CN117535451A - Primer, probe and kit for detecting copy number of retrovirus vector in CAR-T cell - Google Patents
Primer, probe and kit for detecting copy number of retrovirus vector in CAR-T cell Download PDFInfo
- Publication number
- CN117535451A CN117535451A CN202410022680.0A CN202410022680A CN117535451A CN 117535451 A CN117535451 A CN 117535451A CN 202410022680 A CN202410022680 A CN 202410022680A CN 117535451 A CN117535451 A CN 117535451A
- Authority
- CN
- China
- Prior art keywords
- wpre
- copy number
- probe
- car
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000523 sample Substances 0.000 title claims abstract description 73
- 239000013598 vector Substances 0.000 title claims abstract description 35
- 241001430294 unidentified retrovirus Species 0.000 title claims abstract description 14
- 238000001514 detection method Methods 0.000 claims abstract description 40
- 108091093126 WHP Posttrascriptional Response Element Proteins 0.000 claims abstract description 17
- 230000001177 retroviral effect Effects 0.000 claims abstract description 17
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 14
- 239000013612 plasmid Substances 0.000 claims abstract description 9
- 239000000126 substance Substances 0.000 claims abstract description 4
- 238000000034 method Methods 0.000 claims description 51
- 210000004027 cell Anatomy 0.000 claims description 27
- 230000003321 amplification Effects 0.000 claims description 21
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 21
- 108020004414 DNA Proteins 0.000 claims description 11
- 230000009977 dual effect Effects 0.000 claims description 10
- 238000011084 recovery Methods 0.000 claims description 5
- 210000005260 human cell Anatomy 0.000 claims description 3
- 239000013642 negative control Substances 0.000 claims description 2
- 239000013641 positive control Substances 0.000 claims description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 2
- 238000011529 RT qPCR Methods 0.000 claims 11
- 238000003149 assay kit Methods 0.000 claims 3
- 239000013603 viral vector Substances 0.000 abstract description 12
- 238000010790 dilution Methods 0.000 abstract description 8
- 239000012895 dilution Substances 0.000 abstract description 8
- 238000003753 real-time PCR Methods 0.000 description 22
- 238000006243 chemical reaction Methods 0.000 description 19
- 239000000463 material Substances 0.000 description 7
- 238000012986 modification Methods 0.000 description 6
- 230000004048 modification Effects 0.000 description 6
- 238000002360 preparation method Methods 0.000 description 6
- 239000000047 product Substances 0.000 description 6
- 125000006853 reporter group Chemical group 0.000 description 6
- 210000001744 T-lymphocyte Anatomy 0.000 description 5
- 241000700605 Viruses Species 0.000 description 4
- 238000007792 addition Methods 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 238000013461 design Methods 0.000 description 3
- 238000011068 loading method Methods 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 239000012086 standard solution Substances 0.000 description 3
- 238000006467 substitution reaction Methods 0.000 description 3
- 238000003260 vortexing Methods 0.000 description 3
- 108010019670 Chimeric Antigen Receptors Proteins 0.000 description 2
- 101150058049 car gene Proteins 0.000 description 2
- 238000009169 immunotherapy Methods 0.000 description 2
- 230000010354 integration Effects 0.000 description 2
- 238000005457 optimization Methods 0.000 description 2
- 238000003752 polymerase chain reaction Methods 0.000 description 2
- 238000003908 quality control method Methods 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 230000001225 therapeutic effect Effects 0.000 description 2
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 108700020978 Proto-Oncogene Proteins 0.000 description 1
- 102000052575 Proto-Oncogene Human genes 0.000 description 1
- 102000006382 Ribonucleases Human genes 0.000 description 1
- 108010083644 Ribonucleases Proteins 0.000 description 1
- 108700025716 Tumor Suppressor Genes Proteins 0.000 description 1
- 102000044209 Tumor Suppressor Genes Human genes 0.000 description 1
- 230000004913 activation Effects 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000006285 cell suspension Substances 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 230000000295 complement effect Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000007847 digital PCR Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000000684 flow cytometry Methods 0.000 description 1
- 238000009472 formulation Methods 0.000 description 1
- 201000005787 hematologic cancer Diseases 0.000 description 1
- 208000024200 hematopoietic and lymphoid system neoplasm Diseases 0.000 description 1
- 230000002779 inactivation Effects 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 239000013062 quality control Sample Substances 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 208000011581 secondary neoplasm Diseases 0.000 description 1
- 238000011896 sensitive detection Methods 0.000 description 1
- 210000001082 somatic cell Anatomy 0.000 description 1
- 238000001179 sorption measurement Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Virology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a primer, a probe and a kit for detecting copy number of a retrovirus vector in a CAR-T cell, which comprises the following components: universal primer WPRE-L, WPRE-R and probe WPRE-P of WPRE element region of retroviral vector for detection of VCN: the sequence of the WPRE-L is shown in SEQ ID NO. 1; the sequence of the WPRE-R is shown in SEQ ID NO. 2; the sequence of the WPRE-P is shown in SEQ ID NO. 3; a partial sequence of the viral vector is shown in SEQ ID NO. 7. The quantitative detection of the target genes WPRE and hALB is realized by carrying out gradient dilution on plasmid working standard substances, and the detection method is time-saving, labor-saving, good in repeatability, strong in specificity and capable of obtaining reliable results in a short time.
Description
Technical Field
The invention belongs to the technical field of biological product detection, and relates to a primer, a probe and a kit for detecting the copy number of a retrovirus vector in a CAR-T cell, in particular to a primer, a probe and a kit for detecting the copy number of the retrovirus vector in the CAR-T cell based on a double qPCR (Quantitative polymerase chain reaction, qPCR) method.
Background
Chimeric antigen receptor T Cell (Chimeric Antigen Receptor T-Cell, CAR-T) immunotherapy is an important method in current tumor immunotherapy, and its therapeutic effect in hematological tumors is particularly prominent. The viral vector carries the CAR gene to integrate into the T cell genome, and on one hand, the T cell is modified with the CAR gene, and on the other hand, the viral vector is also an index for measuring safety: multiple random integration may cause the risk of secondary tumors caused by activation of protooncogenes or inactivation of tumor suppressor genes, etc., and although the design of viral vectors has now greatly reduced the potential risk of integration, it is still necessary to detect and control the copy number (VCN) of viral vectors integrated into the T cell genome to ensure the safety of CAR-T cell products. CDE provides that the copy number of the viral vector is less than or equal to 5 copies/cell in CAR-T cell therapeutic product quality control detection study and non-clinical study consideration points.
The foregoing background knowledge is intended to assist those of ordinary skill in the art in understanding the prior art that is closer to the present invention and to facilitate an understanding of the inventive concepts and aspects herein, and it should be understood that the foregoing background art should not be used to assess the novelty of the present application without explicit evidence that such disclosure is already disclosed prior to the filing date of the present application.
Disclosure of Invention
Currently, three methods of digital PCR (ddPCR), fluorescent quantitative PCR (qPCR) and flow cytometry are mainly used as the detection methods of VCN, wherein the qPCR method is the most commonly used method. In a single qPCR method reaction system, one reaction tube can only detect one target gene at a time, but the double qPCR method can detect the copy number VCN of the viral vector and the single copy gene in somatic cells in the same reaction tube, reduce the consumption of reagent consumables, reduce errors caused by operation among different reaction tubes, and improve the reliability of detection results.
Aiming at solving the technical problem of how to design and optimize a universal primer/probe to rapidly and reliably detect the copy number of a retrovirus vector in a CAR-T cell, the primer, the probe and a double qPCR method detection kit for detecting the copy number of the retrovirus vector in the CAR-T cell are provided, and quantitative detection of target genes WPRE and hALB is realized by carrying out gradient dilution on plasmid working standard substances, and the detection method is time-saving, labor-saving, good in repeatability, strong in specificity and capable of obtaining reliable results in a short time.
In order to achieve the above object, the present invention provides the following technical solutions.
Primers and probes for detecting the copy number of a retroviral vector in a CAR-T cell, comprising:
universal primer WPRE-L, WPRE-R and probe WPRE-P designed for WPRE element region of retroviral vector:
the sequence of the WPRE-L is shown in SEQ ID NO. 1;
the sequence of the WPRE-R is shown in SEQ ID NO. 2;
the sequence of WPRE-P is shown in SEQ ID NO. 3.
As a preferable mode of the technical scheme of the invention, the fluorescent reporter group of the probe WPRE-P is VIC.
The sequence of the WPRE-L is as follows: CGCTGTGTGGATATGCTGCTT.
The sequence of the WPRE-R is as follows: CGGGCCACAACTCCTCATAA.
The sequence of the WPRE-P is as follows: AATGCCTCTGTATCATGC.
As a preference for the technical scheme of the invention, part of the sequence of the viral vector is shown in SEQ ID NO. 7.
The partial sequence of the virus vector is as follows: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGATATTCTTAACTATGTTGCTCCTTTTACGCTGTGTGGATATGCTGCTTTAATGCCTCTGTATCATGCTATTGCTTCCCGTACGGCTTTCGTTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCCGTCAACGTGGCGTGGTGTGCTCTGTGTTTGCTGACGCAACCCCCACTGGCTGGGGCATTGCCACCACCTGTCAACTCCTTTCTGGGACTTTCGCTTTCCCCCTCCCGATCGCCACGGCAGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTAGGTTGCTGGGCACTGATAATTCCGTGGTGTTGTCGGGGAAGCTGACGTC.
As a preferred aspect of the present invention, the primer and probe for detecting copy number of retroviral vector in CAR-T cell further comprises: primers hAbb gRT-L, hAbb gRT-R and probe hAbb gRT-P for detecting single copy of reference gene hAbb in human cells:
the sequence of hALB gRT-L is shown in SEQ ID NO. 4;
the sequence of hALB gRT-R is shown in SEQ ID NO. 5;
the sequence of hALB gRT-P is shown in SEQ ID NO. 6.
As a preferable mode of the technical scheme of the invention, the fluorescent reporter group of the probe hALB gRT-P is FAM.
The sequence of hALB gRT-L is as follows: GTCACATGTGGCTAATGGCTAC.
The sequence of hALB gRT-R is as follows: TCCCAACTAAGCACAGGAATG.
The sequence of the hALB gRT-P is as follows: TTGGACAGTACAGCTCTGGAACTTGC.
The primer and the probe are applied to detecting the copy number of the retrovirus vector in the CAR-T cells by a double qPCR method.
The primer and the probe are applied to the preparation of a double qPCR detection kit.
In the technical scheme of the application, the partial sequence of the viral vector is only the partial viral vector sequence of the primer and probe pairing region and/or the corresponding complementary sequence, but not the complete viral sequence. The fluorescent reporter group of the probe WPRE-P is VIC, the fluorescent reporter group of the probe hALB gRT-P is FAM, and fluorescent light of different channels is detected by means of a detection instrument, so that quantitative detection of two different target genes can be realized in the same reaction tube at the same time.
The double qPCR method detection kit comprises a plasmid work standard, and the primer and the probe for detecting the copy number of the retrovirus vector in the CAR-T cell.
As a preference for the technical scheme of the invention, the double qPCR method detection kit also comprises water and an orifice plate which do not contain RNase.
A method for detecting retroviral vector copy number in CAR-T cells by a double qPCR method comprising:
1) Extracting genomic DNA of a sample and detecting the concentration of the sample;
2) Drawing a standard curve by using a plasmid working standard substance CG 2-hALB;
3) The detection sample is diluted and then is detected and VCN is calculated: vcn=2×wpre copy number/hALB copy number.
As a further preference to the technical scheme of the present application, in step 1), QIAamp DNA Mini Kit (51304, qiagen) is used to extract genomic DNA of the sample to be examined.
As a further preference to the technical scheme of the application, in step 1), the sample concentration is determined using an ultra-micro spectrophotometer Nanodrop one.
As a further preferred aspect of the present application, the determination that the detection result of the method for detecting the copy number of a retroviral vector in CAR-T cells by the double qPCR method satisfies the system applicability requirement is valid:
the amplification efficiency of the standard curve is between 85.0 and 110.0 percent, and the correlation coefficient R 2 ≥0.99；
The recovery rate of the positive control is 80% -120%;
ct of no template negative control NTC was either > 40 or underwomined.
The primer/probe for detecting the copy number of the retrovirus vector is positioned in the WPRE element region of the virus vector, can be used as a universal primer/probe for VCN detection, has good specificity for detecting and selecting an internal reference gene hALB by single copy genes in human cells, has no similarity with human genome in the element sequence of the applied part of the virus vector, and can not amplify any sequence except the element sequence of the part of the virus vector after the primer and the probe are put in, so that the primer/probe has excellent detection accuracy, application sensitivity and precision. The quantitative detection of the target genes WPRE and hALB is realized by carrying out gradient dilution on plasmid working standard CG 2-hALB. The method for detecting the copy number of the retrovirus vector in the CAR-T cell provided by the invention is time-saving, labor-saving, good in repeatability, strong in specificity and capable of obtaining a reliable result in a short time.
The above-mentioned preferable conditions can be combined with each other to obtain a specific embodiment on the basis of common knowledge in the art.
The raw materials or the reagents involved in the invention are all common commercial products, and the related operations are all routine operations in the field unless specified.
Compared with the prior art, the invention has the following beneficial effects:
the universal primer, the probe and the primer and the probe for detecting the hALB in the WPRE element region are provided, the fluorescent reporter group of the probe WPRE-P is VIC, the fluorescent reporter group of the hALB gRT-P is FAM, and fluorescence of different channels is detected by a detection instrument, so that quantitative detection of two different target genes can be realized in the same reaction tube at the same time, the specificity of the primer and the probe is good, the applied partial viral vector element sequence has no similarity with a human genome, and after the primer and the probe are put in, any sequence except the partial viral vector element sequence can not be amplified, so that the detection accuracy, the application sensitivity and the precision are excellent. The method for detecting the copy number of the retrovirus vector in the CAR-T cells by the double qPCR method has the advantages of time saving, labor saving, good repeatability and strong specificity, and can obtain a reliable result in a short time.
The invention adopts the technical proposal to realize the aim, makes up the defects of the prior art, has reasonable design and convenient operation.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It will be apparent to those of ordinary skill in the art that the drawings in the following description are exemplary only and that other implementations can be obtained from the extensions of the drawings provided without inventive effort.
FIG. 1 shows a standard curve of WPRE with a final concentration of 100nM for the probe;
FIG. 2 shows an amplification profile of WPRE with a final concentration of 100nM for the probe;
FIG. 3 shows a standard curve of hALB when the final concentration of the probe was 100 nM;
FIG. 4 shows a standard chart of hALB when the final concentration of the probe was 100 nM;
FIG. 5 shows a standard curve of WPRE with 200nM final concentration of probe;
FIG. 6 shows an amplification profile of WPRE with a final concentration of 200nM for the probe;
FIG. 7 shows a standard curve of hALB when the final concentration of the probe was 200 nM;
FIG. 8 shows an amplification pattern of hALB when the final concentration of the probe was 200 nM.
Detailed Description
Suitable substitutions and/or modifications of the process parameters will be apparent to those skilled in the art from the disclosure herein, however, it is to be expressly pointed out that all such substitutions and/or modifications are intended to be included in the present invention. While the products and methods of preparation of the present invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that variations and modifications can be made in the products and methods of preparation described herein without departing from the spirit and scope of the invention.
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The present invention uses the methods and materials described herein, but other suitable methods and materials known in the art may also be used. The materials, methods, and examples described herein are illustrative only and not intended to be limiting. All publications, patent applications, patents, provisional applications, database entries, and other references mentioned herein, and the like, are incorporated herein by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
All percentages, parts, ratios, etc., are by weight unless otherwise specified; the other specification includes, but is not limited to, "wt%" means weight percent, "mol%" means mole percent, "vol%" means volume percent.
When an amount, concentration, or other value or parameter is given as either a range, preferred range, or a series of upper preferable values and lower preferable values, this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value, regardless of whether ranges are separately disclosed. For example, when a range of "1 to 5 (1 to 5)" is described, the described range should be understood to include ranges of "1 to 4 (1 to 4)", "1 to 3 (1 to 3)", "1 to 2 (1 to 2) and 4 to 5 (4 to 5)", "1 to 3 (1 to 3) and 5", and the like. Where a range of values is described herein, unless otherwise stated, the range includes the range endpoints and all integers and fractions within the range.
Unless specifically stated otherwise, the materials, methods, and examples described herein are illustrative only and not intended to be limiting. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described herein.
The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention. Meanwhile, the embodiments and features in the embodiments in the present application may be combined with each other without conflict. The present application will be described in detail below with reference to the accompanying drawings in conjunction with embodiments.
The present invention is described in detail below.
Example 1
Dual qPCR method amplification system optimization
1. Detection process
1.1 extraction of genomic DNA from samples to be examined
1.1.1, 5X 10 6 The individual CAR-T cell suspensions were transferred to a 1.5mL centrifuge tube, centrifuged at 500g for 5min, and the supernatant discarded.
1.1.2, 200. Mu.L PBS solution was added to each tube, and mixed by vortexing.
1.1.3, 20. Mu.L protease K was added to each tube and mixed by vortexing.
1.1.4, 200. Mu.L Buffer AL was added to each tube, and mixed by vortexing.
1.1.5, incubation at 56℃for 10min, adding 200. Mu.L absolute ethanol into each tube, and mixing by vortex shaking.
1.1.6, the supernatant was transferred to an adsorption column, 6,000g (8000 rpm), centrifuged for 1min, and the column was placed in a new collection tube.
1.1.7, 500. Mu.L Buffer AW1,6,000g (8000 rpm) was added to each column, centrifuged for 1min, and the column was placed in a new collection tube.
1.1.8, 500. Mu.L Buffer AW2, 16,000g (14000 rpm) was added to each column, centrifuged for 2min, and the column was placed in a new 1.5mL centrifuge tube and left at room temperature for 3min.
1.1.9, 60. Mu.L Buffer AE was added per tube, 6,000g (8000 rpm), and the eluate was collected by centrifugation for 1 min.
1.1.10 the concentration and purity of the extracted samples were measured with an ultra-micro spectrophotometer Nanodrop: 92 ng/. Mu. L, A260/A280 = 1.98.
2. Standard curve preparation
DNA dilution against working Standard CG2-hLB (Pre: 8.52X10) 9 cobies/. Mu.L), the specific procedure is shown in Table 1, the ST0 working standard solution is obtained first, and then the serial samples for preparing the standard curve are obtained according to the obtained ST0 working standard solution and the gradient dilution is carried out according to Table 1.
TABLE 1-CG2-hALB plasmid working Standard dilution procedure
3. PCR reaction
The preparation of the PCR reaction system was carried out according to the table 2.
TABLE 2 preparation of PCR reaction System
4. Amplification procedure
The PCR amplification procedure was performed according to Table 3.
TABLE 3 PCR amplification procedure
5. Reaction results
Tables 4 and 5 show the reaction results of the reaction system 1, with a final probe concentration of 100nM, i.e., an addition volume of 0.2. Mu.L.
TABLE 4 Probe concentration 100nM one of the reaction results
TABLE 5 Probe concentration 100nM second of the reaction results
Tables 6 and 7 show the reaction results of reaction system 2 with a final probe concentration of 200nM, i.e., an addition volume of 0.4. Mu.L.
TABLE 6 Probe concentration 200nM one of the reaction results
TABLE 7 Probe concentration 200nM second of the reaction results
6. Summary of results
Under the amplification system 1 and the amplification system 2, the detection results meet the system applicability requirement, wherein, fig. 1 and 2 show the standard curve and the amplification map of the WPRE under the amplification system 1, fig. 3 and 4 show the standard curve and the amplification map of the hALB under the amplification system 1, fig. 5 and 6 show the standard curve and the amplification map of the WPRE under the amplification system 2, and fig. 7 and 8 show the standard curve and the amplification map of the hALB under the amplification system 2. Comprehensive amplification parameters, complex inter-well C T The final probe concentration of 200nM (i.e., 0.4. Mu.L added) is preferred in view of the combination of SD, standard curve morphology, etc.
Example 2
Optimal sample loading amount optimization of double qPCR method samples
The extracted genomic DNA samples were diluted to 100 ng/. Mu.L, 20 ng/. Mu.L, 4 ng/. Mu.L, and 0.8 ng/. Mu.L with DNA dilutions, respectively, and 10-fold dilutions of ST2 standard solutions were used as positive Quality Control (QCS) in detection. Standard curve formulation and specific qPCR assay were performed as in example 1.
Standard curve amplification parameters are shown in table 8.
TABLE 8 Standard Curve amplification parameters
TABLE 9 quality control sample detection results
TABLE 10 sample detection data
Summary of detection results
The detection results of the sample loading amount of 0.8-100 ng/. Mu.L fall in the standard curve range, and the VCN detection results of different sample loading amounts (0.8/4/20/100 ng/. Mu.L) have no obvious difference.
Example 3
Dual qPCR method accuracy verification
Based on example 1, QCS of three different concentrations, high, medium and low, were added to the extracted sample genomic DNA to verify the accuracy of the dual qPCR method, and the accuracy detection results are shown in table 11.
TABLE 11 Dual qPCR accuracy test results
As can be seen from the detection results of the table 11, the recovery rate of the high-concentration QCS sample is 98% -116%; the recovery rate of the medium-concentration QCS sample is 97% -102%, and the recovery rate of the low-concentration QCS sample is 95% -109%, which all meet the requirements of 80% -120%.
In summary, universal amplification primers/probes were innovatively designed in the WPRE gene element region of the retroviral vector to quantitatively detect the copy number of the retroviral vector; meanwhile, primers/probes are designed on the single copy internal reference gene hALB sequence on the genome of the human body cell, and quantitative detection is carried out on the detection template. On the basis, two groups of different probes are innovatively marked with different fluorescent groups VIC and FAM respectively, so that quantitative detection of two different target genes is simultaneously carried out in the same reaction single tube, the loss of manual operation and reagent consumable materials is greatly reduced, and reliable and sensitive detection results can be obtained.
The conventional technology in the above embodiments is known to those skilled in the art, and thus is not described in detail herein.
The specific embodiments described herein are offered by way of example only to illustrate the spirit of the invention. Various modifications or additions to the described embodiments may be made by those skilled in the art to which the invention pertains or may be substituted in a similar manner without departing from the spirit of the invention or beyond the scope of the appended claims.
While the invention has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof.
While the above detailed description has shown, described, and pointed out novel features as applied to various embodiments, it will be understood that various omissions, substitutions, and changes in the form and details of the device or method illustrated may be made without departing from the spirit of the disclosure. In addition, the various features and methods described above may be used independently of one another, or may be combined in various ways. All possible combinations and subcombinations are within the scope of this disclosure. Many of the embodiments described above include similar components, and thus, these similar components are interchangeable in different embodiments. While the invention has been disclosed in the context of certain embodiments and examples, it will be understood by those skilled in the art that the invention extends beyond the specifically disclosed embodiments to other alternative embodiments and/or uses and obvious modifications and equivalents thereof. Therefore, the present invention is not intended to be limited by the specific disclosure of the preferred embodiments herein.
The invention is a well-known technique.
Claims (10)
1. A primer and probe for detecting the copy number of a retroviral vector in a CAR-T cell, comprising:
universal primer WPRE-L, WPRE-R and probe WPRE-P designed for WPRE element region of retroviral vector was used to detect VCN:
the sequence of the WPRE-L is shown in SEQ ID NO. 1;
the sequence of the WPRE-R is shown in SEQ ID NO. 2;
the sequence of WPRE-P is shown in SEQ ID NO. 3.
2. The primer and probe for detecting the copy number of a retroviral vector in a CAR-T cell according to claim 1, further comprising: primers hAbb gRT-L, hAbb gRT-R and probe hAbb gRT-P for detecting single copy of reference gene hAbb in human cells:
the sequence of hALB gRT-L is shown in SEQ ID NO. 4;
the sequence of hALB gRT-R is shown in SEQ ID NO. 5;
the sequence of hALB gRT-P is shown in SEQ ID NO. 6.
3. Use of the primer and probe of claim 1 or 2 for detecting the copy number of a retroviral vector in a CAR-T cell by a double qPCR method.
4. Use of the primer and probe according to claim 1 or 2 for preparing a dual qPCR assay kit.
5. A dual qPCR assay kit comprising a plasmid work standard and the primers and probes for detecting the copy number of a retroviral vector in a CAR-T cell according to claim 1 or 2.
6. The dual qPCR assay kit as claimed in claim 4, wherein: RNase-free water and well plates are also included.
7. A method for detecting the copy number of a retroviral vector in a CAR-T cell by a double qPCR method, comprising: the dual qPCR method detection kit of claim 5 or 6 is adopted, a standard curve is constructed by using the plasmid work standard, and the copy number of the retrovirus vector in the CAR-T cells is obtained by constructing a dual qPCR method detection system by using the primer and the probe.
8. The method for detecting the copy number of a retroviral vector in a CAR-T cell by a double qPCR method according to claim 7, characterized by comprising in particular:
1) Extracting genomic DNA of a sample and detecting the concentration of the sample;
2) Drawing a standard curve by using a plasmid working standard substance CG 2-hALB;
3) The detection sample is diluted and then is detected and VCN is calculated: vcn=2×wpre copy number/hALB copy number.
9. The method for detecting the copy number of a retroviral vector in a CAR-T cell by the double qPCR method according to claim 8, wherein:
in step 1), the genomic DNA of the sample to be tested is extracted using QIAamp DNA Mini Kit (51304, qiagen); and/or
In step 1), the sample concentration was determined using an ultra-micro spectrophotometer Nanodrop one.
10. The method of dual qPCR method for detecting retroviral vector copy number in CAR-T cells according to any one of claims 7 to 9, wherein:
the detection result of the method for detecting the copy number of the retrovirus vector in the CAR-T cell by the double qPCR method meets the requirement of system applicability and is judged as effective:
the amplification efficiency of the standard curve is between 85.0 and 110.0 percent, and the correlation coefficient R2 is more than or equal to 0.99;
the recovery rate of the positive control is 80% -120%;
ct of no template negative control NTC was either > 40 or underwomined.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410022680.0A CN117535451A (en) | 2024-01-08 | 2024-01-08 | Primer, probe and kit for detecting copy number of retrovirus vector in CAR-T cell |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410022680.0A CN117535451A (en) | 2024-01-08 | 2024-01-08 | Primer, probe and kit for detecting copy number of retrovirus vector in CAR-T cell |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117535451A true CN117535451A (en) | 2024-02-09 |
Family
ID=89782616
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410022680.0A Pending CN117535451A (en) | 2024-01-08 | 2024-01-08 | Primer, probe and kit for detecting copy number of retrovirus vector in CAR-T cell |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117535451A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112575093A (en) * | 2020-12-15 | 2021-03-30 | 北京艺妙神州医药科技有限公司 | Primer probe composition and kit for detecting adoptive immune cells |
| CN116356005A (en) * | 2023-04-28 | 2023-06-30 | 宁波熙宁检测技术有限公司 | Composition for detecting CAR-T cell copy number and application thereof |
-
2024
- 2024-01-08 CN CN202410022680.0A patent/CN117535451A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112575093A (en) * | 2020-12-15 | 2021-03-30 | 北京艺妙神州医药科技有限公司 | Primer probe composition and kit for detecting adoptive immune cells |
| CN116356005A (en) * | 2023-04-28 | 2023-06-30 | 宁波熙宁检测技术有限公司 | Composition for detecting CAR-T cell copy number and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| LIN YE 等: "Mesothelin‑targeted second generation CAR‑T cells inhibit growth of mesothelin‑expressing tumors in vivo", 《EXPERIMENTAL AND THERAPEUTIC MEDICINE》, vol. 17, 31 December 2019 (2019-12-31), pages 739 - 747 * |
| MULROONEY-COUSINS, P.M. 等: "KJ755405.1 Woodchuck hepatitis virus isolate 8/M isolation-source liver-negative inocula polymerase protein and X protein genes, partial cds", 《GENBANK》, 4 September 2014 (2014-09-04), pages 1 - 2 * |
| RIEDER, M.J. 等: "EF649953.1 Homo sapiens albumin (ALB) gene, complete cds", 《GENBANK》, 23 July 2007 (2007-07-23), pages 1 - 12 * |
| YAMAMOTO, T. 等: "AF410861.1 Woodchuck hepatitis B virus isolate 342 polymerase gene, complete cds", 《GENBANK》, 18 February 2004 (2004-02-18), pages 1 - 2 * |
| 张飞飞 等: "一种检测慢病毒滴度的实时荧光定量PCR方法", 《生物技术通讯》, vol. 30, no. 4, 31 July 2019 (2019-07-31), pages 523 - 527 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12110538B2 (en) | Method for detecting nucleic acid based on prokaryotic argonaute protein and application thereof | |
| WO2016188144A1 (en) | Str locus fluorescent labeling multiplex amplification kit having enhanced identification capability and use thereof | |
| CN107354239B (en) | Multiplex fluorescence quantitative PCR method and kit for detecting EB virus | |
| CN112391500B (en) | Fluorescent quantitative PCR detection primer, probe and kit for simultaneously detecting cat parvovirus and cat AIDS virus | |
| CN111534514A (en) | Novel coronavirus detection kit based on Crisper | |
| CN109750124B (en) | Nucleic acid group for detecting lentivirus and detection method | |
| CN110157837B (en) | Primer and method for detecting peste des petits ruminants virus and bluetongue virus | |
| CN116814859A (en) | Primer probe composition, kit and method for identifying African swine fever virus genes I and II | |
| CN116790823A (en) | Dual quantitative RT-PCR detection composition, kit and method for synchronously detecting HTLV-1 and HTLV-2 | |
| CN110735003A (en) | Universal primer, kit and detection method for detecting fungal contamination in cell product | |
| CN117535451A (en) | Primer, probe and kit for detecting copy number of retrovirus vector in CAR-T cell | |
| CN108300804B (en) | Material and method for HBV miR-3 fluorescent quantitative PCR detection | |
| CN115852058A (en) | Primer and probe combination for detecting T cell lymphotropic virus of monkey and application thereof | |
| CN116219071A (en) | Multiplex qPCR kit for simultaneously detecting and identifying type I, type IIa and type IIb monkey poxviruses | |
| CN115896316A (en) | Tuberculosis detection method | |
| CN116254371A (en) | Primer molecular beacon combination for wild type and mutant molecular typing of monkey pox virus and application thereof | |
| CN114807318A (en) | Composition, kit and method for detecting Vero cell genome DNA | |
| CN111534634A (en) | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof | |
| CN113881808B (en) | Physical titer detection kit and detection method for viral vector | |
| CN114317835B (en) | Multiplex PCR detection primer set, kit and detection method for waterfowl parvovirus, duck enteritis virus and goose astrovirus | |
| CN116200546B (en) | PRCV, PRRSV, SIV and PRV multiplex RT-qPCR kit and detection method | |
| CN117660701B (en) | LAMP primer group, kit and method for detecting Liquorice pangolin virus | |
| CN114703322B (en) | Primer pair, kit and detection method for RT-RAA fluorescence detection of avian leukosis virus P12 gene | |
| CN116516069B (en) | RPA kit for rapidly detecting Epstein-Barr virus in cells | |
| CN110195128B (en) | Nucleotide sequence of skin type HPV typing detection primer based on constant temperature nucleic acid amplification technology and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |