CN108546778A - A kind of SNP marker and its application for detecting anti-cucumber powdery mildew character - Google Patents
A kind of SNP marker and its application for detecting anti-cucumber powdery mildew character Download PDFInfo
- Publication number
- CN108546778A CN108546778A CN201810798871.0A CN201810798871A CN108546778A CN 108546778 A CN108546778 A CN 108546778A CN 201810798871 A CN201810798871 A CN 201810798871A CN 108546778 A CN108546778 A CN 108546778A
- Authority
- CN
- China
- Prior art keywords
- cucumber
- mildew
- snp marker
- powdery mildew
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of SNP marker and its applications for detecting anti-cucumber powdery mildew character.The SNP marker is located at cucumber rice chromosome, associated region is in the segment of NCBI numbers NC_026660.1, initial position 22.3Mb, final position 23.1Mb, the sequence of the SNP marker is as shown in SEQ ID NO.1, base r wherein at the sites 51nt is A or G, and it is disease-resistant which is that the cucumber of G shows as, and it is susceptible that base is that the cucumber of A shows as.Present invention application KASP technologies carry out Genotyping to the SNP marker found, can fast and accurately detect resistance of the cucumber to powdery mildew, greatly improve hereditary transformation efficiency.And detection process does not need digestion, electrophoresis and sequencing etc., and it is easy to operation, it is conducive to high-throughput quickly detection, has thoroughly prevented the pollution of the Aerosol Pollution and EB of PCR product to environment, and the harm to human body.
Description
Technical field
The invention belongs to SNP marker technical fields, and in particular to a kind of for detecting anti-cucumber powdery mildew character
SNP marker and its application.
Background technology
Traditional pedigree method selection is the breeding method that breed cucumber men generally use, for many years by breeders
A large amount of high-quality, high yield and disease-resistant new breeds of cucumbers are cultivated and have been formulated in effort.However, the tradition in conjunction with phenotypic evaluation is educated
The defects of there are phenotype controls to be not allowed for kind pattern, genetic group demand is big, human cost is high, breeding cycle is long, is difficult to realize
Large-scale commercial integrates breeding or the improvement of material genetic breeding.Along with the hair of molecular biology and bioinformatics
Exhibition, molecular mark selection (Molecular Assisted Selection, MAS) show that huge technology is excellent
Gesture realizes hereditary basis and effective combination of Goal Present Situation, and the material (single plant) containing target gene is selected to carry out combo, real
Show the accurate improvement of objective trait, can effectively avoid the technical barrier of traditional breeding way.
Single nucleotide acid variation (Single Nucleotide Polymorphism, SNP) is wide on the genome of species
General presence, including：The conversion or transversion of single base, single base (segment) are inserted into or the forms such as missing, more for these
The SNP marker technology of a new generation is gradually risen in state property site.For the Data mining function SNP marks of control targe character
Note, character is associated with genotype, and then realize efficient, accurate breeding.At this stage, it is suitable for the detection means of SNP marker
Mainly gel electrophoresis, quantitative fluorescent PCR and competitiveness allele PCR (Kompetitive Allele Specific
PCR,KASP).The label that the present invention is developed is suitable for KASP methods and detects SNP site, and this method is applied to divide successively
The work such as sub- assistant breeding, the objective trait assignment of genes gene mapping, seed purity and authenticity identification, at low cost, flux is high, experiment
The advantages such as safe operation and fluorescence signal acquisition data are accurate.
Powdery mildew (Powdery mildew, PM) is commonly called as white hair, is a kind of worldwide disease occurred extensively.Pathogen master
To be propagated by air-flow, have the characteristics that short incubation period, infect again it is frequent, popular strong.Northern germ is with cleistothecium with invalid
Body stays in overwintering on ground or greenhouse, vinyl house melon crop.Southern germ is overwintering on host with mycelia or conidium
Or more summer, become next year primary source of infection.In China, spring protecting field and summer and autumn open country cucumber are every year all caused by the generation of powdery mildew
A large amount of losses, powdery mildew can fall ill in entire cucumber breeding time, and main harm blade is serious to endanger vines, especially in life
Long middle and later periods morbidity is serious, so that plant is uprooted plants after their edible portions have been harvested ahead of time, causes Severe Reduction.In the Protectorate cultivation of Shanghai and southern area,
The harm of both diseases is increasingly severe.Under the moist planting environment of long-term wet weather, field improper ventilation, illumination is insufficient, plant
Growing way is weak, humidity increases a large amount of generations for being conducive to cause of disease powdery mildew.At present production on mainly with the method for medical treatment come
The generation of controlling disease, but environment is polluted, pesticide residue influences fruit quality, jeopardizes food security, while increasing farmer
Cost.Long-term dispenser can generate resistance to the biological strain of pathogen again, to increase difficulty of prevention and cure, therefore, only cultivate anti-
The cucumber variety of powdery mildew could fundamentally solve the problems, such as cucumber No-harmful apple orchard.In breeding process carry out field and
Indoor identification is time-consuming and laborious, and therefore, exploitation is suitable for seedling stage high throughput identification cucumber plant and mildew-resistance character close linkage
SNP marker, contribute to the resistance for quickly and efficiently detecting cucumber to powdery mildew, contribute on a large scale be commercialized point
Sub- breeding, has a good application prospect and economic value.
Invention content
It is an object of the present invention to provide a kind of SNP marker and its applications for detecting anti-cucumber powdery mildew character.
The present invention is that technical solution used by above-mentioned purpose is as follows：
A kind of SNP marker for detecting anti-cucumber powdery mildew character, the SNP marker are located at cucumber the 4th
Number chromosome, associated region are named as qCSSL-04, initial position 22.3Mb in the segment of NCBI numbers NC_026660.1,
Final position 23.1Mb, the sequence of the SNP marker is as shown in SEQ ID NO.1, wherein the base r at the sites 51nt
For A or G, it is disease-resistant which is that the cucumber of G shows as, and it is susceptible that base is that the cucumber of A shows as.
The SNP marker CS_K_040108, sequence are as follows：taactccaactactctcttttcagttcttt
Tcatttcccaaacactaccartctcatctgtcaaacaaattgggcatataatgagt attgacagtagagta, wherein
Base r at the sites 51nt is A or G.The present invention confirms through population experiment, the property of above-mentioned molecular labeling and anti-cucumber powdery mildew
Shape is closely related, in 2 detected parent and its F2 groups, alkali of the parent material SL02 in CS_K_040108 test sites
Fundamental mode is G:G, shows as disease-resistant, and the base types of XL01 test sites is then A:A shows as susceptible, 215 F2 groups single plants
In, there are 4 single plants to detect G:G has 17 single plants to detect A:A is shown as homozygous；There are 158 single plants to detect A:
G is shown to be heterozygous.
The present invention also provides the specific primer sets for detecting the SNP marker, including：
(1) two special primer CS_K_040108X and CS_K_040108Y：The sequence of CS_K_040108X such as SEQ ID
Shown in NO.2, the sequence of CS_K_040108Y is as shown in SEQ ID NO.3；
(2) universal primer CS_K_040108C：Its sequence is as shown in SEQ ID NO.4.
The nucleotide sequence and universal primer sequence of two specific primers are shown in Table 1.
1 labeled primer sequence table of table
The present invention also provides application of the specific primer sets in detecting cucumber variety mildew-resistance character.Tool
Body includes the following steps：
(1) Cucumber germplasm DNA to be measured is extracted；
(2) using Cucumber germplasm DNA as template, KASP reaction detections are carried out using the specific primer sets, two
The 5 '-ends of specific primer CS_K_040108X and CS_K_040108Y are separately connected FAM-tail:5’-
Gaaggtgaccaagttcatgct-3 ' (shown in SEQ ID NO.5) and VIC-tail:5’-gaaggtcggagtcaacggatt-
3 ' (shown in SEQ ID NO.6) universal fluorescent sequence labels；
(3) it when detecting anti-cucumber powdery mildew character, is answered if only detecting the connected fluorescence sequence pairs of primer CS_K_040108Y
Fluorescence signal, then cucumber to be measured show as mildew-resistance；If only detecting the connected fluorescence sequence pairs of primer CS_K_040108X
The fluorescence signal answered then judges that cucumber to be measured is not disease-resistant material；Judge that cucumber is white to resist if being detected simultaneously by the two fluorescence
The heterozygous of powder disease.The degree of correlation of label and powdery mildew disease-resistant carries out test and verifies as extremely significantly (p<0.05)
Preferably, when carrying out breed cucumber, selection detects that the connected fluorescence sequences of primer CS_K_040108Y are corresponding
The cucumber sample of fluorescence signal carries out breeding.
The fluorescence sequence can be fluorescence sequence commonly used in the art, the big fluorescence of preferably two fluorescence color difference
Sequence.In a specific implementation mode in the present invention, selection is connected to Liang Tiaote using FAM and VIC fluorescence sequences
It is anisotropic because 5 ' end.
Preferably, the PCR conditions in the step (2) in KASP detections are：94℃15min；95 DEG C of 20sec, 65-56 DEG C
60sec, each cycle annealing elongating temperature reduce by 0.8 DEG C, totally 10 cycles；94 DEG C of 20sec, 57 DEG C of 60sec, totally 26 are followed
Ring.
The present invention also provides the method that the specific primer sets are used to detect the SNP marker, the party
Method is：
KASP detections are carried out to the genomic DNA of cucumber to be detected using the specific primer sets, in primer CS_K_
The 5 '-ends of 040108X and primer CS_K_040108Y are separately connected different universal fluorescent sequence labels；If only detecting primer
The corresponding fluorescence signal of the connected fluorescence sequences of CS_K_040108Y, then cucumber to be measured be mildew-resistance material, genotype G,
If only detecting the fluorescence signal of the connected fluorescence sequences of primer CS_K_040108X, judge cucumber to be measured for not mildew-resistance
Material, genotype A；If being detected simultaneously by two kinds of fluorescence, cucumber sample is judged to carry the heterozygosis of mildew-resistance character
The degree of correlation of type, label and powdery mildew disease-resistant carries out test and verifies as extremely significantly (p<0.05).
The present invention also provides the kits for including the specific primer sets.
The present invention also provides application of the kit in Cucumber Germplasm improvement.
The present invention also provides application of the kit in cultivating powdery mildew resisting green cucumber.
The detection method of the substantially molecular labeling of above application.Wherein, ability can be used with system in PCR response procedures
Domain routine techniques, the present invention are not construed as limiting this separately.
Compared with prior art, beneficial effects of the present invention are：
(1) screening of SNP site and the group of structure are related, related with genetic effect value.If position in screening process
Point unobvious, then need to rebuild population material and be screened again.Inventor passes through many experiments Exploring Analysis, structure
The suitable population material of acquisition is built, then further build anti-susceptible gene pool progress genome resurveys sequence, then carries out BSA and determine
Position analysis, it is final to obtain the SNP marker that can be used for detecting anti-cucumber powdery mildew character.
(2) detection of the above-mentioned SNP marker in breed cucumber is provided, using the molecular labeling and detection method,
The molecular labeling of selection and mildew-resistance close linkage, can be used for identification and the assisted selection of anti-cucumber powdery mildew, right
The molecular breeding of mildew-resistance is promoted to be of great significance.
(3) present invention carries out Genotyping using KASP technologies to the SNP marker found, can quickly, accurately
Detection cucumber to the resistance of powdery mildew, greatly improve hereditary transformation efficiency.And detection process does not need digestion, electrophoresis and sequencing
Deng, it is easy to operation, it is conducive to high-throughput quickly detection, has thoroughly prevented the pollution of the Aerosol Pollution and EB of PCR product to environment,
And the harm to human body.
Description of the drawings
Fig. 1 is that application BSA-seq methods of the embodiment of the present invention position mildew-resistance QTLs's on cucumber rice chromosome
Schematic diagram, wherein black horizontal line represent positioning section.
Fig. 2 is the Genotyping test chart of the invention with the SNP marker of anti-cucumber powdery mildew close linkage in group；Its
Middle G:G is disease-resistant homozygous genotype, A:A is susceptible homozygous genotype, A:G is heterozygous, and NTC is no template control.
Specific implementation mode
Technical scheme of the present invention is described in detail with reference to embodiment.Tested point experiment in following embodiments
Method is conventional method unless otherwise specified.The materials, reagents and the like used in the following examples, unless otherwise instructed,
It obtains from commercial channels.The LGC SNPline Genotypings platforms used in embodiment are purchased from English with its matched reagent consumptive material
LGC companies of state.
The exploitation of embodiment 1 and the SNP marker of the anti-cucumber powdery mildew linkage of characters
Identify that the cucumber self-mating system SL02 of the mildew-resistance of acquisition is female parent using interior, susceptible self-mating system XL01 is father
This, obtains 215 single plants of F2 segregating populations by hybridizing, being selfed, is identified by indoors artificial, according to plant leaf powdery mildew disease
Spot number, by plant morbidity grade be divided into 0 grade (not falling ill), 1 grade, 3 grades and 5 grades.The morbidity feelings of 215 single plants of F2 groups
Condition is：0 grade 40 plants, 1 grade 93 plants, 3 grades 65 plants and 5 grades 17 plants, by 17 that F2 groups morbidity grade is 0 grade (non-disease plant)
Single plant builds extreme disease-resistant gene pond R-pool, and 17 single plants of morbidity class 5 grade build susceptible gene pool S-pool and carry out base
Because of the sequence of resurveying of group, then carries out BSA and positioning analysis is sequenced, navigate to the region of rice chromosome region 22.3M-23.1M.
Referring to Fig. 1, which is the schematic diagram for positioning mildew-resistance QTLs on cucumber rice chromosome using BSA-seq methods, wherein
QCSSL-04 black horizontal lines represent positioning section.
Design of primers is carried out according to sequence at the 23159853rd bit base of parent's polymorphic SNP site in this target area.
The primer for detecting above-mentioned SNP marker that the present invention designs is combined as：(1) two specific primer：
CS_K_040108X:
gaaggtgaccaagttcatgcttttcatttcccaaacactaccag；
CS_K_040108Y:
gaaggtcggagtcaacggattttcatttcccaaacactaccaa。
(2) universal primers
CS_K_040108C：tgcccaatttgtttgacaga.
It is separately connected FAM-tail at two specific primer 5 '-ends:5 '-gaaggtgaccaagttcatgct-3 ' and
VIC-tail:5 '-gaaggtcggagtcaacggatt-3 ' universal fluorescent sequence labels；KASP reactions are carried out to cucumber to be measured
Detection.
The detection of the KASP reactions for the SNP marker that embodiment 2 is developed
1, be directed to molecular labeling design primer of the present invention, using KASP reactions can be high-throughput to the anti-white powder of cucumber
Characteristic of disease shape is detected, and is combined using the primer that embodiment 1 designs.
2, using CTAB methods are simplified, genomic DNA is extracted from cucumber leaves.
(1) it takes the fresh sample of appropriate cucumber leaves or freezes sample, be put into 2ml centrifuge tubes, two steel balls be added, in tissue grinder instrument
On grind；
(2) 750 μ L CTAB solution are added, shake homogenate, 65 DEG C of concussion warm bath 0.5-1h；
(3) it is cooled to room temperature, 750 μ L chloroforms is added in draught cupboard：Isoamyl alcohol you (24：1) 3-4 mixing of electric knife；
(4) 12000rmp centrifuges 10min, takes in supernatant 500 μ L to new 1.5mL centrifuge tubes；
(5) isometric aqueous isopropanol is added gently to shake, precipitated 1 hour in -20 DEG C or more, 12000rmp centrifugations
3min abandons supernatant；
(6) 70% ethyl alcohol of 1mL is added, flicks precipitation, 1000rmp centrifuges 3min, abandons supernatant；
(7) 300mL H are added2O, dissolving are spare.
3, KASP reaction tests：
KASP reaction tests carry out on LCG SNPline genetic analysis platforms.1.0- is added in microwell plate reaction plate
The 20ng/ μ L DNA samples of 1.5 μ L, are added KASP reaction mixtures after drying, reaction system is shown in Table 2.PCR amplification is in water-bath heat
It is completed in circulating instrument, reaction condition is：94℃15min；95 DEG C of 20sec, 65-56 DEG C of 60sec, each cycle annealing elongating temperature
0.8 DEG C is reduced, totally 10 cycles；94 DEG C of 20sec, 57 DEG C of 60sec, totally 26 recycle；Scanner is utilized after the completion of reaction
Pherastar carries out fluorescence data reading to KASP reaction products, and the result of fluorescent scanning can be converted to figure automatically.As a result join
Fig. 2 is seen, for Genotyping test chart of the SNP marker with anti-cucumber powdery mildew close linkage in group；Wherein G:G is disease-resistant
Homozygous genotype, A:A is susceptible homozygous genotype, A:G is heterozygous, and NTC is no template control.Fig. 2 results show parting effect
Fruit is good.
The SNP marker pcr amplification reaction system of 2 mildew-resistance of table
Embodiment 3：F2 segregating populations Disease Resistance Identification and molecular labeling and phenotype correlation analysis
Phenotype verification is carried out to the label in the present invention, is as follows：
1, with suspension spore liquid (concentration 1 × 104~1 × 106A/ml) in 25 DEG C of daytime/20 DEG C nights of temperature, humidity
It is inoculated with Leaf of Cucumber Seedling under 80% environment, is object by the 2nd and the 3rd true leaf of cucumber seedling, according to scab face on blade
Long-pending size is investigated, is evaluated the morbidity light and heavy degree of powdery mildew of cucumber to each single plant incidence：
0 grade-do not fall ill, highly resistance；
1 grade-scab accounts for blade area about 30%；
3 grades-scab accounts for blade area about 70%；
5 grades-scab accounts for blade area about 100%.
2, according to the disease index (DSI) of the morbidity rating calculation parent of investigation.It is parent and F2 groups referring to table 3
Incidence.Using the cucumber self-mating system SL02 (DSI=5.0) of the mildew-resistance of indoor acquisition, easy susceptible self-mating system XL01
(DSI=96.8).215 single plants of F2 segregating populations are obtained by hybridization of female parent, selfing of SL02.215 single plants of F2 groups
Incidence is：0 grade 40 plants, 1 grade 93 plants, 3 grades 65 plants and 5 grades 17 plants.
The incidence of 3 parent of table and F2 groups is identified
3, the F2 hybridized with the susceptible material XL01 of receptor with reference to the method in embodiment 2, detection donor resistance parent SL02
The phenotypic results such as table 4 of the anti-sense powdery mildew of segregating population single plant.F2 segregating populations single plant phenotypic evaluation result and Genotyping knot
Fruit height correspond to, in F2 groups with the homozygous genotype G of disease-resistant parent SL02:G it is consistent have 8 plants 0 grade, 12 plants 1 grade, 9 plant 3
Grade, 1 plant 5 grades, with Susceptible parent XL01 homozygous genotypes A:A it is consistent have 7 plants 0 grade, 31 plants 1 grade, 22 plants 3 grades, 12 plants 5 grades,
A:G base types are totally 114 plants of heterozygous plant.
4, the genotype to F2 groups and phenotype relevance verification result carry out t-test analyses, and result is p=0.029 (p
<0.05), display CS_K_040108 labels are closely related with powdery mildew of cucumber disease resistance.
Table 4 CS_K_040108 labels are in F2 segregating population testing results
The present invention relates to the SNP marker of anti-cucumber powdery mildew material, which is located at No. 4 dyeing of cucumber
Body, associated region is in the segment of NCBI numbers NC_026660.1, initial position 22.3Mb, final position 23.1Mb, according to for
Sequence end base design SNP marker is changed, which is A/G.The present invention provides for detecting the SNP
The specific primer sets and detection method in site, the specific primer sets difference are as shown in table 1.SNP points of the present invention
Son label can be used for the prediction of anti-cucumber powdery mildew, can be used for screening and identifies whether nature genetic stocks has mildew-resistance
Character.Detection method provided by the invention is accurate and reliable, easy to operate, suitable for answering for high-throughput commercialization molecular breeding
With providing scientific basis for the selection and breeding or improvement of anti-cucumber powdery mildew kind.
The part preferred embodiment of the present invention is above are only, the present invention is not limited in the content of embodiment.For ability
For technical staff in domain, can there is various change and change in the conception range of technical solution of the present invention, made by appoint
What changes and change, within the scope of the present invention.
Sequence table
<110>Academy of Agricultural Sciences, Shanghai City
<120>A kind of SNP marker and its application for detecting anti-cucumber powdery mildew character
<160> 6
<170> SIPOSequenceListing 1.0
<210> 2
<211> 101
<212> DNA
<213>Cucumber (Cucumis sativus)
<400> 2
taactccaac tactctcttt tcagttcttt tcatttccca aacactacca rtctcatctg 60
tcaaacaaat tgggcatata atgagtattg acagtagagt a 101
<210> 2
<211> 44
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gaaggtgacc aagttcatgc ttttcatttc ccaaacacta ccag 44
<210> 3
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
gaaggtcgga gtcaacggat tttcatttcc caaacactac caa 43
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
tgcccaattt gtttgacaga 20
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
gaaggtgacc aagttcatgc t 21
<210> 6
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
gaaggtcgga gtcaacggat t 21
Claims (10)
1. a kind of SNP marker for detecting anti-cucumber powdery mildew character, it is characterised in that：The SNP marker position
In cucumber rice chromosome, associated region is in the segment of NCBI numbers NC_026660.1, initial position 22.3Mb, stop bit
Set 23.1Mb, the sequence of the SNP marker as shown in SEQ ID NO.1, wherein base r at the sites 51nt be A or
G, the site base be G cucumber show as it is disease-resistant, base be A cucumber show as it is susceptible.
2. requiring the specific primer sets of the SNP marker described in 1 for test right, which is characterized in that including：
(1) two special primer CS_K_040108X and CS_K_040108Y：The sequence of primer CS_K_040108X such as SEQ ID
Shown in NO.2, the sequence of primer CS_K_040108Y is as shown in SEQ ID NO.3；
(2) universal primer CS_K_040108C：Its sequence is as shown in SEQ ID NO.4.
3. application of the specific primer sets in detecting cucumber variety mildew-resistance character described in claim 2.
4. application of the specific primer sets according to claim 3 in detecting cucumber variety mildew-resistance character,
It is characterized in that, includes the following steps：
(1) Cucumber germplasm DNA to be measured is extracted；
(2) using Cucumber germplasm DNA as template, KASP reaction inspections are carried out using the specific primer sets described in claim 2
It surveys, FAM-tail is separately connected at the 5 '-ends of two specific primers CS_K_040108X and CS_K_040108Y:5’-
GAAGGTGACCAAGTTCATGCT-3 ' and VIC-tail:5 '-GAAGGTCGGAGTCAACGGATT-3 ' universal fluorescent label sequences
Row；
(3) when detecting anti-cucumber powdery mildew character, if it is corresponding glimmering to only detect the connected fluorescence sequences of primer CS_K_040108Y
Optical signal, then cucumber to be measured show as mildew-resistance；If it is corresponding to only detect the connected fluorescence sequences of primer CS_K_040108X
Fluorescence signal then judges that cucumber to be measured is not disease-resistant material；Judge cucumber for mildew-resistance if being detected simultaneously by the two fluorescence
Heterozygous.
5. application of the specific primer sets according to claim 4 in detecting cucumber variety mildew-resistance character,
It is characterized in that：Selection detects that the cucumber sample of the corresponding fluorescence signal of the connected fluorescence sequences of primer CS_K_040108Y is educated
Kind.
6. application of the specific primer sets according to claim 4 in detecting cucumber variety mildew-resistance character,
It is characterized in that, the PCR conditions in step (2) in KASP detections are：94℃15min；95 DEG C of 20sec, 65-56 DEG C of 60sec, each
Cycle annealing elongating temperature reduces by 0.8 DEG C, totally 10 cycles；94 DEG C of 20sec, 57 DEG C of 60sec, totally 26 recycle.
7. the method that the specific primer sets described in claim 2 are used to detect the SNP marker, this method are：
KASP detections are carried out to the genomic DNA of cucumber to be detected using the specific primer sets described in claim 2, are being drawn
The 5 '-ends of object CS_K_040108X and primer CS_K_040108Y are separately connected different universal fluorescent sequence labels；If only examining
The corresponding fluorescence signal of the connected fluorescence sequences of primer CS_K_040108Y is measured, then cucumber to be measured is mildew-resistance material, base
Because type is G, if only detecting the fluorescence signal of the connected fluorescence sequences of primer CS_K_040108X, judge that cucumber to be measured is not resist
The material of powdery mildew, genotype A；If being detected simultaneously by two kinds of fluorescence, cucumber sample is judged to carry resistance to powdery mildew
The heterozygous of shape.
8. including the kit of the specific primer sets described in claim 2.
9. application of the kit according to any one of claims 8 in Cucumber Germplasm improvement.
10. application of the kit according to any one of claims 8 in cultivating powdery mildew resisting green cucumber.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810798871.0A CN108546778B (en) | 2018-07-19 | 2018-07-19 | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810798871.0A CN108546778B (en) | 2018-07-19 | 2018-07-19 | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108546778A true CN108546778A (en) | 2018-09-18 |
| CN108546778B CN108546778B (en) | 2021-06-01 |
Family
ID=63492095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810798871.0A Active CN108546778B (en) | 2018-07-19 | 2018-07-19 | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108546778B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102125521B1 (en) * | 2019-06-18 | 2020-07-07 | 대한민국 | Single Nucleotide Polymorphism Marker Set for Identifying of Cucumber Baekdadagi Varieties and Uses Thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101351116A (en) * | 2005-11-04 | 2009-01-21 | 德鲁伊特种子研发有限公司 | Disease resistant cucumber plants |
| KR20100133014A (en) * | 2008-04-16 | 2010-12-20 | 세미니스 베저터블 시즈 인코포레이티드 | Downy mildew resistant cucumber plants |
| CN104152446A (en) * | 2014-08-06 | 2014-11-19 | 上海交通大学 | SSR molecular markers cosegregated from cucumber powdery mildew-resistant major QTL |
| CN104498486A (en) * | 2014-12-02 | 2015-04-08 | 中国农业科学院蔬菜花卉研究所 | Indel marker of powdery mildew resistant gene pm-h of cucumber and application of Indel marker |
| CN104560983A (en) * | 2015-01-30 | 2015-04-29 | 扬州大学 | Two SNP markers in close linkage with cucumber powdery mildew resistance and application thereof |
| CN104988142A (en) * | 2015-06-12 | 2015-10-21 | 浙江省农业科学院 | Novel cucumber SNP molecular marker |
| WO2018044529A1 (en) * | 2016-08-30 | 2018-03-08 | Seminis Vegetable Seeds, Inc. | Melon plants with improved traits |
-
2018
- 2018-07-19 CN CN201810798871.0A patent/CN108546778B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101351116A (en) * | 2005-11-04 | 2009-01-21 | 德鲁伊特种子研发有限公司 | Disease resistant cucumber plants |
| KR20100133014A (en) * | 2008-04-16 | 2010-12-20 | 세미니스 베저터블 시즈 인코포레이티드 | Downy mildew resistant cucumber plants |
| CN104152446A (en) * | 2014-08-06 | 2014-11-19 | 上海交通大学 | SSR molecular markers cosegregated from cucumber powdery mildew-resistant major QTL |
| CN104498486A (en) * | 2014-12-02 | 2015-04-08 | 中国农业科学院蔬菜花卉研究所 | Indel marker of powdery mildew resistant gene pm-h of cucumber and application of Indel marker |
| CN104560983A (en) * | 2015-01-30 | 2015-04-29 | 扬州大学 | Two SNP markers in close linkage with cucumber powdery mildew resistance and application thereof |
| CN104988142A (en) * | 2015-06-12 | 2015-10-21 | 浙江省农业科学院 | Novel cucumber SNP molecular marker |
| WO2018044529A1 (en) * | 2016-08-30 | 2018-03-08 | Seminis Vegetable Seeds, Inc. | Melon plants with improved traits |
Non-Patent Citations (6)
| Title |
|---|
| PENG ZHANG 等: "Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing", 《BMC GENOMICS》 * |
| XUEWEN XU 等: "Fine mapping of a dominantly inherited powdery mildew resistance major-effect QTL, Pm1.1, in cucumber identifies a 41.1 kb region containing two tandemly arrayed cysteine-rich receptor-like protein kinase genes", 《THEOR APPL GENET》 * |
| Y. SAKATA 等: "QTL analysis of powdery mildew resistance in cucumber (Cucumis sativus L.)", 《THEOR APPL GENET》 * |
| YUHUI WANG 等: "QTL mapping of downy and powdery mildew resistances in PI 197088 cucumber with genotyping-by-sequencing in RIL population", 《THEORETICAL AND APPLIED GENETICS》 * |
| 张鹏 等: "利用SLAF-seq 技术开发黄瓜白粉病抗性分子标记", 《分子植物育种》 * |
| 景然 等: "黄瓜白粉病抗性序列相关扩增多态性的分子标记研究", 《浙江大学学报(农业与生命科学版)》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102125521B1 (en) * | 2019-06-18 | 2020-07-07 | 대한민국 | Single Nucleotide Polymorphism Marker Set for Identifying of Cucumber Baekdadagi Varieties and Uses Thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108546778B (en) | 2021-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109735652B (en) | Wheat stripe rust resistant gene QYr.nwafu-6BL.2 linked KASP molecular marker, primer and application | |
| CN112725506B (en) | KASP primer group for detecting gibberellic disease resistance of Yangmai series wheat and application thereof | |
| CN107227373B (en) | SNP functional molecular marker of japonica rice lodging-resistant gene and application | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| CN111662966A (en) | Construction method and application of wheat backbone parent functional gene fingerprint spectrum | |
| CN110938706B (en) | Molecular marker closely linked with watermelon plant non-tendril gene Clnt and application thereof | |
| CN109913582B (en) | Molecular marker closely linked with rice blast resistance gene and application thereof | |
| CN108546777A (en) | A kind of SNP marker and its application for detecting the anti-clubroot of Chinese cabbage | |
| CN107400715A (en) | The exploitation and its application of the special chemoattractant molecule mark of Thinopyrum ponticum and probe | |
| CN106086007B (en) | Molecular labeling and its application with tomato atropurpureus fruit Gene A TV close linkage | |
| WO2005071076A1 (en) | Gene markers linked to fusarium head blight-resistance factor and utilization thereof | |
| CN108588273B (en) | Maize recessive nuclear male sterility mutant genems30Functional mark and application thereof | |
| CN108531642B (en) | SSR molecular markers for identifying corn varieties and application thereof | |
| CN108546778A (en) | A kind of SNP marker and its application for detecting anti-cucumber powdery mildew character | |
| CN106636349A (en) | SNP molecular marker in close linkage with bacterial blight resistance gene Xa7 and applications of SNP molecular marker | |
| CN110551843A (en) | Codominant marker primer capable of distinguishing RTSW homozygous heterozygous genotypes of tobacco anti-spotted wilt sites, distinguishing method and application thereof | |
| AU2020103461A4 (en) | Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| CN109913580B (en) | Application of molecular marker closely linked with rice blast resistance gene | |
| CN108728576B (en) | Marker of wheat chlorophyll content related gene and application thereof | |
| CN106350515B (en) | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN111424109B (en) | SNP molecular marker for identifying powdery mildew resistance traits of melons and application thereof | |
| BR112020026955A2 (en) | MARKER ASSOCIATED WITH SMUT RESISTANCE IN THE PLANT BELONGING TO THE SACCHARUM GENDER AND USE OF THE SAME | |
| CN109825619A (en) | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |