CN112575093A - Primer probe composition and kit for detecting adoptive immune cells - Google Patents

Abstract

The invention provides a primer probe composition and a kit for detecting adoptive immune cells, wherein a target gene of the primer probe composition is a coding gene of a lentivirus capsid protein. The invention designs a primer probe according to the coding gene nucleic acid sequence of the lentiviral capsid protein, utilizes the fluorescent quantitative PCR to detect the adoptive immune cells based on the lentiviral transduction gene, and particularly can be applied to the detection of the distribution and the pharmacokinetic indexes of the adoptive immune cells in the animal body.

Description

Primer probe composition and kit for detecting adoptive immune cells

Technical Field

The invention belongs to the technical field of biology, and relates to a primer probe composition and a kit for detecting adoptive immune cells.

Background

The lentivirus vector is constructed by removing genes required for virus replication and adding therapeutic genes and selective markers based on lentivirus genome. The lentivirus vector has large transfer gene segment capacity, no toxicity, less possibility of inducing host immune reaction and high safety, and can infect not only dividing cells, but also terminally differentiated cells and non-dividing cells (such as nerve cells, stem cells, myofibroblasts, retinal cells and liver cells) and the target gene integrated in the target cell genome can be stably expressed for a long time. Thus, lentiviral vectors have become the focus of current gene transfer vector research, with the most interesting being HIV-1 based lentiviral vectors.

The applications of the lentivirus vector are very wide, and comprise tumor treatment, HIV infection treatment, gene therapy of nervous system diseases, new vaccine and new drug development, protein production, transgenic animal preparation and the like. Among them, the application is mainly applied to adoptive immune cell therapy in tumor therapy, including chimeric antigen receptor T cell therapy (CAR-T), T cell receptor modified T cell therapy (TCR-T), chimeric antigen receptor NK cell therapy (CAR-NK), chimeric antigen receptor modified macrophage therapy (CAR-macrocage), and the like. The slow virus vector can lead the target gene to generate specific killing effect on target cells by introducing the target gene into host cells, and the cells with the transferred foreign gene are most cells used in adoptive immune cell therapy.

The pharmacokinetics research of the adoptive immune cells is an important index for the preclinical evaluation of the medicine, and can provide important reference data for clinical administration dosage, post-medicine observation period and the like. Such studies are mainly performed in animals, and the studies mainly concern the problems of cell proliferation, tissue organ distribution, survival time and the like in animals, and at present, methods for detecting the pharmacokinetics of the adoptive immune cells mainly comprise flow cytometry, quantitative PCR, RNAscope, 3D technology and the like.

The flow cytometry mainly utilizes the protein coded by the tag gene in the lentiviral vector to detect the existence of the corresponding cell, but the effect of the tag gene in the cell is not clear, the side effect of the coded protein applied to a human body is not known, the uncertain factor is large, and the safety is uncontrollable. When the target gene to which lentivirus is introduced does not carry a marker gene, the gene introduction rate is detected by using a general-purpose target protein-recognizing antibody. The method needs to screen sensitive and specific recognition antibodies, and the technical threshold is high. In addition, the preparation of the flow type sample of each organ tissue of the animal is complicated, the operation is difficult to carry out for a long time, and the requirement on the freshness of the sample is high, so that the flow cytometry is not suitable for the pharmacokinetic research of the adoptive immune cells.

RNAscope relates to the steps of paraffin embedding, slicing, staining and the like of each tissue, is relatively complex and time-consuming, reaction conditions are not easy to control, false results are easy to occur, and a large number of slices need to be processed in pharmacokinetic research, so that the technical difficulty is further increased.

The 3D technology is an emerging method, is currently not perfect, and is not suitable for processing a large number of samples, and therefore is not suitable for pharmacokinetic studies of adoptive immune cells.

The quantitative PCR does not need to introduce a special label gene, the sample preparation method is simple, the sample can be stored for a long time, the test time consumption is short, and the result is accurate, so the fluorescent quantitative PCR method is suitable for the pharmacokinetic research of the adoptive immune cells.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides a primer probe composition and a kit for detecting adoptive immune cells based on lentivirus transduction genes.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a primer probe composition, wherein a target gene of the primer probe composition is a coding gene of a lentiviral capsid protein, and the primer probe composition is used for detecting adoptive immune cells which are constructed based on transduction of genes by lentiviral vectors.

In the invention, the coding gene of the capsid protein of the lentivirus is taken as a target gene, a specific primer probe is designed, accurate detection of the efficiency of introducing exogenous genes carried by the lentivirus into a host genome is realized based on fluorescent quantitative PCR, and the method has wide application prospect in the aspects of pharmacokinetics research of adoptive immune cells and the like.

Preferably, the coding gene of the lentivirus capsid protein has the length of 589bp and comprises a nucleic acid sequence shown as SEQ ID NO. 1;

SEQ ID NO:1：

aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgc。

preferably, the primer comprises a nucleic acid sequence shown as SEQ ID NO. 2-3;

SEQ ID NO:2：GGCTTTCATTTTCTCCTCCTTGTA；

SEQ ID NO:3：CGGGCCACAACTCCTCATAA。

preferably, the probe comprises a nucleic acid sequence shown as SEQ ID NO. 4;

SEQ ID NO:4：ATCCTGGTTGCTGTCTC。

preferably, the 5 'end of the probe is modified with a fluorescent group, and the 3' end of the probe is modified with a quenching group.

Preferably, the fluorescent group comprises any one of FAM, HEX, TET, JOE, CY3, VIC, or CY5, preferably FAM.

Preferably, the fluorescence quenching group comprises any one of MGB, MGBNFQ, BHQ1, BHQ2 or BHQ3, preferably MGBNFQ.

In a second aspect, the present invention provides a kit for detecting adoptive immune cells, the kit comprising the primer probe composition of the first aspect.

Preferably, the kit further comprises a PCR premix purchased from TAKARA under the cat number RR 390A.

Preferably, the kit further comprises a standard plasmid for constructing a standard curve.

Preferably, the standard plasmid is a CAR plasmid, preferably a CD19 CAR plasmid.

Preferably, the copy number of the CAR plasmid is 1 × 10⁸～1×10⁹copies/μL。

In a third aspect, the invention provides a method for detecting adoptive immune cells, which comprises performing fluorescent quantitative PCR on sample DNA by using the kit of the second aspect, and calculating the copy number of the lentivirus gene in the sample according to a standard curve.

Preferably, the sample comprises any one or a combination of at least two of heart, liver, spleen, lung, kidney, brain, uterus, testis, ovary, epididymis, stomach, duodenum, fat, skeletal muscle, colon, bone marrow, or blood.

Preferably, the condition of the fluorescent quantitative PCR is pre-denaturation at 93-98 ℃ for 20-40 s; denaturation at 93-98 ℃ for 5-10 s, annealing at 50-55 ℃ for 10-20 s, extension at 70-75 ℃ for 30-40 s, and 30-40 cycles.

Preferably, the standard curve is constructed using a gradient dilution of the CAR plasmid.

As a preferred embodiment, the present invention provides a method for detecting adoptive immune cells, comprising the steps of:

(1) for copy number of 1 × 10⁸～1×10⁹Gradient dilution of copies/μ L CAR plasmid, fluorescent quantitative PCR using the kit of claim 4 or 5, with the conditions of pre-denaturation at 93-98 ℃ ™ 20 ∞40 s; performing denaturation at 93-98 ℃ for 5-10 s, annealing at 50-55 ℃ for 10-20 s, extending at 70-75 ℃ for 30-40 s, and performing 30-40 cycles to construct a standard curve;

(2) extracting DNA from heart, liver, spleen, lung, kidney, brain, uterus, testis, ovary, epididymis, stomach, duodenum, fat, skeletal muscle, colon, bone marrow and blood of a tumor-bearing mouse, and performing fluorescent quantitative PCR by using the kit of claim 4 or 5 under the condition of pre-denaturation at 93-98 ℃ for 20-40 s; denaturation at 93-98 ℃ for 5-10 s, annealing at 50-55 ℃ for 10-20 s, extension at 70-75 ℃ for 30-40 s, and 30-40 cycles;

(3) and calculating according to the amplification result and the standard curve to obtain the CAR gene distribution in different tissues of the tumor-bearing mouse.

In a fourth aspect, the invention provides the use of a primer probe composition according to the first aspect and/or a kit according to the second aspect in the pharmacokinetic study of lentiviral vector-based adoptive immune cells.

Compared with the prior art, the invention has the following beneficial effects:

(1) the invention designs a specific primer probe aiming at the coding gene of the capsid protein of the lentivirus based on fluorescent quantitative PCR, realizes accurate and rapid detection of the pharmacokinetics index of the adoptive immune cell, and has the advantages of rapid detection speed, high accuracy, low cost, high safety and the like compared with methods such as flow cytometry, RNAscope, 3D and the like;

(2) in the invention, CD19 CAR-T is intravenously administered to tumor-bearing mice, the drug is mainly distributed in tissues or organs such as spleen, whole blood, lung, kidney, liver, heart, bone marrow and the like, while the drug is less distributed in spinal cord, brain and muscle, the concentration of T cells in collected tissues reaches the peak at 336h, and no cell elimination is observed;

(3) the primer probe composition, the kit and the method have no limitation on a detection sample, the sample can be derived from tissues, cells or blood, the genomic DNA extracted from the sample can be stored for a long time, the flexibility of test operation can be improved, and the primer probe composition, the kit and the method are suitable for detection of cell pharmacokinetics in adoptive immune cell treatment based on a lentiviral vector introduction technology (an animal model in non-clinical research or a patient in clinical research) and detection of in-vivo distribution of special tumor cells based on the lentiviral vector introduction technology, and have wide application prospects.

Drawings

FIG. 1 is a standard graph;

FIG. 2 is a graph of the drug concentration of CD19 CAR-T in tissues of B-NDG tumor-bearing mice as a function of time;

FIG. 3 is a graph of tissue exposure levels of CD19 CAR-T in B-NDG tumor-bearing mice.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Example 1 primer design procedure

The primer design uses Oligo software, the length of the primer is set to be 18-40 bases, the GC content of the base of the primer is 40% -60%, the length of the product is 50-300 bases, the GC content of the base of the product is 40% -60%, primer dimer and hairpin structure are avoided to be formed through the analysis of the Oligo software so as to determine a proper upstream and downstream primer pair, and the final primer pair SEQ ID NO: 2-3 is determined through qPCR verification.

Example 2 establishment of leukemia model

In this example, NALM-6 tumor cells (purchased from ATCC) were cultured to the vigorous growth stage and inoculated into 5-6 week-old B-NDG mice (purchased from Poosaccare) by intravenous injection at an inoculation dose of 1X 10⁶And/42 mice were inoculated, half in each case, and the growth of tumor cells was monitored daily on the day of injection and thereafter using a small animal imaging system, while tumor-free mice were used as a control group.

Example 3 preparation of CD19 CAR-T cells

T cells were isolated from peripheral blood mononuclear cells (Miaotong (Shanghai) Biotech Co., Ltd., China) of healthy volunteers using CD3/CD28 Dynabeads (thermo Fisher), and the isolated and purified T cells (in this case, the T cells were combined with CD3/CD28 Dynabeads) were cultured at 1.0X 10⁶Inoculating and culturing cells/mL into X-VIVO 15 medium (Lonza, Switzerland), adding 500IU/mL IL-2 (Shandong Jintai bioengineering Co., Ltd., China) for activating and culturing for 48 hours, adding prepared virus solution into cells according to MOI of 1, and performing lentivirus infection;

centrifuging and changing the solution 24 hours after the virus infects the cells, and adding a fresh X-VIVO 15 culture medium containing 500IU/mL IL-2 to continue culturing;

after 9-11 days of cell culture, all cells in the culture system were collected and Dynabeads were removed with a magnetic frame, T cells were collected by centrifugation and counted, and CAR content of each group of cells was measured using a flow cytometer (NovoCyte 2060R, ACEA Biosciences, San Diego, CA, USA).

Example 4 tumor-bearing mice reinfused CD19 CAR-T

CD19 CAR-T was injected into tumor-bearing mice via tail vein once. To accurately monitor CAR-T cell distribution, taking into account the bearing capacity of the mice and the sensitivity of the monitoring method, the maximum dose 5X 10 that the mice can bear is used⁸The cells/kg were studied, and the injection volume was 0.2-0.4 mL/mouse (maximum dose was 0.4 mL/mouse tail vein).

This example sets up a CAR-T test group and a vehicle control group for a 56 day test period. Since CAR-T cells show a peak of in vivo proliferation in the presence of target cells at week 2, one dissection point was set at week 2, three dissection points 3h, 2 days and 7 days before week 2 were monitored for changes in the ascending phase of cells, the descending phase was gradually monitored after week 2, week 8 was set as the dissection endpoint, and dissection points at weeks 4 and 6 were set in the middle to monitor changes in the descending phase of cells. The specific information is shown in table 1.

TABLE 1 tumor-bearing mouse distribution test schedule

Example 5 fluorescent quantitative PCR detection of in vivo distribution of CD19 CAR-T

After heart perfusion of the mouse model, samples of heart, liver, spleen, lung, kidney, brain, uterus/testis, ovary/epididymis, stomach, duodenum, fat, skeletal muscle, colon, bone marrow and blood of all mice were taken, and genomic DNA was extracted using a commercially available kit.

The primer probes shown in Table 2 were used to perform three-step fluorescent quantitative PCR, the reaction system (20. mu.L) is shown in Table 3, and the reaction program was pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5s, annealing at 55 ℃ for 15s, and extension at 72 ℃ for 35s, for 40 cycles.

TABLE 2

Name (R)	Numbering	Sequence of
			WF	SEQ ID NO:2	GGCTTTCATTTTCTCCTCCTTGTA
WR	SEQ ID NO:3	CGGGCCACAACTCCTCATAA
			WP	SEQ ID NO:4	FAM-ATCCTGGTTGCTGTCTC-MGBNFQ

TABLE 3

Name of solution	Addition amount per reaction
		Premix Ex TaqTM	10μL
WF(SEQ ID NO:2)	0.4μL(500nM)
		WR(SEQ ID NO:3)	0.4μL(500nM)
WP(SEQ ID NO:4)	0.4μL(250nM)
		ROX	0.4μL
Template DNA	2.0μL(50ng)
		H2O	6.4μL

Take 1X 10⁹copies/. mu.L CD19 CAR plasmid as Stock (Stock A) according to Table 4And (4) diluting by using the method.

TABLE 4

Add 4. mu.L/reaction CD19 CAR plasmid DNA to the mouse genomic background, corresponding to 4X 10^2-～4×10⁷copies/. mu.g DNA, construction of the standard curve shown in FIG. 1, CAR plasmid standard at 4X 10²～4×10⁷Dilution in the range of copies/. mu.g DNA, good linearity, R²0.996, and the amplification efficiency was 101.9%.

And (3) performing fluorescence quantitative PCR (polymerase chain reaction) on the genomic DNA of different tissues of the tumor-bearing mouse as a template, and determining the distribution of CAR molecules in the mouse according to a standard curve.

The results are shown in FIG. 2, and all animals showed an overall downward trend 5min after intravenous administration of CAR-T cells in B-NDG tumor-bearing mice when CAR gene copies were detectable in peripheral blood (6/6, average 33905.6 copies/. mu.g DNA); by 28 days of administration, CAR gene copy was minimized (2/6, mean 676.5copies/μ g DNA); the increase occurred again at 42 days (5/6, average 12208.2 copies/. mu.g DNA) and 56 days (4/5, average 7946.0 copies/. mu.g DNA) of administration.

After intravenous administration of CD19-CAR-T cells to B-NDG tumor-bearing mice, they first entered the heart with the blood, then exited the heart into the pulmonary circulation and then entered the heart, and then redistributed through the arteries. And 3h after administration, the CAR genes are mainly distributed in tissues with abundant blood flow, such as heart, liver, lung and the like, wherein the CAR genes have the highest lung content, are in an integral descending trend in 2-14 days, and then gradually ascend to reach the highest value in 42 days. Spleen as an important immune organ, CAR gene copies were detectable in all animals 2 days after administration, followed by a gradual upward trend in total to a peak at 56 days after administration. Bone marrow tissue detected copies of CAR gene at 2 days of dosing, after which the assay was below the lower limit of quantitation, and gradually increased by detection of copies of CAR gene at 28 days of dosing. Other tissues such as kidney, brain, stomach, duodenum, fat, muscle, colon, testis, epididymis and the like are administrated for 3h to 28 days, most tissue detection values are lower than the lower limit of quantification, CAR gene copy is detected (obviously increased compared with the previous period) by 42 days of administration, and copy number of each tissue is reduced by 56 days of administration. Uterine and ovarian showed only 56 days after administration of the CAR gene copies. Based on the results of the detection of CAR gene copies in each tissue, the CAR gene copies in most tissues were elevated at 42 days after administration, indicating that CAR-T cell activation and expansion occurred in most tissues systemically after 42 days of administration. According to the area under the curve (AUC) results, as shown in FIG. 3, the CAR-T cells were most highly distributed in the spleen, and were low in lung, fat, stomach, epididymis, liver, muscle, kidney, testis, blood, duodenum, bone marrow, heart, and other tissues. In conclusion, the organ distribution of CAR-T cells in tumor-bearing mice is influenced by the mode of administration and the characteristics of the cells themselves, and the results are consistent with the in vivo distribution profile of the cell preparation.

In conclusion, the invention designs the specific primer probe aiming at the coding gene of the lentivirus capsid protein, and realizes the accurate and rapid detection of the CD19 CAR-T cell distribution in the animal body by utilizing the fluorescent quantitative PCR, thereby having wide application prospect in the aspects of pharmacokinetics research of adoptive immune cells and the like.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

SEQUENCE LISTING

<110> Beijing Art Shenzhou pharmaceutical science and technology, Inc.; hippocastanay Biotech Co Ltd

<120> a primer probe composition and kit for detecting adoptive immune cells

<130> 20201116

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 589

<212> DNA

<213> Artificial sequence

<400> 1

aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60

ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120

atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180

tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240

ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300

attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360

ttgggcactg acaattccgt ggtgttgtcg gggaagctga cgtcctttcc atggctgctc 420

gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480

aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540

cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgc 589

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence

<400> 2

ggctttcatt ttctcctcct tgta 24

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

cgggccacaa ctcctcataa 20

<210> 4

<211> 17

<212> DNA

<213> Artificial sequence

<400> 4

atcctggttg ctgtctc 17

Claims (10)

1. A primer probe composition characterized by comprising a probe,

a) the target gene of the primer probe composition is a coding gene of a lentivirus capsid protein;

b) the primer probe composition is used for detecting adoptive immune cells which are constructed based on transduction of genes by lentiviral vectors.

2. The primer probe composition of claim 1, wherein the gene encoding the lentiviral capsid protein comprises the nucleic acid sequence set forth in SEQ ID NO. 1.

3. The primer probe composition of claim 1 or 2, wherein the primer comprises a nucleic acid sequence shown as SEQ ID NO. 2-3;

preferably, the probe comprises a nucleic acid sequence shown as SEQ ID NO. 4;

preferably, the 5 'end of the probe is modified with a fluorescent group, and the 3' end of the probe is modified with a quenching group;

preferably, the fluorescent group comprises any one of FAM, HEX, TET, JOE, CY3, VIC or CY5, preferably FAM;

preferably, the fluorescence quenching group comprises any one of MGB, MGBNFQ, BHQ1, BHQ2 or BHQ3, preferably MGBNFQ.

4. A kit for detecting adoptive immune cells, comprising the primer probe composition of any one of claims 1-3.

5. The kit of claim 4, further comprising a PCR premix;

preferably, the kit further comprises a standard plasmid;

preferably, the standard plasmid is a CAR plasmid, preferably a CD19 CAR plasmid;

preferably, the copy number of the CAR plasmid is 1 × 10⁸～1×10⁹copies/μL。

6. A method for detecting adoptive immune cells, which comprises performing fluorescent quantitative PCR on a sample DNA using the kit of claim 4 or 5, and calculating the copy number of a lentiviral gene in the sample according to a standard curve.

7. The method of claim 6, wherein the sample comprises any one or a combination of at least two of heart, liver, spleen, lung, kidney, brain, uterus, testis, ovary, epididymis, stomach, duodenum, fat, skeletal muscle, colon, bone marrow, or blood.

8. The method according to claim 6 or 7, wherein the condition of the fluorescent quantitative PCR is pre-denaturation at 93-98 ℃ for 20-40 s; denaturation at 93-98 ℃ for 5-10 s, annealing at 50-55 ℃ for 10-20 s, extension at 70-75 ℃ for 30-40 s, and 30-40 cycles;

preferably, the standard curve is constructed using a gradient dilution of the CAR plasmid.

9. Method according to any of claims 6-8, characterized in that the method comprises the steps of:

(1) for copy number of 1 × 10⁸～1×10⁹Performing gradient dilution on the copies/mu L CAR plasmid, and performing fluorescent quantitative PCR by using the kit of claim 4 or 5 under the condition of pre-denaturation at 93-98 ℃ for 20-40 s; performing denaturation at 93-98 ℃ for 5-10 s, annealing at 50-55 ℃ for 10-20 s, extending at 70-75 ℃ for 30-40 s, and performing 30-40 cycles to construct a standard curve;

(2) extracting DNA from heart, liver, spleen, lung, kidney, brain, uterus, testis, ovary, epididymis, stomach, duodenum, fat, skeletal muscle, colon, bone marrow and blood of a tumor-bearing mouse, and performing fluorescent quantitative PCR by using the kit of claim 4 or 5 under the condition of pre-denaturation at 93-98 ℃ for 20-40 s; denaturation at 93-98 ℃ for 5-10 s, annealing at 50-55 ℃ for 10-20 s, extension at 70-75 ℃ for 30-40 s, and 30-40 cycles;

(3) and calculating according to the amplification result and the standard curve to obtain the CAR gene distribution in different tissues of the tumor-bearing mouse.

10. Use of the primer probe composition of any one of claims 1 to 3 and/or the kit of claim 4 or 5 for pharmacokinetic studies of lentiviral vector-based adoptive immune cells.

Images