CN117551742A - Melon DNA extraction method and identification method suitable for KASP detection - Google Patents

Abstract

The invention belongs to the technical field of genetic breeding, and discloses a melon DNA extraction method and an identification method suitable for KASP detection. The method removes the shell of melon seeds, adds 50ul A liquid (50mM NaOH+2%Tween20), and uses PCR instrument to heat bath at 99 degree centigrade for 2 minutes. After cooling to room temperature, adding an equal volume of solution B (100 mM Tris-HCl), and performing instantaneous centrifugation to fully mix the solution A and the solution B; diluting the AB mixture by 20 times, and then using the AB mixture for KASP typing. The invention uses the KASP primer with high efficiency and good parting effect of the amphiphilicity F1 screening and amplifying, is used for identifying the purity of the hybrid seeds, can obtain the identification result of the purity of the hybrid seeds of the muskmelon with high efficiency, high accuracy and low cost, and has wide application prospect in the fields of identifying the purity of the hybrid seeds, identifying the authenticity of germplasm, molecular marker assisted selective breeding, functional gene digging and the like.

Description

Melon DNA extraction method and identification method suitable for KASP detection

Technical Field

The invention belongs to the technical field of genetic breeding, and particularly relates to a melon DNA extraction method and an identification method suitable for KASP detection.

Background

Commercially planted melon seeds are hybrid seeds. Purity of hybrid seeds is an important index of seed quality, and insufficient purity will directly affect melon yield and quality. The rapid detection of the purity of the muskmelon hybrid seeds is an important factor influencing the internal control and marketing promotion of seed production enterprises, and the identification of the purity of the hybrid seeds in a short time, at low cost and with high quality has become an urgent need of the seed production enterprises. The purity of the traditional hybrid seeds is mainly identified by field morphological observation, the identification period is long, the cost is high, and the hybrid seeds are easily influenced by human factors and natural environment factors. The identification of the purity of the crop hybrid seeds by means of molecular markers is gradually accepted by people, and the second generation molecular markers represented by SSR have the advantages of good repeatability, co-dominant inheritance and the like, are widely applied to the identification of the purity of the crop hybrid seeds, but have the defects of difficult automatic detection, complicated genotype result acquisition and the like, and limit the popularization and application to a certain extent.

With the development of the resequencing technology and the molecular biology technology, the third generation molecular marker represented by SNP is widely adopted by a plurality of scientific research institutions in the field of molecular breeding due to the advantages of large number, wide distribution, easy automation of detection and the like. Efficient extraction of plant genomic DNA is an important prerequisite for the application of molecular markers and also influences genotype acquisitionAn important rate limiting step of efficiency. The extraction of plant genome DNA mainly adopts CTAB method, alkaline cracking method and the like. CTAB method has high DNA concentration and good quality, but has complex reagent, complicated operation, long time consumption and high cost, is unfavorable for batch and large-scale extraction of plant genome DNA, is not suitable for extraction of seed DNA, generally selects radicle, cotyledon or tender true leaf as an extraction material, and simultaneously uses mercaptoethanol _、 Chloroform and other toxic and harmful reagents have certain safety risks. Compared with the CTAB method, the currently reported alkaline cracking method has high efficiency, but the operation is still more complicated, the DNA extraction efficiency is affected, the general extraction quality is poor, and the KASP typing requirement cannot be met.

Disclosure of Invention

In order to overcome the problems in the related art, the disclosed embodiments of the present invention provide a melon DNA extraction method and an identification method suitable for KASP detection. In particular to a melon DNA extraction method suitable for KASP detection and application thereof in hybrid purity identification.

The technical scheme is as follows: a melon DNA extraction method suitable for KASP detection, the method comprising:

s1, removing shells of melon seeds, and placing kernels in a PCR tube;

s2, adding the solution A, and carrying out hot bath;

s3, cooling to room temperature, adding the equal volume of the liquid B, and centrifuging to fully mix the liquid A and the liquid B;

s4, diluting the mixed solution of the solution A and the solution B for KASP typing.

In S2, add solution a, including: 50ul of solution A was added, which was a mixture of 50mM NaOH and 2% Tween 20.

In S2, a hot bath comprising: the reaction mixture was subjected to a thermal bath at 99℃for 2 minutes using a PCR instrument.

In S3, solution B was 100mM Tris-HCl solution.

In step S4, the mixture of the liquid a and the liquid B is diluted 20 times.

The invention also aims to provide a method for identifying the purity of muskmelon hybrid seeds, which comprises the steps of screening and identifying KASP markers according to dilution of mixed liquor of A liquor and B liquor obtained by the muskmelon DNA extraction method suitable for KASP detection, and specifically comprises the following steps:

(1) 10 seeds of female parent and male parent of melon variety Nassmi are respectively taken, the seed coat is removed, and each seed is put into a centrifuge tube with 1.5 ml;

(2) Adding 500ul of A solution respectively, opening the cover, placing into a metal bath pot, and heating for 10 minutes;

(3) After cooling to room temperature, 500ul of liquid B is added;

(5) Diluting the mixed solution of the solution A and the solution B by 20 times for screening KASP marks;

(6) Taking 176 melon seeds of 'Nassmi', removing seed coat shells, putting one quarter of kernels of each seed into 96-hole PCR plates, and putting 88 seeds into each 96-hole PCR sample plate; the positions of the 96-hole PCR sample plates H5 to H12 are respectively and sequentially provided with 3 female parent DNA, 3 male parent DNA and 2 negative controls;

(7) Adding 50ul of A liquid into each hole of a 96-hole sample plate by using a 96-hole pipetting workstation, and covering a silica gel cover;

(8) Placing the 96-well sample plate in a PCR instrument, and heating for 2 minutes;

(9) After cooling to room temperature, adding 50ul of solution B into each well of a 96-well sample plate, and carrying out instantaneous centrifugation to uniformly mix the solution A and the solution B;

(10) Taking a new 96-hole PCR sample plate, adding 114ul of purified water into each hole by using a 96-hole pipetting workstation, and then adding 6ul of the mixed solution of the solution A and the solution B obtained in the step (9) by using the 96-hole pipetting workstation, namely diluting the mixed solution of the solution A and the solution B obtained in the step (9) by 20 times for KASP (KASP labeling detection);

(11) The KASP reaction is performed in a reaction plate;

(12) Scanning to obtain parting results;

(13) Judging that a sample with the same position as the female parent is the female parent genotype; the sample with the same position as the male parent is the male parent genotype, the heterozygous genotype is positioned between the female parent and the male parent genotype, and the quantity of each KASP marked female parent, male parent, F1 and undetected genotype is counted;

(14) And (3) calculating the purity identification result of the hybrid, taking 176 seeds from each sample to be detected to extract DNA, dividing the samples into two 96-hole PCR sample plates on average, identifying each sample plate by using 2 groups of KASP marks, and calculating the purity of the hybrid of the sample by combining the identification results of the 2 groups of KASP marks.

In step (11), the KASP reaction is performed in a reaction plate comprising: the total reaction system was 2ul,KASP 2xPCR Mix1ul primer mix 0.014ul, with a volume ratio of primer F1, primer F2 and primer R of 3:3:8;

PCR amplification was performed in a Matrix Cycler, with the following reaction procedure: pre-denaturation at 94 ℃ for 15 min; denaturation at 94℃for 20 seconds, 61℃to 55℃for 1min, amplification for 10 cycles; denaturation at 94℃for 20 seconds and extension at 55℃for 1min, followed by amplification for 28 cycles; extension was carried out at 72℃for 10 minutes.

In step (13), counting the number of each KASP-tagged female parent, male parent, F1, and undetected genotype, comprising: detecting genotypes of a female parent and a male parent by using a fluorescent probe to obtain genotype information which is the same as the position of the female parent and the position of the male parent and is positioned between the female parent and the male parent genotypes, and comparing the obtained information with standard information prestored in a gene library to obtain a sample which is the same as the female parent position as the female parent genotype; the sample with the same position as the male parent is the male parent genotype, and the heterozygous genotype is located between the female parent and the male parent genotype.

In step (14), in the identification of each sample plate with 2 sets of KASP markers, the primers for identifying 2 sets of KASP markers for melon variety "nasmi" hybrid purity are as follows:

the DNA sequence of KX11F1 is: GAAGGTGACCAAGTTCATGCTCATCCATCCGTCTTAGTCCGATTA;

the DNA sequence of KX11F2 is:

GAAGGTCGGAGTCAACGGATTCATCCATCCGTCTTAGTCCGATTG；

the DNA sequence of KX11R is: CGGTATGCTCCATTTCAATTCAGG;

the DNA sequence of KX27F1 is:

GAAGGTGACCAAGTTCATGCTAGGTGTATGCTAGTTATTGGAATCTT；

the DNA sequence of KX27F2 is:

GAAGGTCGGAGTCAACGGATTAGGTGTATGCTAGTTATTGGAATCTC；

the DNA sequence of KX27R is:

CACGAAGCCCATCTCTCCA。

in step (14), the number of abnormal genotype samples is recorded with reference to the positive control genotype, and the variety purity P is expressed in%:

wherein P is the purity of the hybrid, N1 is the number of seeds to be detected, N2 is the number of samples of the parent genotype, and N3 is the number of samples to be deleted.

By combining all the technical schemes, the invention has the following beneficial effects: the invention provides a melon seed DNA extraction method suitable for KASP marking, which comprises the steps of removing the shell of seeds to obtain one fourth of kernels, adding A liquid, carrying out hot bath for 2 minutes at 99 ℃ in a PCR instrument, cooling to room temperature, adding B liquid, uniformly mixing, carrying out instantaneous centrifugation, and diluting AB mixed liquid by 20 times to obtain the product for KASP typing. The method is simple and quick to operate, is convenient for flow operation, relates to non-toxic and few reagents, has low cost, takes sampling tissues as kernels, can save the time of germination acceleration and plant growth, and remarkably improves the DNA extraction efficiency. The KASP primer with high amplification efficiency and good typing effect is used for identifying the purity of the hybrid seeds, can be used for efficiently, accurately and inexpensively obtaining the identification result of the purity of the hybrid seeds of the muskmelon, and has wide application prospects in the fields of hybrid seed purity identification, germplasm authenticity identification, molecular marker assisted selection breeding, functional gene excavation and the like.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the disclosure and together with the description, serve to explain the principles of the disclosure;

FIG. 1 is a flowchart of a melon DNA extraction method suitable for KASP detection provided by the embodiment of the invention;

FIG. 2 is an identification of purity of "Nasmash" hybrids using KX11 markers provided by the examples of the present invention;

FIG. 3 is an identification of purity of "Nasmash" hybrids using KX11 markers provided by the examples of the present invention;

FIG. 4 is an identification of purity of "Nasmash" hybrids using KX27 markers provided by examples of the present invention;

FIG. 5 is an identification of purity of "Nasmash" hybrids using KX27 markers provided by examples of the present invention.

Detailed Description

In order that the above objects, features and advantages of the invention will be readily understood, a more particular description of the invention will be rendered by reference to the appended drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. The invention may be embodied in many other forms than described herein and similarly modified by those skilled in the art without departing from the spirit or scope of the invention, which is therefore not limited to the specific embodiments disclosed below.

The melon DNA extraction method suitable for KASP detection provided by the embodiment of the invention has the innovation points that:

on the basis of previous researches, the invention provides a simple, convenient, efficient, safe and low-cost DNA extraction method which meets KASP typing through continuous exploration and testing. The method for identifying the purity of the muskmelon hybrid with high efficiency, accuracy and low cost is also provided.

The invention provides a simple and efficient DNA extraction method, and can meet the requirement of KASP marking. The method provides an important premise for molecular marker assisted selection breeding, functional gene fine positioning and hybrid purity identification, the extraction method in the prior art is complex and involves the use of toxic substances, or the steps such as sample crushing are relatively time-consuming and inconvenient, the method does not need to crush the samples, does not involve the use of toxic substances, and has very simple and convenient operation and very low cost.

Example 1 as shown in fig. 1, the melon DNA extraction method suitable for KASP detection provided in the embodiment of the invention includes:

s1, removing shells of melon seeds, and placing kernels in a PCR tube;

s2, adding the solution A, and carrying out hot bath;

s3, cooling to room temperature, adding the equal volume of the liquid B, and centrifuging to fully mix the liquid A and the liquid B;

s4, diluting the mixed solution of the solution A and the solution B for KASP typing.

In the embodiment of the invention, a high-efficiency, accurate and low-cost identification method for the purity of melon hybrid seeds is also provided, and KASP (KASP-labeled screening and identification) is performed by using 20-fold diluent of the AB mixed solution obtained by the DNA extraction method. Taking the purity of the hybrid seeds for identifying the 'Nassmi' variety as an example, the used melon seeds are Nassmi amphiphilicity F1 seeds, and the specific implementation modes are as follows:

(1) 10 seeds of each of the female parent and the male parent of the Nasi mi are taken, the seed coat is removed, and about one-fourth of the seed kernel is taken from each seed and placed in a corresponding 1.5ml centrifuge tube.

(2) 500ul of solution A was added separately, the lid was opened, and the solution was placed in a metal bath and heated for 10 minutes.

(3) After cooling to room temperature, 500ul of solution B was added.

(5) The mixed solution of the solution A and the solution B is diluted by 20 times and is used for screening KASP marks, and the KASP marks with high amplification efficiency and obvious difference between the sodium female parent and the male parent are screened.

(6) 176 seeds of 'Nassmi' F1 are taken, the seed coat is removed, about one quarter of the kernel of each seed is placed in a 96-well PCR plate, and 88 seeds are placed in each 96-well PCR sample plate. The positions of the 96-well PCR sample plates H5 to H12 were respectively placed with 3 female parent DNAs, 3 male parent DNAs and 2 negative controls in this order.

(7) 50ul of solution A was added to each well of a 96 well sample plate using a 96 well pipetting station and covered with a silica gel cap.

(8) The 96-well sample plate was placed in a PCR instrument and heated for 2 minutes.

(9) After cooling to room temperature, 50ul of solution B was added to each well of a 96-well sample plate and the solution A and solution B were mixed by instantaneous centrifugation.

(10) Taking a new 96-hole PCR sample plate, adding 114ul of purified water into each hole by using a 96-hole pipetting workstation, and then adding 6ul of the mixed solution of the solution A and the solution B obtained in the step (9) by using the 96-hole pipetting workstation, namely diluting the mixed solution of the solution A and the solution B obtained in the step (9) by 20 times, thereby being used for KASP (KASP labeling detection).

(11) The consumable and instrument for KASP detection are provided by the chinese-Chen optical wing technology Limited liability company (hereinafter abbreviated as chinese-Chen optical wing), KASP mix is purchased from Guangzhou solid-De biotechnology Co., ltd, the preparation of PCR system is carried out according to the experimental operation instruction of chinese-Chen optical wing, and KASP reaction is carried out in 384 reaction plates. The total reaction system was 2ul, specifically KASP 2xPC Mix1ul, primer Mix 0.014ul (primer F1, primer F2 and primer R ratio 3:3:8), and 384 plates were prepared using Matrix array. PCR amplification was performed in a Matrix Cycler, with the following reaction procedure: pre-denaturation at 94 ℃ for 15 min; denaturation at 94℃for 20 seconds, 61℃to 55℃with a touchdown procedure, 0.6℃decrease per cycle, 1min, 10 cycles of amplification; denaturation at 94℃for 20 seconds and extension at 55℃for 1min, followed by amplification for 28 cycles; extension was carried out at 72℃for 10 minutes.

(12) Scanning in a Matrix Scanner to obtain a parting result.

(13) Judging that a sample with the same position as the female parent is the female parent genotype; the samples with the same positions as the male parent are the male parent genotypes, the heterozygous genotypes are positioned between the female parent and the male parent genotypes, and the quantity of each KASP marked female parent, male parent, F1 and undetected genotypes is counted.

Illustratively, in step (13), the genotypes of the female parent and the male parent are detected by using a fluorescent probe to obtain genotype information identical to the position of the female parent and the position of the male parent and located between the female parent and the male parent genotypes, and the obtained genotype information is compared with standard information pre-stored in a gene library to obtain: the sample with the same position as the female parent is the female parent genotype; the sample with the same position as the male parent is the male parent genotype, and the heterozygous genotype is located between the female parent and the male parent genotype.

In step (14), the number of abnormal genotype samples is recorded with reference to the positive control genotype, and the variety purity P is expressed in%:

wherein P is the purity of the hybrid, N1 is the number of seeds to be detected, N2 is the number of samples of the parent genotype, and N3 is the number of samples to be deleted.

176 seeds of each sample to be detected are taken for extracting DNA, the DNA is divided into two 96-hole PCR sample plates on average, each sample plate is identified by using 2 groups of KASP marks (see table 1 for details), and the purity of the hybrid seeds of the sample is calculated by combining the identification results of the 2 groups of KASP marks.

TABLE 1 KASP marker information identifying purity of "Nassmi" variety hybrids

Sequence number	Primer name	Sequence information
			1	KX11F1	GAAGGTGACCAAGTTCATGCTCATCCATCCGTCTTAGTCCGATTA
2	KX11F2	GAAGGTCGGAGTCAACGGATTCATCCATCCGTCTTAGTCCGATTG
			3	KX11R	CGGTATGCTCCATTTCAATTCAGG
4	KX27F1	GAAGGTGACCAAGTTCATGCTAGGTGTATGCTAGTTATTGGAATCTT
			5	KX27F2	GAAGGTCGGAGTCAACGGATTAGGTGTATGCTAGTTATTGGAATCTC
6	KX27R	CACGAAGCCCATCTCTCCA

The purity identification result of the hybrid seeds of the 'nano-density' variety based on the 2 groups of KASP markers is shown as figures 2-5, wherein 5 seeds are detected in total in M5 to be of female parent genotypes, 2 seeds are not detected, 1 seed is detected in total in M6 to be of male parent genotypes, and 1 seed is not detected. The purity of the M5 and M6 hybrids was identified as 98.3% and 98.9%, respectively (Table 2).

TABLE 2 identification of purity of hybrid varieties of "Nassmi" variety based on KASP markers

In order to verify the accuracy of the identification result of the purity of the hybrid seeds of the 'Nassmi' variety based on the KASP mark, and simultaneously to ensure the reality and reliability of the traditional identification result, the purity condition of the hybrid seeds in the actual planting process of the batch of seeds is researched in a certain planting base. Two greenhouses were investigated altogether, 1400 plants were planted in each greenhouse, 5 plants were found to have a maternal phenotype in one greenhouse, 3 plants were found to have a maternal phenotype in one greenhouse, no abnormal plants were found, and the purity identification results of the hybrid seeds are shown in table 3: (1400×2-5-3)/(1400×2) =99.7% slightly higher than the result of identifying the KASP marker, and substantially corresponds to the result of identifying the KASP marker.

TABLE 3 hybrid purity identification results for "Nassmi" variety based on conventional methods

Numbering device	Female parent phenotype	Abnormal strain	F1 hybrid	Purity identification result
					M5+M6	8	0	2792	99.7％

According to the embodiment, the DNA extraction directly takes seeds as test materials, so that the process and the place for acquiring radicle or cotyledon or true leaf by germination accelerating, planting and the like are omitted, and the efficiency is improved in time and space. The germination acceleration requires at least 24 hours, at least three days for obtaining cotyledons or true leaves, and preparation of germination boxes, incubators, trays and the like.

The DNA extraction method omits the step of sample grinding, is matched with a 96-hole PCR plate, a 96-hole pipetting workstation, a simple flat centrifuge, a PCR instrument and the like, can carry out DNA extraction in a flow and large scale, and has simple working procedure and high efficiency. Approximately 10000 melon seeds of DNA can be extracted by three persons in cooperation for 8 hours, except for sampling time.

Compared with the CTAB method, the DNA extraction method has the advantages that the used reagent is simple and nontoxic, the price is low, and the DNA extraction cost can be greatly reduced. The method for identifying the purity of the muskmelon hybrid is obviously superior to the traditional identification method in time cost and cost, can carry out flow and scale identification, has more objective and real identification result, and greatly reduces the occurrence of human errors. Compared with an SSR marking method, the method for identifying the purity of the muskmelon hybrid is higher in efficiency, and the obtained identification result is more automatic and intelligent, so that the process and scale identification can be easily carried out, and toxic and harmful medicines in the processes of glue making, silver staining and the like in the SSR marking identification method are avoided.

In conclusion, the DNA extraction method and the application of the DNA extraction method in the aspect of purity identification of muskmelon hybrid seeds have great market potential, and simultaneously can provide technical support for obtaining DNA in the fields of auxiliary selective breeding, functional gene mining, genetic diversity analysis and the like for molecular markers.

In the foregoing embodiments, the descriptions of the embodiments are emphasized, and in part, not described or illustrated in any particular embodiment, reference is made to the related descriptions of other embodiments.

While the invention has been described with respect to what is presently considered to be the most practical and preferred embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but on the contrary, is intended to cover various modifications, equivalents, and alternatives falling within the spirit and scope of the invention.

Claims (10)

1. A melon DNA extraction method suitable for KASP detection, the method comprising:

s1, removing shells of melon seeds, and placing kernels in a PCR tube;

s2, adding the solution A, and carrying out hot bath;

s3, cooling to room temperature, adding the equal volume of the liquid B, and centrifuging to fully mix the liquid A and the liquid B;

s4, diluting the mixed solution of the solution A and the solution B for KASP typing.

2. The method for extracting melon DNA suitable for KASP detection according to claim 1, wherein in S2, adding a solution a comprises: 50ul of solution A was added, which was a mixture of 50mM NaOH and 2% Tween 20.

3. The method for extracting melon DNA suitable for KASP detection according to claim 1, wherein in S2, the hot bath comprises: the reaction mixture was subjected to a thermal bath at 99℃for 2 minutes using a PCR instrument.

4. The method for extracting melon DNA suitable for KASP detection according to claim 1, wherein in S3, solution B is 100mM Tris-HCl solution.

5. The method for extracting melon DNA suitable for KASP detection according to claim 1, wherein in step S4, the mixed solution of solution A and solution B is diluted 20 times.

6. The identification method for the purity of muskmelon hybrid seeds is characterized by comprising the steps of screening and identifying KASP markers by diluting mixed liquor of A liquid and B liquid obtained by the muskmelon DNA extraction method suitable for KASP detection according to any one of claims 1-5, and specifically comprising the following steps:

(1) 10 seeds of female parent and male parent of melon varieties are taken, the seed coat and the shell are removed, and one quarter of the seed is taken for each seed and placed in a 1.5ml centrifuge tube;

(2) Adding 500ul of A solution respectively, opening the cover, placing into a metal bath pot, and heating for 10 minutes;

(3) After cooling to room temperature, 500ul of liquid B is added;

(5) Diluting the mixed solution of the solution A and the solution B by 20 times for screening KASP marks;

(6) Taking F1 seeds of 176 melon varieties, removing seed coat shells, putting one quarter of kernels of each seed into 96-hole PCR plates, and putting 88 seeds into each 96-hole PCR sample plate; the positions of the 96-hole PCR sample plates H5 to H12 are respectively and sequentially provided with 3 female parent DNA, 3 male parent DNA and 2 negative controls;

(7) Adding 50ul of A liquid into each hole of a 96-hole sample plate by using a 96-hole pipetting workstation, and covering a silica gel cover;

(8) Placing the 96-well sample plate in a PCR instrument, and heating for 2 minutes;

(9) After cooling to room temperature, adding 50ul of solution B into each well of a 96-well sample plate, and carrying out instantaneous centrifugation to uniformly mix the solution A and the solution B;

(10) Taking a new 96-hole PCR sample plate, adding 114ul of purified water into each hole by using a 96-hole pipetting workstation, and then adding 6ul of the mixed solution of the solution A and the solution B obtained in the step (9) by using the 96-hole pipetting workstation, namely diluting the mixed solution of the solution A and the solution B obtained in the step (9) by 20 times for KASP (KASP labeling detection);

(11) The KASP reaction is performed in a reaction plate;

(12) Scanning to obtain parting results;

(13) Judging that a sample with the same position as the female parent is the female parent genotype; the sample with the same position as the male parent is the male parent genotype, the heterozygous genotype is positioned between the female parent and the male parent genotype, and the quantity of each KASP marked female parent, male parent, F1 and undetected genotype is counted;

(14) And (3) calculating the purity identification result of the hybrid, taking 176 seeds from each sample to be detected to extract DNA, dividing the samples into two 96-hole PCR sample plates on average, identifying each sample plate by using 2 groups of KASP marks, and calculating the purity of the hybrid of the sample by combining the identification results of the 2 groups of KASP marks.

7. The method for identifying the purity of melon hybrids as claimed in claim 6, wherein in step (11), the KASP reaction is performed in a reaction plate comprising: the total reaction system is 2ul,KASP 2xPCR Mix1ul primer mixed solution 0.014ul, wherein the primer comprises a primer F1, a primer F2 and a primer R, and the volume ratio of the primer F1 to the primer F2 to the primer R is 3:3:8;

PCR amplification was performed in a Matrix Cycler, with the following reaction procedure: pre-denaturation at 94 ℃ for 15 min; denaturation at 94℃for 20 seconds, 61℃to 55℃for 1min, amplification for 10 cycles; denaturation at 94℃for 20 seconds and extension at 55℃for 1min, followed by amplification for 28 cycles; extension was carried out at 72℃for 10 minutes.

8. The method for identifying the purity of melon hybrids according to claim 6, wherein in step (13), counting the number of each KASP markers female parent, male parent, F1 and undetected genotype comprises: detecting genotypes of a female parent and a male parent by using a fluorescent probe to obtain genotype information which is the same as the position of the female parent and the position of the male parent and is positioned between the female parent and the male parent genotypes, and comparing the obtained information with standard information prestored in a gene library to obtain a sample which is the same as the female parent position as the female parent genotype; the sample with the same position as the male parent is the male parent genotype, and the heterozygous genotype is located between the female parent and the male parent genotype.

9. The method for identifying the purity of a melon variety hybrid according to claim 6, wherein in step (14), each sample plate is identified with 2 sets of KASP markers, and the primers used for the 2 sets of KASP markers are as follows:

the DNA sequence of KX11F1 is: GAAGGTGACCAAGTTCATGCTCATCCATCCGTCTTAGTCCGATTA;

the DNA sequence of KX11F2 is:

GAAGGTCGGAGTCAACGGATTCATCCATCCGTCTTAGTCCGATTG；

the DNA sequence of KX11R is: CGGTATGCTCCATTTCAATTCAGG;

the DNA sequence of KX27F1 is:

GAAGGTGACCAAGTTCATGCTAGGTGTATGCTAGTTATTGGAATCTT；

the DNA sequence of KX27F2 is:

GAAGGTCGGAGTCAACGGATTAGGTGTATGCTAGTTATTGGAATCTC；

the DNA sequence of KX27R is:

CACGAAGCCCATCTCTCCA。

10. the method for identifying the purity of a hybrid seed of a melon variety according to claim 6, wherein in the step (14), the number of abnormal genotype samples is recorded with reference to the positive control genotype, and the variety purity P is expressed in%:

wherein P is the purity of the hybrid, N1 is the number of seeds to be detected, N2 is the number of samples of the parent genotype, and N3 is the number of samples to be deleted.