-taste mushroom, white hypsizigus marmoreus and white beech mushroom, belongs to Agaricales, Tricholomataceae and white mushroom, and is a rare edible mushroom. The white beech mushroom body is white as jade and is crystal clear; the texture is fine and smooth, and the mushroom body is crisp, tender, fresh and smooth, and is fresh, sweet and delicious.

The white beech mushroom has higher protein content than common vegetables, proper proportion of essential amino acid, and a plurality of trace elements and other substances essential to human body, and is eaten for a long time in order to play a good health care role. The Hypsizygus marmoreus has effects of relieving pain, tranquilizing, relieving cough, eliminating phlegm, relaxing bowels, removing toxic substance, and lowering blood pressure. The white beech mushroom is rich in nutrition, contains a large amount of polysaccharide and various vitamins, can improve the metabolism of a human body and reduce the content of cholesterol after being eaten frequently, and the effective components of the white beech mushroom can enhance the function of T lymphocytes, so that the immunity of the body for resisting various diseases is improved. Brazil research shows that one substance extracted from Hypsizygus marmoreus has the effects of relieving pain and tranquilizing, and the analgesic effect can replace morphine. Animal experiments show that the white beech mushroom extract has obvious effects of relieving cough and diluting sputum. The fresh product has a value as high as 30 to 40 yuan, is known as 'golden branch and jade leaf' in edible fungi, and has wide cultivation prospect and market potential.

The shape of the mushroom body: the fruiting bodies are clustered, 15-50 plants in each cluster are different, and the seedlings are scattered less. When the pileus is young, the pileus is hemispherical and dark brown, and then the pileus is gradually flattened and the color becomes light and yellow brown; dark middle part, dark brown; the cover surface is smooth and has 2-3 circles of stripes; the cover edge is flat or slightly bent downwards and is slightly wavy; the diameter of the pileus is 1.5-2.0 cm; the mushroom meat is white, tough and crisp in texture and compact. The fungal folds are white to light yellow, curvy, and sometimes slightly straight, dense, unequal in length, and distant. The stipe is middle-growing and cylindrical, the length of the stipe is 3-12 cm, the lower part of the stipe obviously expands when young, the stipe is white to grey white, the thickness of the stipe is O.5-3.5 cm, the upper part of the stipe is thin and the lower part of the stipe is thick, the upper part and the lower part of the stipe are almost the same when the stipe fully grows, most of the stipe is slightly bent, and the stipe has yellow brown stripes, is. Basidiospores are colorless, smooth, spherical, and white in spore impression. Conidia are white and appear at the end of aerial hyphae when culture conditions are not suitable.

Hypha characteristics: the white beech mushroom hypha grows vigorously and grows quickly, the dark brown strain has strong anti-infectious bacteria capability, and the white strain has weak pest and disease resistance capability. Mature old hyphae can secrete yellow droplets to form mycoderm. The hyphae on the slant culture medium are thick white, aerial hyphae are vigorous, the wall climbing capability is strong, and the hyphae are light soil gray after aging. The culture conditions are suitable, and hyphae grow over the test tube inclined plane for 7-10 days; when the conditions are not suitable, the fruit body is not easily formed.

And (3) a development process: the white beech mushroom is typical heterogeneous combined edible mushroom, basidiospores germinate into mononuclear hyphae under appropriate conditions, the compatible mononuclear hyphae are fused, protoplasm is mated to form binuclear hyphae, and the binuclear hyphae is twisted to form primordia under appropriate conditions, so that mature sporocarp is developed. According to the morphological characteristics of different development stages of the fruiting body, the fruiting body can be artificially divided into a color conversion stage, a mushroom bud stage, a white stage, a cap stage, a stretching stage and a maturation stage.

The white beech mushroom mycelium in the color conversion period grows in the culture container to physiological maturity and then has the fructification capability, and the fungus block in the container is converted from pure white to gray. Before the differentiation of the fruit body, a thin layer of tile-gray or soil-gray short velvet appears on the surface of the culture material, so the color transition period is called. The period lasts for 3-4 days under proper conditions.

3-4 days after the color of the culture material surface in the bud period is changed, hypha of the short velvet layer starts to kink to form verrucous bulges, and then the crock needle-shaped mushroom buds develop. Culturing for 2-3 days under proper conditions, and entering a whitening period when the length reaches 0.5-1 cm.

In the whitening period, as the mushroom buds grow, a small white point appears at the tips of the mushroom buds and gradually grows up to form a circular white plane with the diameter of 1-3 mm, and the circular white plane is a primary pileus. This phase is called the blooming period.

After the primary pileus grows and develops for 2-3 days in the cap forming period, the white plane begins to bulge, and the color begins to turn deep. And forming complete pileus after 3-4 days, wherein the diameter of the pileus is 3-5 mm, the pileus is deep ochre, small water drops are densely distributed at the edge, the top end of the pileus appears netted stripes, and the stipe begins to extend and thicken.

After the pileus of the fruiting body in the extension stage is formed, the growth speed is accelerated, the pileus is quickly flattened and thickened, the color of the pileus is lightened, and the stipe is quickly elongated and thickened.

At present, most of white beech mushrooms in the market are cultivated and grown by utilizing solid strains in industrialized production, and the cultivation mode has the defects of longer cultivation period and general yield.

Disclosure of Invention

In view of the above, the invention provides white beech mushroom H7 and a cultivation method thereof. The white beech mushroom new variety 'Xueyan white beech mushroom H7' obtained by systematic breeding can be well adapted to the white beech mushroom liquid strain production mode, has obvious effects on shortening fruiting period, improving unit yield, optimizing product form and the like, and fills the blank of the white beech mushroom liquid strain cultivation mode.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides white beech mushroom, the preservation number of which is CGMCC No. 14987.

The invention also provides application of the white beech mushroom in preparing medicaments for easing pain, tranquilizing, relieving cough and reducing sputum, relaxing bowels and expelling toxin and/or reducing blood pressure. The white beech mushroom has higher protein content than common vegetables, proper proportion of essential amino acid, and a plurality of trace elements and other substances essential to human body, and is eaten for a long time in order to play a good health care role. The Hypsizygus marmoreus has effects of relieving pain, tranquilizing, relieving cough, eliminating phlegm, relaxing bowels, removing toxic substance, and lowering blood pressure. The white beech mushroom is rich in nutrition, contains a large amount of polysaccharide and various vitamins, can improve the metabolism of a human body and reduce the content of cholesterol after being eaten frequently, and the effective components of the white beech mushroom can enhance the function of T lymphocytes, so that the immunity of the body for resisting various diseases is improved. Brazil research shows that one substance extracted from Hypsizygus marmoreus has the effects of relieving pain and tranquilizing, and the analgesic effect can replace morphine. Animal experiments show that the white beech mushroom extract has obvious effects of relieving cough and diluting sputum. The fresh product has a value as high as 30 to 40 yuan, is known as 'golden branch and jade leaf' in edible fungi, and has wide cultivation prospect and market potential.

On the basis of the technical scheme, the invention also provides the liquid culture medium for the white beech mushroom, and 10L of the culture medium comprises:

on the basis of the technical scheme, the invention also provides the white beech mushroom cultivation medium which comprises the following components in parts by mass:

on the basis of the technical scheme, the invention also provides a system breeding method of the white beech mushroom, which comprises the steps of taking an original strain, carrying out hypha grafting, culturing, scratching, bud forcing and fruiting body growth, selecting fruiting body tissues with good mushroom shapes, separating and inoculating the fruiting body tissues into a PDA culture medium, and selecting strains with high yield, robust mushroom bodies and good mushroom shapes to obtain the white beech mushroom.

On the basis of the technical scheme, the invention also provides a white beech mushroom culture method, and the white beech mushroom is inoculated into a culture medium for culture.

In some embodiments of the invention, the culturing comprises hyphal inversion, shake flask culture, fermentor culture, and culture flask culture.

In some embodiments of the invention, the hyphae are inoculated in a PDA culture medium, the inoculation amount of the white beech mushroom is 1 fungus block, the size of the fungus block is 5 × 3mm, and the number of the viable bacteria is about 7500 cfu/g.

In some embodiments of the present invention, the shake flask culture uses the liquid medium of the present invention, the amount of inoculated white beech mushroom is 4 pieces, each piece has a size of 5 × 3mm, and the viable count is about 7500 cfu/g.

In some embodiments of the present invention, the liquid medium of the present invention is used for the fermentor culture, the inoculation amount of the Hypsizygus marmoreus is 600mL of bacterial liquid, and the viable count is about 8300 cfu/mL.

In some embodiments of the invention, the cultivation medium of the invention is used for cultivation in the cultivation bottle, the inoculation amount of the white beech mushroom is 20mL of bacterial liquid, and the number of the living bacteria is about 8300 cfu/mL.

In some embodiments of the present invention, the shake flask culture temperature is 21-23 ℃ and the culture rotation speed is 160 rpm/min; the cultivation time was 8 days.

In some embodiments of the present invention, the temperature of the fermentation tank is 22-23 ℃ and the cultivation time is 7 days.

In some embodiments of the invention, the cultivation bottle is cultured at 21-23 deg.C, 65-70% humidity and CO₂Culturing for 70-90 days under the condition of 2000-3000ppm concentration.

In some embodiments of the present invention, the mushroom fruiting condition is: the temperature is 14-16 ℃, the humidity is 95% -100%, and CO₂The concentration is below 2000 ppm.

In some embodiments of the invention, the conditions for inducing budding are: the temperature is 14-16 ℃, the humidity is 90-95 percent, and CO is₂The concentration is less than 2000ppm, the illumination intensity is 50 lux-100 lux, and the bud-forcing time is 810 days.

In some embodiments of the invention, the conditions under which the fruiting body grows are: the temperature is controlled to be 14-17 ℃, the humidity is more than 90 percent, and CO is₂The concentration is below 2000ppm, the illumination intensity is 250-500 lux, and the growth time is 12-17 days.

The white beech mushroom new variety 'Xueyan white beech mushroom H7' obtained by systematic breeding can be well adapted to the white beech mushroom liquid strain production mode, has obvious effects on shortening fruiting period, improving unit yield, optimizing product form and the like, and fills the blank of the white beech mushroom liquid strain cultivation mode.

Compared with white beech mushroom on the market, the white beech mushroom H7 of Xueyan has the following advantages:

1. the white beech mushroom H7 provided by the invention has the advantages of fastest spawn running speed, best high temperature resistance and best growth vigor in the later culture period in a culture dish;

2. preliminarily judging that the white beech mushroom H7 of ficus microcarpa and other tested varieties are different white beech mushroom varieties through an antagonistic experiment;

3. in the culture and fruiting stage, the white beech mushroom H7 of ficus microcarpa has the shortest total culture period and the highest yield, and the average yield per unit is more than 250 g/1100 mL;

4. in the aspect of agronomic characters, the white beech mushroom H7 of ficus microcarpa provided by the invention has the advantages of large primordia, long and thin stipe, easy growth and high growth, and round and white mushroom cap.

Biological preservation Instructions

Biological material: h7; and (3) classification and naming: hypsizigus marmoreus (Hypsizygus marmoreus); and the strain is preserved in the China general microbiological culture Collection center in 2017, 12 and 04 months, wherein the preservation center addresses are as follows: the institute of microbiology, national academy of sciences No.3, Xilu No.1, Beijing, Chaoyang, Beijing; the preservation number is CGMCC No. 14987.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows the systematic breeding process of white beech mushroom H7 provided by the present invention;

FIG. 2 shows a process flow of the production of white beech mushroom H7 provided by the present invention;

FIG. 3 shows the comparison results of the bacterial growth rates of 4 white beech mushroom strains at different temperatures;

FIG. 4 shows the morphology of hyphal growth at different temperatures for 4 strains;

FIG. 5 shows antagonism among 4 strains;

FIG. 6 shows a genomic DNA electropherogram of Pleurotus nebrodensis H7 provided by the present invention;

FIG. 7 shows an ITS phylogenetic tree of Pleurotus nebrodensis H7 strain provided by the present invention;

FIG. 8 shows the white beech mushroom H7 strain provided by the present invention.

Detailed Description

The invention discloses white beech mushroom H7 and a cultivation method thereof, and a person skilled in the art can appropriately improve process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The term of art:

scratching fungi: the old strain blocks and the fungus skin are removed by a mycelium stimulation machine (or manually), which is an important measure for promoting the mycelium to generate primordium, and the fruiting bodies can be regularly generated from the surface of a culture medium by the mycelium stimulation

Fruiting body: is the spore-forming structure of higher fungi, i.e. fruit body, and is composed of organized mycelium. Basidiomycetes are called Basidiomycetes and ascomycetes are called ascomycetes. Whether sexual reproduction or asexual reproduction, whether simple or complex in structure, the spore-forming structure is called a sporophore.

Primordia: before the edible mushrooms grow out, the hyphae are twisted to form a small particle, and the grown small particle is a mushroom.

Hypha: a single tubular filament, the structural unit of most fungi, and some prokaryotes also have hyphae, such as actinomycetes.

Mycelium: many hyphae aggregate together to form the trophozoite of the fungus, i.e., the mycelium.

Mutation breeding: a breeding method for generating variation in DNA molecules of gene carrier by physical or chemical factors, and selecting and using the variation. Physical factors such as ultraviolet light, x-rays, r-rays, isotope Co60, laser, and the like. Chemical mutagens act directly on DNA molecules and can be generally classified into three main groups according to their chemical properties or mode of action: (1) base analogues such as 5-bromouracil and a-aminopurine; (2) mutagens that change the base structure of DNA, such as nitrous acid, diethyl sulfate, ethyl methanesulfonate, nitrosoguanidine, etc.; (3) the frame shift mutagens, such as acridines, pyridines, polycyclic hydrocarbons, nitrogen heterocyclic carcinogens, mycotoxins, antibiotics, are the most studied acridines.

The protoplast fusion technology is a process of fusing protoplasts of two cells with different genetic traits by a manual method so as to obtain a stable recombinant with parental genetic traits.

Material

Test strains

H1: the white beech mushroom of Fengke has been recognized as a Shanghai city

H4: original strain of Hypsizygus marmoreus introduced in Japan

H7: is prepared from H4 through systematic selection and breeding, white beech mushroom H7

H11: hypsizygus marmoreus strain provided by Japan

Culture medium

PDA culture medium: peeled potato 200g, glucose 20g, agar 20g, adding distilled water to 1000mL, natural pH.

Liquid culture medium: 200g of white granulated sugar, 30g of soybean meal, 1g of monopotassium phosphate, 0.5g of magnesium sulfate and 10L of tap water, wherein the pH is natural.

Cultivation medium: 53.5 percent of corncob, 10 percent of cottonseed hull, 20 percent of rice bran, 10 percent of bran, 5 percent of corn flour, 1.5 percent of additive, 850 grams of filling weight 830 and 64 to 66 percent of water content.

The raw material requirements are as follows: the raw materials for the industrial cultivation of white beech mushroom mainly comprise corncob, cottonseed hull, bran, rice bran, corn flour and the like. The raw materials must be kept fresh and dry, and the raw materials are free from worm damage and mildew, and the granularity meets the requirements of equipment and technology. Ventilating in the process of storing raw materials, and keeping the storage environment dry.

Mixing raw materials: accurately quantifying according to the formula requirement, fully and uniformly stirring the materials, and adding water until the water content reaches 64-66 percent and the pH value is 6.5-7.0. And adjusting the stirring time according to seasonal changes to prevent the mixture from rancidity, and stirring until bottling is finished.

Bottling: the high-temperature resistant plastic bottle is used, the filling compactness is required to be uniform, the filling amount of the 1100mL plastic bottle is 830-850g, the middle part is perforated to the bottom of the bottle, and the bottle cap is covered immediately after the bottle is filled.

And (3) sterilization: autoclaving was carried out immediately after bottling. The sterilization time is that the central temperature of the material must reach 118-121 ℃ and be kept for 30 minutes, and all microorganisms and spores in the culture material must be killed thoroughly.

And (3) cooling: after sterilization, the bottle frame is pushed into a cooling chamber for forced cooling, and the cooling chamber and the inoculation chamber are provided with a purification device and refrigeration equipment.

The white beech mushroom and the raw materials and reagents used in the culture method thereof provided by the invention can be purchased from the market.

The invention is further illustrated by the following examples:

example 1 preparation of liquid seed

And (3) sterilization: after the liquid culture medium is prepared, putting the liquid culture medium into a vertical sterilizing pot for sterilization, wherein the sterilization process comprises the following steps: and keeping the temperature at 121 ℃ for 60 minutes. After sterilization, the liquid culture medium is placed in a clean area for cooling, and inoculation can be carried out after the liquid culture medium is cooled to 18-22 ℃;

inoculation: the ultra-clean workbench is opened for 30min, the ultraviolet lamp is opened for 30min, then a person wears the special clean clothes for inoculation, wears a mask and medical gloves, wears clean zone work shoes, enters the clean zone after air showering, and is operated aseptically on the ultra-clean workbench (note: all tools are sterilized by high-temperature high-pressure steam). Inoculating the selected plate seeds into a shake flask by using an inoculation tool,

tearing off a sealing film of a selected plate strain to be used → tearing off a plate cover by a cover-tearing clamp → clamping the plate by a clamp of a plate-supporting clamp → scraping off aerial hyphae on the surface of the plate by an inoculation hook → uniformly punching by a puncher → fixing the plate in the clamp of the plate-supporting clamp → placing on a tripod → igniting the inoculation hook → placing on a tool rack for cooling → taking off aluminum platinum paper, taking off a bottle stopper of a shake flask by crucible tongs, placing on the tool rack → taking 4 small pieces of mother seeds from the upper part, the lower part, the left part and the right part of the plate by the inoculation hook respectively, placing on the shake flask → the bottle stopper, sealing the aluminum platinum paper → finishing inoculation, and recording strain batch numbers and inoculation dates.

Culturing: placing the inoculated strains into a shaking table for shake culture, placing the well inoculated shake flasks into a shake culture device for culture, wherein the culture temperature is as follows: 22 +/-1 ℃, culture rotation speed: 160 rpm/min; culturing time: and 8 days, taking out after the culture is finished, and preparing for inoculation and cultivation.

Example 2 cultivar preparation

Each strain is made into 10 baskets, 480 bottles are totally reserved, 1 basket is randomly drawn after mycelium stimulation, agronomic characters such as mycelium color change, primordium bud development time, primordium quantity, uniformity, harvesting time and the like are observed, and average unit yield is calculated after all the strains are harvested.

The culture material is uniformly stirred and then is filled by a bottling machine, the weight of each bottle of 1100mL plastic bottles is 850g of 830 materials, the water content is adjusted to 64% -66%, the pH value is adjusted to 6.5-7.0, the high-temperature sterilization is carried out, the temperature is kept at 100 ℃ for 60min, the temperature is increased to 121 ℃ for 60min, then the culture material is cooled to below 22 ℃ in a cooling chamber, white beech mushroom liquid strains are inoculated, and the inoculation amount is 15-20 mL. Then placing the mixture at the temperature of 21-23 ℃, the humidity of 65-70 percent and CO₂Culturing in culture room with concentration of 2000-3000ppm for 70-90 days, removing mycelium, culturing at 14-16 deg.C and humidity of 95% -100%, and culturing in CO₂And (4) fruiting in a growth room with the concentration of less than 2000ppm, irradiating the fruiting room with certain light during the period, harvesting after the fruiting standard is reached, and weighing. Various parameters are recorded.

The inoculation operator must meet the requirement of aseptic operation, the temperature in the bottle is controlled below 25 ℃ during inoculation, microscopic examination is used, the liquid strain is ensured to be pollution-free and vigorous, the liquid strain can be used for inoculation cultivation, the inoculation amount of each cultivation bottle is 20mL of bacterial liquid, the wet weight of the mycelium is about 2.4g/20mL, and the viable count is about 8300 cfu/mL.

Example 3 cultivation for growth and fruiting

Culturing: the temperature of the culture room is controlled to be 21 +/-2 ℃, the humidity is maintained to be 70-80 percent, and the concentration of CO2 is controlled to be below 4000 ppm. The culture time is 70-80 days.

Scratching fungi: after the culture is mature, mycelium stimulation treatment is carried out. A special mycelium stimulation tool bit is adopted, water is injected after mycelium stimulation, and the water injection amount is 15-20 mL.

Bud forcing: the indoor temperature is controlled to be 14-16 ℃, the humidity is controlled to be 90-95%, the concentration of CO2 is within 2000ppm, and the illumination intensity is 50-100 lux. The bud induction time is 8-10 days.

And (3) fruiting body growth: the temperature is controlled to be 14-17 ℃, the humidity is more than 90%, the concentration of CO2 is less than 2000ppm, the illumination intensity is 250-500 lux, and the light starting time is adjusted according to different growth stages. The growth time is 12-17 days.

Harvesting and packaging: the diameter of the pileus reaches 18mm, the length of the stipe reaches 80mm, and then the mushroom can be harvested. When in collection, the whole is collected, the culture medium is cut off, the whole is packed by an automatic packing machine and then is put into a cold storage, and the temperature of the cold storage is controlled between 3 ℃ and 5 ℃.

Digging a bottle: the harvested bottle frames are timely transported to a bottle digging area, the culture materials are dug, the empty bottle baskets are transported to a bottling area to be reused, and the waste materials are cleared and delivered out of the factory.

Example 4 hyphal growth characteristics of different Hypsizygus marmoreus varieties at vegetative growth stage

There was a significant difference in the growth rate of the 4 different white beech mushroom strains tested in the petri dishes (see fig. 3). The cultivation temperature is the fastest at 20-26 ℃, the strain of white beech mushroom H7 is the fastest, the high temperature resistance is the strongest among 4 strains, the strain of H11 is the fastest at 24 ℃, the strain growing speed is rapidly reduced along with the temperature rise, and hypha does not germinate at 30 ℃.

Example 5 differences in hyphal morphology after 10 days of culture

After the hyphae are cultured for 10 days, the hyphae grow at different temperatures (see figure 4), the strain of the white beech mushroom H7 with ficus microcarpa has the fastest spawning speed, and the aerial hyphae of the hyphae are less.

Example 6 hyphal antagonism between different strains

As seen from FIG. 5, the antagonistic lines between different strains were very obvious, indicating that the strains were very different, and the strains were preliminarily judged to be different white beech mushroom strains.

Example 7 comparison of different strains during cultivation and cultivation

As can be seen from Table 1, the total cultivation period of the "white beech mushroom H7" strain is the shortest, is 103 days, and has the highest yield. Other varieties have insufficient hypha density during spawn running, and the corncob formula and liquid spawn adopted by a company are not suitable for the strains, so that the spawn running is poor and the yield is low.

TABLE 1 development of fruiting bodies of different strains of Hypsizigus marmoreus after scratching

Note:^*h7 was shown to have a significant difference (P < 0.05) compared to the other groups;^#h7 was shown to have a very significant difference (P < 0.01) compared to the other groups.

As can be seen from Table 1, the yield per unit of variety "H7" is significantly higher than the yield per unit of the other three varieties, and on average is higher than 72.33 g/bottle, wherein the most significant differences are that the yield per unit of variety "H1" is higher than the yield per unit of variety "H7" is higher than the yield per unit of variety "H1" 95 g/bottle.

TABLE 2 Productivity of different Hypsizigus marmoreus strains

TABLE 3 independent sample Biometrics test results

The yield per unit data of the variety H7, the variety H1, the variety H4 and the variety H11 are analyzed by using a biometric software spss to obtain a graph 8, the yield per unit data of the variety H7, the variety H1, the variety H4 and the variety H11 are analyzed by using the biometric software spss to obtain the graph 8, and compared with a control bacterium, the yield per unit of the variety H7 is very different (P is less than 0.01).

Example 8 traits of different cultivars

The quality of the agronomic characters is directly related to the quality of the white beech mushroom as a commodity and the cost of an edible fungus factory. The white beech mushroom variety of ficus microcarpa H7 of the patent application is obviously improved in yield compared with the original strain, the average yield is more than 250 g/1100 mL, and from the aspect of product form, the number of primordia of the H7 strain is large, and the stipe is long and thin and is easy to grow.

TABLE 4 agronomic traits of different white beech mushroom strains

Example 9 molecular characterization of "white Hypsizygus marmoreus H7 of snow Ficus

Variety for test

BY1-H1, Hypsizygus marmoreus strain of Fengke

BY2-H4, starting strain of Hypsizygus marmoreus introduced in Japan

BY3-H7, and is obtained BY H4 system breeding

BY4-H11, introduced white beech mushroom strain in Japan

Test culture medium, reagent and preparation method

(1) PDB liquid medium: 200g of peeled potatoes, 20g of glucose and distilled water to a constant volume of 1L.

(2) Genomic DNA extraction reagent:

LETS buffer LiCl0.424g, EDTA 0.372g, Tris 0.242g, SDS 0.5g (the above reagents are weighed, dissolved in 90ml of sterile redistilled water, the pH value is adjusted to 7.8-8.0 by HCl, finally the volume is determined to 100ml, protease K is added according to 50 mg: 100 ml)

PCI reagent phenol chloroform isoamyl alcohol (ratio 25: 24: 1)

(3) ITS amplification reaction reagent

The primer sequence is as follows: the ITS region was amplified using the fungal universal primer ITS1F (Gardes & Bruns,1993)/ITS4(White et al 1990) having the following sequence

ITS1F 5'-CTT GGT CAT TTA GAG GAAGTAA-3' (shown as SEQ ID No. 2)

ITS 45 '-TCC TCC GCT TAT TGA TAT GC-3' (shown as SEQ ID No. 3)

The primers were synthesized by England JunvyBiotechnology GmbH, and prepared into 10 μ M reaction solution, and subpackaged at-20 deg.C for use.

Agarose for electrophoresis (Spanish)

10 XPCR reaction buffer, 25mM MgCl₂TaqDNA polymerase (Promega)

10mM dNTP (Genview split)

(4) DNA gel recovery kit (Axygen)

Mainly using instruments

81-2 model produced by Shanghai Si le Instrument plant with constant temperature magnetic stirrer

Swing bed for Shanghai Yiheng

Sterilized pot SS-325, TOMY SEIKO CO.

Vacuum freeze dryer EDWARDS, 4K2-4L

PCR amplification apparatus Mastercycler Gradient (Eppendorf)

BIO-RAD (bipolar junction ionization-Radar) level plate electrophoresis instrument

Camera system Image Master VDS (Pharmacia Biotech)

Experimental methods

(1) Hypha culture and extraction of genomic DNA

Inoculating cultured strain (PDA) into PDY liquid culture medium, culturing at 25-28 deg.C under shaking (150r/min) for 7-9 days, collecting mycelium, washing with sterile ultrapure water for 2-3 times, freeze drying, and storing at low temperature. Genomic DNA was extracted using a modified LETS method. The method comprises the following specific steps:

placing the freeze-dried hyphae into a precooled sterile mortar for grinding, adding a proper amount of LETS buffer solution, centrifuging at 12000rpm and 4 ℃ for 20min

② taking the supernatant, adding the same volume of PCI reagent, gently mixing for more than 10min, 12000rpm, 4 ℃, centrifuging for 10min, and repeating the step for 3-4 times.

③ taking the supernatant, adding 2/3 volume of isopropanol precooled at minus 20 ℃, mixing evenly, placing in a refrigerator at minus 20 ℃ for a moment, and centrifuging for 10min at 10000rpm and 4 ℃.

Fourthly, washing the sediment for 2 times by using 75 percent ethanol and 10mM KAc, centrifuging for 5min at 10000rpm and 4 ℃.

Fifthly, adding pre-cooled 95% ethanol at-20 ℃ into the residual liquid after suction drying, gently mixing, centrifuging for 10min at 10000rpm and 4 ℃, and naturally drying.

Sixthly, adding a proper amount of TE buffer to dissolve the precipitate, and adding 2 mu l of RNase (1mg/ml) into water bath at 37 ℃ for 1h to remove RNA.

Seventhly, taking 2 mu l of DNA sample, and detecting the quality of the DNA by electrophoresis of 1% agarose gel.

(2) PCR amplification of ITS regions

Amplification reaction system (25. mu.l): 10 XPCR buffer 2.5. mu.l, MgCl2(25mmol/L) 2.0. mu.l, dNTP (10mmol/L) 0.5. mu.l, primers ITS1F/ITS4 (10. mu. mol/L) each 1. mu.l, Taq enzyme (5U/. mu.l) 0.25. mu.l, DNA template 10ng, made up with sterile double distilled water. The PCR reaction condition is 94 ℃ for 2 min; 15s at 94 ℃, 30s at 62 ℃, 1min at 72 ℃ and 30 cycles; 5min at 72 ℃.

After the reaction is finished, 10 mul of amplification product is taken, and the amplification product is subjected to 1.2 percent agarose gel electrophoresis, ethidium bromide staining and then is placed in a VDS gel imaging system for photographing.

(3) Purification of PCR amplification products

The PCR amplification product is electrophoresed through agarose, and agarose gel containing target bands is cut under an ultraviolet lamp.

② the weight of the gel was weighed, and the gel volume was converted from 1mg to 1. mu.l.

Thirdly, 3 times of volume of Buffer DE-A is added, after even suspension, the mixture is heated at 75 ℃ and mixed once every 2 to 3 minutes until the gel is completely melted for about 6 to 8 minutes (the gel block must be completely melted to fully release the DNA in the gel).

Fourthly, 50 percent of the volume of the Buffer DE-A is added into the Buffer DE-B and mixed evenly.

Fifthly, placing the DNA-prep Tube in 2ml Microfuge Tube, transferring the mixed solution in the step 5 into the DNA-prep Tube, and centrifuging at 12000g for 1 minute.

Sixthly, the filtrate is discarded, the DNA-prep Tube is placed back to the original 2ml Microfuge Tube, 500 ul of Buffer W1 is added, and 12000g is centrifuged for 1 minute.

Seventhly, filtrate is discarded, the DNA-prep Tube is placed back to the original 2ml Microfuge Tube, 700. mu.l of Buffer W2 added with absolute ethyl alcohol is added, 12000g is centrifuged for 1 minute, and the DNA-prep Tube is washed once by 700. mu.l of Buffer W2 by the same method.

(iii) placing the DNA-prep Tube back into the original 2ml Microfuge Tube, and centrifuging at 12000g for 1 minute. (9) The DNA-prep Tube was placed in another sterilized 1.5ml centrifuge Tube, and 25. mu.l of an eluate preheated at 65 ℃ was added to the center of the silica membrane, followed by standing at room temperature for 1 minute. The DNA was eluted by centrifugation at 12000g for 1 min.

And ninthly, taking 2 mu l of the sterile gun head, and detecting and recovering the effect through agarose gel electrophoresis.

(4) Sequencing of PCR amplification products of ITS region

Sequencing was performed by Shanghai Producer corporation.

(5) Accurate positioning of ITS sequences and construction of phylogenetic trees

The length of the ITS sequence is determined according to the ITS sequence data of the white beech mushroom existing in Genbank. The DNA sequence in the FastA format was subjected to alignment analysis using ClustalX 2.1 software. Using Hypsizygus tessulatus ITS sequence obtained after rearrangement as an external group, performing clustering analysis by using neighbor-join methods in MEGA 4.1 software, and establishing a phylogenetic tree based on ITS sequence

Results and analysis

(1) The effect of DNA extraction is shown in FIG. 6.

FIG. 1 shows that the quality of DNA is good and can completely meet the requirements of the test.

(2) ITS sequence alignment

The specific sequence is shown in the appendix (sequence alignment).

The ITS sequence length of the white beech mushroom is about 595bp determined by comparative analysis with related sequences in GenBank.

(3) Genetic distance between strains

TABLE 5 genetic distance of Hypsizygus marmoreus

	BY1	BY2	BY3	BY4	JN234835
						BY1
BY2	0.003
						BY3	0.002	0.002
BY4	0.002	0.002	0.000
						JN234835	0.000	0.003	0.002	0.002

As can be seen from Table 5, the genetic distances of the tested white beech mushroom strains are all very small, and the ITS sequences have very small differences, which indicates that the ITS sequences of the strains have slow evolution speed.

(4) Phylogenetic trees, see FIG. 7.

As shown in FIG. 7, BY1 has differences from BY2, BY3 and BY4, but the differences are small and close to the relation with Hypsizigus marmoreus JN234835 in GenBank.

(5) And (3) sequence alignment:

results of sequence alignment

1. ITS sequence alignment result of white beech mushroom

BY3TTGAATAAAC TTGTTTGGGT TGTTGCTGGC TCTTAGGAGCATGTGCACGC CTGACACATT

BY4............................................................

JN............................................................

BY2............................................................

BY1............................................................

BY3TTTACCACCT GTGCACCCTT TGTAGACCTG GAACACCTCTCGAGGTAACT CGGTTTGAGG

BY4............................................................

JN............................................................

BY2.............................................C..............

BY1............................................................

BY3 ATTGCCGCTG CTGAAAAGCC GGCTTTCCTT GCGTTCCCGGTCTATGTCTT TATATACCCC

BY4............................................................

JN............................................................

BY2............................................................

BY1............................................................

BY3 ATGAATGTAA CTGAATGTCT TTAATGGGCC TTAGTGCCTTTAAATCAAAT ACAACTTTCA

BY4............................................................

JN............................................................

BY2............................................................

BY1............................................................

BY3 ACAACGGATC TCTTGGCTCT CGCATCGATG AAGAACGCAGCGAAATGCGATAAGTAATGT

BY4............................................................

JN............................................................

BY2............................................................

BY1............................................................

BY3 GAATTGCAGA ATTCAGTGAATCATCGAATC TTTGAACGCACCTTGCGCTC CTTGGTATTC

BY4............................................................

JN............................................................

BY2............................................................

BY1............................................................

BY3 CGAGGAGCAT GCCTGTTTGAGTGTCATTAAATTCTCAACCTTTCCAGCTT TTATTAGCTT

BY4............................................................

JN............................................................

BY2............................................................

BY1............................................................

BY3 GGTCAGGCTT GGATGTGGGG GTTGCGGGCT TCTCAGAAGTCGGCTCTCCT TAAATGCATT

BY4............................................................

JN............................................................

BY2............................................................

BY1............................................................

BY3 AGCGGAACCT TTGTTGACCA GCTCTGGTGT GATAATTATCTACGCCATTG CGAAGCAGCT

BY4............................................................

JN............................................................

BY2............................................................

BY1............................................................

BY3 TTAATTATGG GGTTCAGCTT CTAACCGTCC CCTTCACGGGACAACTCTCT GACAT

BY4.......................................................

JN.....A.................................................

BY2.......................................................

BY1.....A................................................

2 DNA sequencing result of Pleurotus nebrodensis H7 (shown in SEQ ID No. 1)

TGCGGAAGGATCATTATTGAATAAACTTGTTTGGGTTGTTGCTGGCTCTTAGGAGCATGTGCACGCCTGACACATTTTTACCACCTGTGCACCCTTTGTAGACCTGGAACACCTCTCGAGGTAACTCGGTTTGAGGATTGCCGCTGCTGAAAAGCCGGCTTTCCTTGCGTTCCCGGTCTATGTCTTTATATACCCCATGAATGTAACTGAATGTCTTTAATGGGCCTTAGTGCCTTTAAATCAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTCCAGCTTTTATTAGCTTGGTCAGGCTTGGATGTGGGGGTTGCGGGCTTCTCAGAAGTCGGCTCTCCTTAAATGCATTAGCGGAACCTTTGTTGACCAGCTCTGGTGTGATAATTATCTACGCCATTGCGAAGCAGCTTTAATTATGGGGTTCAGCTTCTAACCGTCCCCTTCACGGGACAACTCTCTGACATTTTGACCT-CAAAT-CAGGTA-GGATTACCCGCTGAACTTAAGCATATCAAT

Although the ITS sequence comparison result and the phylogenetic tree of the white beech mushroom show that the 4 tested strains have no great difference in ITS sequence and have close relationship, the difference or even significant difference in the agronomic characters such as appearance, yield and the like of the fruiting bodies of the white beech mushroom under the artificial action, namely the difference among varieties, cannot be excluded.

Example 10 biological characteristics

Mycelium: the white beech mushroom H7 of Ficus microcarpa has vigorous growth, light and sparse hypha at 20-26 deg.C, rapid growth speed and strong high temperature resistance.

And (3) mushroom cap: the white beech mushroom H7 is in the shape of umbrella, is milk white, has light white stripes on the surface, has the same size, has the diameter of 12-22 mm, and has neat edge

And (3) pleating: the white ficus microcarpa H7 strain has white fungus folds, alternate lengths and direct growth relationship with fungus stalks.

Stipe: the white beech mushroom H7 strain has thick and long stipe, the diameter of the middle is 8-12 mm, the upper part is slightly thin and the lower part is slightly thick, the length of the stipe is 60-100 mm, the meat is crisp and tender, the growing relationship between the stipe and the pileus is middle, and the stipe is white or slightly yellowish.

Fruiting body: the fruiting body is clustered, the base parts are connected, the mushroom flesh is white, and no bitter taste is caused

Spore: the spore print is white, the spore producing capability is strong, the spore is in the shape of an egg sphere, and the diameter is about 5 micrometers.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Shanghai Xue banyan Biotech Ltd

<120> white beech mushroom H7 and cultivation method thereof

<130> MP1807302

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 660

<212> DNA

<213> H7(H7)

<400> 1

tgcggaagga tcattattga ataaacttgt ttgggttgtt gctggctctt aggagcatgt 60

gcacgcctga cacattttta ccacctgtgc accctttgta gacctggaac acctctcgag 120

gtaactcggt ttgaggattg ccgctgctga aaagccggct ttccttgcgt tcccggtcta 180

tgtctttata taccccatga atgtaactga atgtctttaa tgggccttag tgcctttaaa 240

tcaaatacaa ctttcaacaa cggatctctt ggctctcgca tcgatgaaga acgcagcgaa 300

atgcgataag taatgtgaat tgcagaattc agtgaatcat cgaatctttg aacgcacctt 360

gcgctccttg gtattccgag gagcatgcct gtttgagtgt cattaaattc tcaacctttc 420

cagcttttat tagcttggtc aggcttggat gtgggggttg cgggcttctc agaagtcggc 480

tctccttaaa tgcattagcg gaacctttgt tgaccagctc tggtgtgata attatctacg 540

ccattgcgaa gcagctttaa ttatggggtt cagcttctaa ccgtcccctt cacgggacaa 600

ctctctgaca ttttgacctc aaatcaggta ggattacccg ctgaacttaa gcatatcaat 660

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cttggtcatt tagaggaagt aa 22

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tcctccgctt attgatatgc 20

Claims

1. The white beech mushroom strain is characterized in that the preservation number is CGMCC No. 14987.

2. Use of white beech mushroom prepared with the white beech mushroom strain according to claim 1 for the preparation of a medicament for analgesia, sedation, cough suppression, sputum reduction, laxation, detoxification and/or hypotension.

3. The liquid culture medium of the strain of white beech mushroom according to claim 1, wherein 10L of the culture medium comprises:

200g of white granulated sugar

30g of soybean meal powder

Potassium dihydrogen phosphate 1g

Magnesium sulfate 0.5g

The balance of water.

4. The cultivation medium of the white beech mushroom strain according to claim 1, characterized by comprising the following components in parts by mass:

corncob 53.5 parts

10 portions of cottonseed hull

20 portions of rice bran

10 portions of bran

Corn flour 5 parts

Additive 1.5 parts

64-66 parts of water.

5. The method for systematic breeding of white beech mushroom strains according to claim 1, wherein the white beech mushroom strains are obtained by taking original strains, performing hypha grafting, culturing, scratching, inducing buds, growing fruiting bodies, selecting fruiting body tissues with good beech shapes, separating and inoculating the fruiting body tissues into a PDA culture medium, and selecting strains with high yield, robust bodies and good types.

6. A method for culturing the strain of white beech mushroom according to claim 1, characterized in that the strain of white beech mushroom according to claim 1 is inoculated into a culture medium for culture.

7. The method of claim 5, wherein the culturing comprises shake flask culturing, fermentor culturing, and culture flask culturing.

8. The method of claim 7, wherein said hyphae subculturing is performed using PDA medium, said Pleurotus cornucopiae strain is inoculated in 1 block, the block size is 5 x 3mm, and the viable count is 7500 cfu/g;

the shake flask culture adopts the liquid culture medium of claim 3, the inoculation amount of the white beech mushroom strain is 4 bacterium blocks, the size of each bacterium block is 5 x 3mm, and the number of the viable bacteria is 7500 cfu/g;

the liquid culture medium of claim 3 is adopted for the culture in the fermentation tank, the inoculation amount of the white beech mushroom strain is 600mL of bacterial liquid, and the viable count is 8300 cfu/mL;

the culture flask culture adopts the culture medium of claim 4, the inoculation amount of the white beech mushroom strain is 20mL of bacterial liquid, and the viable count is 8300 cfu/mL.

9. The method according to claim 8, wherein the shake flask culture is carried out at a culture temperature of 21-23 ℃ and a culture rotation speed of 160 rpm/min; the culture time is 8 days;

the culture temperature of the fermentation tank is 22-23 ℃, and the culture time is 7 days;

the cultivation in the cultivation bottle is carried out at the temperature of 21-23 ℃, the humidity of 65-70% and CO₂Culturing for 70-90 days under the condition of 2000-3000ppm concentration.

10. The method of claim 9, wherein the conditions for post-mycelium stimulation are: the temperature is 14-16 ℃, the humidity is 90-95%, the concentration of CO2 is within 2000ppm, the illumination intensity is 50-100 lux, and the bud forcing time is 8-10 days;

the conditions for the growth of the sporocarp are as follows: the temperature is controlled to be 14-17 ℃, the humidity is more than 90 percent, and CO is₂The concentration is below 2000ppm, the illumination intensity is 250-500 lux, and the growth time is 12-17 days.