CN117535289A - Polynucleotide sequence for controlling coleopteran pest stress of plants and application - Google Patents

Polynucleotide sequence for controlling coleopteran pest stress of plants and application Download PDF

Info

Publication number
CN117535289A
CN117535289A CN202311272554.2A CN202311272554A CN117535289A CN 117535289 A CN117535289 A CN 117535289A CN 202311272554 A CN202311272554 A CN 202311272554A CN 117535289 A CN117535289 A CN 117535289A
Authority
CN
China
Prior art keywords
seq
gene
sequence
target
dsrna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311272554.2A
Other languages
Chinese (zh)
Inventor
王发浩
许超
林海燕
沈志成
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hangzhou Ruifeng Bio Tech Co ltd
Original Assignee
Hangzhou Ruifeng Bio Tech Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hangzhou Ruifeng Bio Tech Co ltd filed Critical Hangzhou Ruifeng Bio Tech Co ltd
Priority to CN202311272554.2A priority Critical patent/CN117535289A/en
Publication of CN117535289A publication Critical patent/CN117535289A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
    • A01G13/00—Protecting plants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
    • A01G7/00—Botany in general
    • A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1247—DNA-directed RNA polymerase (2.7.7.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07006—DNA-directed RNA polymerase (2.7.7.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Environmental Sciences (AREA)
  • Ecology (AREA)
  • Plant Pathology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Physics & Mathematics (AREA)
  • Forests & Forestry (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • Insects & Arthropods (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Botany (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

The invention discloses a polynucleotide sequence for controlling the stress of a plant coleopteran pest and application thereof, wherein the polynucleotide sequence is screened to obtain a target gene capable of effectively controlling the coleopteran pest (especially double-spotted fluorescent leaf beetles), the RNA interference technology is utilized to lower the expression of the target gene in coleopteran pest larvae or adults by silencing the target sequence, and the vital activities such as feeding, growth, propagation and the like of the pest are inhibited, so that the aim of preventing and controlling the coleopteran pest from invading crops is fulfilled, and damage caused by the coleopteran pest is reduced. The invention adopts RNAi transgenic plant means to protect corn from the damage of double-spotted fluorescent leaf beetles, and the mode of creating transgenic crops is adopted to ensure that the crops have certain insect prevention effect in the whole growth period, thus realizing the protection of plants in the whole growth period.

Description

Polynucleotide sequence for controlling coleopteran pest stress of plants and application
Field of the art
The invention relates to a method for controlling plant pest stress, in particular to a polynucleotide sequence derived from plant coleoptera pests and a method for controlling the expression of target genes in double-spotted fluorescent leaf beetles by utilizing an RNA interference technology and inhibiting the growth and development of the double-spotted fluorescent leaf beetles.
(II) background art
Pest stress is the main cause of crop yield loss, and the most common control method for pest attack in crops is still to spray chemical pesticides, however many pesticides are toxic, and direct contact can lead to poisoning of humans and other animals. The existing transgenic Bt protein has the defects of unstable control effect, narrow insecticidal spectrum, unsatisfactory control effect on coleopteran insect pests and the like. The transgenic crops containing Bt proteins have very limited control effects on coleopteran pests, and no related report on the control of double spot fluorescent leaf beetles which are main pests of current corn by using Bt proteins exists.
The double-spotted fluorescent leaf beetle Monolepta hieroglyphica (Motschulsky) belongs to coleoptera, phyllotoferae and firefly subfamily, and is an important pest in spring corn areas in northern China and inland corn areas in northwest China. The adult of the double-spot firefly leaf beetles has wide host plant range in China, and besides corn, the double-spot firefly leaf beetles also harm various crops such as sorghum, millet, cotton, beans, potatoes, white hemp, sunflowers and the like, economical plants such as cruciferous vegetables, beans, carrots, eggplants, liquorice, apples, apricots, poplars, willows and the like, and 30 kinds of 157 plants such as various field weeds and the like. The double-spotted fluorescent leaf beetles generate 1 generation in 1 year in northern areas, and winters with eggs. Larvae live in the surface soil, afraid of light and rarely climb off the surface of the soil. The larvae are harmful to the corn root system, a tunnel is formed on the surface of the main root, even the larvae dig into the thick root system to feed, and only the epidermis is left. The imago is the overground part of the maize plant, the imago flying ability of the imago just soon after eclosion is weak, the leaf is eaten in the lower part of maize first after the emergence, if the cornfield Bian Zacao clusters, the imago flies to the field side weeds and is eaten for a period of time, then it is harmful to transfer to the cornfield, after the maize begins to take out male and spit silk, the population quantity in the field rises sharply, the population quantity reaches the peak to the final stage of the male and spit silk of the maize, the population quantity reaches the peak in the early stage of the grouting, the cluster is eaten and is the pest filars, bracts and tender grains, pollination and grouting are blocked, the grain blighted or the bad pollination is often caused to form a flower grain stick, the pollination of the maize is influenced, the harvest is influenced, the influence on the yield of the maize is great.
The double-spotted fluorescent leaf beetle eggs and the larvae survive in the soil, and along with the continuous promotion of straw returning measures, the field humus is continuously rich and the soil surface coverage is increased, so that the difficulty of soil application is increased, and the prevention and control of the double-spotted fluorescent leaf beetle larvae are also more and more difficult. The adult double-spotted fluorescent leaf beetles are flying and jumped insects, the population quantity of the adult double-spotted fluorescent leaf beetles reaches the highest peak at the later stage of corn male-pulling and silking and the earlier stage of grouting, and at the moment, the corn grows high, and the application difficulty is greatly increased. The characteristic is different from other leaf beetle agricultural pests (such as western corn rootworm), namely the leaf beetles of the double-spotted fluorescent beetles meet the breeding peak of the leaf beetles in the corn spinning period, and the yield of crops is directly threatened; and the damage of leaf beetles such as western corn rootworm to corn root systems is larger. The control of the double-spot firefly leaf beetles can adopt the traditional methods of agricultural control (autumn ploughing, winter irrigation or early spring deep ploughing), physical control (insect catching net and the like), chemical control (pesticide) and the like. And many pesticides are toxic, direct contact can cause poisoning in humans and other animals. Therefore, an environment-friendly, convenient and easy method for preventing and treating the hazard of the double-spotted fluorescent leaf beetles is urgently needed.
RNA interference (RNAi) has been demonstrated as a means of efficiently modulating target genes in insects. The RNAi technology is utilized to silence specific target genes of pests, has great application potential for effectively preventing and controlling the pests, and is a novel and safe strategy for preventing and controlling agricultural pests. The key factor of the technology is to select the most proper target genes, namely genes playing important roles in the target biological process, such as signal transduction pathways, metabolic pathways and the like, and the functional deletion can lead to the inhibition of vital activities such as growth development or propagation of organisms or the apoptosis of the organisms.
Thus, the present invention will control pest infestation, particularly insect infestation of plants, by down-regulating specific target genes in the pest.
(III) summary of the invention
The invention aims to provide a polynucleotide sequence for controlling plant coleopteran pest stress and application thereof, and the polynucleotide sequence is screened to obtain a target gene capable of effectively controlling coleopteran pests (especially double-spotted fluorescent beetles), and the RNA interference technology is utilized to lower the expression of the target gene in coleopteran pest (especially double-spotted fluorescent beetles) larvae or adults through silencing the target sequence, so that vital activities such as pest feeding, growth, propagation and the like are inhibited, and the aim of preventing and controlling the coleopteran pests (especially double-spotted fluorescent beetles) from invading crops is fulfilled, and damage caused by the coleopteran pests is reduced. The invention adopts RNAi transgenic plant means to protect corn from the damage of double-spotted fluorescent leaf beetles, and the mode of creating transgenic crops is adopted to ensure that the crops have certain insect prevention effect in the whole growth period, thus realizing the protection of plants in the whole growth period.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
in a first aspect, the present invention provides a polynucleotide sequence for controlling coleopteran pest stress in a plant, said polynucleotide sequence being a target nucleotide sequence derived from a target gene of coleopteran pest diabrotica, said target nucleotide sequence having at least 15-21 consecutive nucleotides of the target gene nucleotide sequence or its complement, down-regulating expression of the target gene using RNA interference techniques, inhibiting growth of said coleopteran pest;
The target gene is one of the following: (1) The nucleotide sequence of the troponin I coding gene is shown as SEQ ID NO. 1; (2) The coding gene of trehalose synthase has a nucleotide sequence shown as SEQ ID NO. 10; (3) The encoding gene of the diaphragm joint protein has a nucleotide sequence shown as SEQ ID NO. 20; (4) The nucleotide sequence of the voxel protein Sec23A coding gene is shown as SEQ ID NO. 27; (5) The nucleotide sequence of the coding gene of the subunit RPB7 of the RNA polymerase II is shown as SEQ ID NO. 37; (6) The nucleotide sequence of the coding gene of the subunit II of the RNA polymerase is shown as SEQ ID NO. 44; (7) The nucleotide sequence of the ROP protein coding gene is shown as SEQ ID NO. 54; (8) The nucleotide sequence of the coding gene of the precursor mRNA shear factor is shown as SEQ ID NO. 64; (9) 26S proteasome non-ATPase regulatory subunit 7, the nucleotide sequence of the coding gene mov34 is shown as SEQ ID NO. 74; (10) The nucleotide sequence of the insect gap gene hunchback (Hb for short) is shown as SEQ ID NO. 83; (11) The nucleotide sequence of the coding gene Dre4 of the FACT complex subunit is shown as SEQ ID NO. 93; (12) The nucleotide sequence of the coding gene COPI-b of the COPI sleeve voxel subunit beta is shown as SEQ ID NO. 103.
Further, the polynucleotide sequence is one of the following: at least 15 consecutive nucleotides of the target gene nucleotide sequence, at least 17 consecutive nucleotides of the target gene nucleotide sequence, at least 19 consecutive nucleotides of the target gene nucleotide sequence, at least 21 consecutive nucleotides of the target gene nucleotide sequence, the target gene nucleotide sequence.
Further, when the target gene is a troponin I encoding gene, the polynucleotide sequence is shown as one of SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6.
Further, when the target gene is a trehalose synthase encoding gene, the polynucleotide sequence is shown as one of SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15 or SEQ ID NO. 16.
Further, when the target gene is the encoding gene of the diaphragm joint protein, the polynucleotide sequence is shown as one of SEQ ID NO. 22 and SEQ ID NO. 23.
Further, when the target gene is a set of voxel protein Sec23A coding gene, the polynucleotide sequence is shown as one of SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32 or SEQ ID NO. 33.
Further, when the target gene is the coding gene of the RNA polymerase II subunit RPB7, the polynucleotide sequence is shown as one of SEQ ID NO. 39 and SEQ ID NO. 40.
Further, when the target gene is the coding gene of RNA polymerase II subunit, the polynucleotide sequence is shown as one of SEQ ID NO. 46, SEQ ID NO. 47, SEQ ID NO. 48, SEQ ID NO. 49 and SEQ ID NO. 50.
Further, when the target gene is the ROP protein coding gene, the polynucleotide sequence is shown as one of SEQ ID NO. 56, SEQ ID NO. 57, SEQ ID NO. 58, SEQ ID NO. 59 and SEQ ID NO. 60.
Further, when the target gene is the coding gene of the precursor mRNA shearing factor, the polynucleotide sequence is shown as one of SEQ ID NO. 66, SEQ ID NO. 67, SEQ ID NO. 68, SEQ ID NO. 69 and SEQ ID NO. 70.
Further, when the target gene is the coding gene of the 6S proteasome, the polynucleotide sequence is shown as one of SEQ ID NO. 76, SEQ ID NO. 77, SEQ ID NO. 78 and SEQ ID NO. 79.
Further, when the target gene is insect gap gene hunchback, the polynucleotide sequence is shown as one of SEQ ID NO. 85, SEQ ID NO. 86, SEQ ID NO. 87, SEQ ID NO. 88 and SEQ ID NO. 89.
Further, when the target gene is the coding gene of FACT complex subunit, the polynucleotide sequence is shown as one of SEQ ID NO. 95, SEQ ID NO. 96, SEQ ID NO. 97, SEQ ID NO. 98 and SEQ ID NO. 99.
Further, when the target gene is a coding gene COPI-b of COPI sleeve voxel subunit beta, the polynucleotide sequence is shown as one of SEQ ID NO. 105, SEQ ID NO. 106, SEQ ID NO. 107, SEQ ID NO. 108 and SEQ ID NO. 109.
In a second aspect, the invention also provides a dsRNA expression cassette of the polynucleotide sequence, wherein the expression cassette is a promoter, a polynucleotide sequence, a spacer sequence, a complementary sequence of the polynucleotide sequence and a sequence effectively connected with a terminator. The spacer sequence is preferably set forth in SEQ ID NO. 114; the promoter is preferably a figwort mosaic virus 35S promoter (SEQ ID NO: 113); the terminator is preferably the terminator of nopaline synthase gene (SEQ ID NO: 115).
In a third aspect, the invention also relates to a plant expression vector constructed by the polynucleotide sequence dsRNA expression cassette.
Further, the plant expression vector also comprises a G10-2 expression frame, and the plant expression vector is based on pCambia1300, and the dsRNA expression frame of the polynucleotide sequence and the G10-2 expression frame are connected between HindIII and XhoI of the 1300 vector. The G10-2 expression frame comprises a promoter, a signal peptide, a G10-2 gene and a terminator; the promoter is preferably yellow leaf curl virus promoter pCmYLCV (SEQ ID NO: 116); the signal peptide is preferably corn chloroplast signal peptide sp (SEQ ID NO: 117); the G10-2 gene is a 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); the terminator is a polyadenylation signal (SEQ ID NO: 119).
In a fourth aspect, the invention provides the use of the polynucleotide sequence in the preparation of a formulation for interfering with expression of a target gene of a plant coleopteran pest or inhibiting growth of a plant coleopteran pest.
Further, the formulation includes interfering ribonucleic acids of the polynucleotide sequence that function to down-regulate expression of at least one target nucleotide sequence in the plant pest target gene upon ingestion by a coleopteran pest, thereby inhibiting growth of the plant coleopteran pest. The interfering ribonucleic acid comprises at least one silencing element that is a double stranded RNA region comprising annealed complementary strands, wherein one strand comprises or consists of a nucleotide sequence that is at least partially complementary to a target nucleotide sequence within the target gene.
Further, the interfering ribonucleic acid sequence comprises at least two silencing elements, each silencing element comprising or consisting of a nucleotide sequence complementary to the polynucleotide sequence; the polynucleotide sequences of each silencing element may be identical, or may be different, may be from the same source, may be from different sources, or may be from different sites of the same source.
Further, the interfering ribonucleic acid comprises dsRNA.
Further, the coleopteran pest is diabrotica.
Further, the formulation comprises the interfering ribonucleic acid and at least one agropharmaceutically acceptable carrier, excipient, or diluent.
In order to improve the stability and delivery efficiency of dsRNA, they may be encapsulated or modified into the form of nanoparticles, liposomes, polymer complexes, etc. These encapsulants or modifiers can enhance the stability of the dsRNA, extend its residence time in plants, and promote its uptake and release in plant cells. Chitosan (CS), also known as deacetylated chitin, is obtained by chemically treating chitin (chitosan), which is widely present in nature. The chitosan molecule has positive charge glucosamine groups, so that the chitosan molecule can generate electrostatic effect with DNA, dsRNA and the like with negative charges, and the chitosan molecule and the DNA are mixed and coagulated into a polymer compound, so that the DNA and CS are combined to form nanoscale particles with compact structures, and the dsRNA is more stable.
Further, the dsRNA acts in the form of a nanocrystallized RNAi formulation prepared as follows: mixing 0.2mg/mL chitosan solution and dsRNA solution, so that the mass ratio of the chitosan solution volume to dsRNA in the dsRNA solution is 100ul:30ug, shaking and mixing uniformly to enable dsRNA to be adsorbed on the surface of chitosan, thus obtaining a nano RNAi preparation; the solvent of the chitosan solution is NaAc buffer solution with pH of 4.5 and 0.1 mol/mL; the dsRNA solution consists of: dsRNA 50mg/L,50mM Na 2 HPO 4 (pH 7.0), 10mM beta-mercaptoethanol, 10mM EDTA, 0.1% sodium cetyl sulfonate, 0.1% polyethylene glycol octyl phenyl ether, and H were added 2 O makes up 1L.
In a fifth aspect, the invention provides a composition for controlling coleopteran pests prepared from the polynucleotide sequence, the composition comprising an interfering ribonucleic acid sequence that silences the polynucleotide sequence, the interfering ribonucleic acid sequence being a dsRNA.
Further, the compositions include an enhancer of dsRNA activity, which is used in combination with an enhancer of activity, to achieve a more powerful and sustainable insect control effect through interactions and synergistic effects. dsRNA activity enhancers include, but are not limited to, the following: (1) dsRNA enhancer: for enhancing stability and delivery efficiency of dsRNA. These enhancers may include polymers, liposomes, nanoparticles, or other carriers that protect the dsRNA from enzymatic degradation, increase its efficiency of cellular uptake and internal release, thereby enhancing the interfering action. (2) a targeted delivery system: for accurate delivery of dsRNA into target insect cells. These delivery systems can be specifically targeted, enabling precise delivery through recognition and binding to insect cell surface receptors, enhancing the effectiveness of dsRNA. (3) fusion protein: the dsRNA is fused with other functional proteins, so that double functions on insects are realized. The fusion protein may include an active ingredient such as an insect-specific toxin, inhibitor or promoter, to produce additional deleterious effects on the insect while inhibiting expression of the target gene. (4) synergists: for increasing the insect-resistant activity of dsRNA. These synergists may be auxiliary small molecule compounds, activators or synergists which work together with the dsRNA to enhance its effect against insects and to increase the ability to inhibit the expression of the target gene. (5) coding RNA (ncRNA): including micro RNA (miRNA), long-chain non-coding RNA, etc., these ncRNAs can jointly regulate insect gene expression by interacting with dsRNA, thus realizing more comprehensive and accurate insect control effect. (6) cofactors: for increasing stability, permeability or delivery efficiency of dsRNA. The auxiliary factors can be chemical modification groups, polymers, colloids or nano particles and the like, can improve the bioavailability of the dsRNA in an insect body, and can improve the service life and activity of the dsRNA in insect cells.
Further, the composition comprises an insecticide, and dsRNA and the insecticide are combined to produce a synergistic effect, so that the efficiency and the broad spectrum of insect control are improved, and the comprehensive control is performed on different types of pests and pests in different growth stages, so that a more comprehensive and durable insect attack control effect is realized. The pesticide may be chemical pesticide, biological pesticide, plant extract, natural substance or chemical substance, etc. These pesticides may have different mechanisms of action, targets or effects, and the following advantages may be achieved when used in combination with the dsRNA of the invention: (1) The resistance range is expanded, the development of the resistance of insects to the composition is avoided or delayed, and the durability of the control effect is increased. (2) improving the insect control effect: different agents may exert inhibitory effects on insects through different mechanisms of action. The mixed use can enhance the overall control efficacy through the influence of multiple action targets. (3) improving quick-acting property: some actives may have a faster insecticidal rate, while the compositions of the present invention may have a more durable effect. The mixed use can realize the rapid and long-acting insect control effect, and better cope with insect attack at different stages. (4) promoting diversity of insect control strategies: different active agents may be suitable for different insect species or stages. The mixed use can provide more control options, so that farmers can select the most suitable combination according to specific conditions, and more comprehensive and accurate insect control is realized.
The chemical pesticide comprises insecticidal aerosol such as pyrethroid, insecticidal powder such as methomyl, insecticidal liquid such as malathion, and insecticidal granules such as imidacloprid; the biopesticide includes bacillus thuringiensis insecticidal proteins, xenorhabdus insecticidal proteins, photorhabdus insecticidal proteins, bacillus laterosporus insecticidal proteins or bacillus sphaericus insecticidal proteins.
Further, the composition comprises a carrier suitable for agriculture to achieve prevention and/or control of insect infestation of plants. Such agricultural carriers have a variety of functions and advantages that enhance the stability, adhesion and durability of the composition and provide better modes and effects of application. Agricultural carriers can provide protection to the ingredients of the composition from decomposition or inactivation in the environment, and by encapsulating it in an agricultural carrier, can improve its stability, allowing it to remain active during storage and application. Agricultural carriers can increase the adhesion and cohesive capacity of the composition. By selecting an appropriate agricultural carrier, the composition can be made to form a uniform, durable coating on the plant surface or target area, providing longer contact and action. This helps ensure that the target insect is in contact with the composition, increasing the chances that it will be controlled. In addition, agricultural carriers may also provide ease of application characteristics. It may be flowable, dispersible and dissolvable to facilitate mixing with other pesticides or fertilizers and application to plants or target areas by spraying, painting, irrigation or other suitable means. This flexibility allows for more convenient, efficient application of the composition and accommodates different agricultural practices and needs. In agricultural applications, the effect and persistence of the composition is critical to the prevention and control of insect infestation of plants. By using agriculturally suitable carriers, the stability, adhesion and durability of the composition may be improved, thereby achieving longer insect control effects. This will help farmers reduce damage to crops by insect pests, increase yield and quality of agricultural products, and reduce reliance on chemical pesticides.
Further, the composition may be prepared according to the mode of application and prior art, may take any suitable physical form for application to insects, for example, the composition may be in solid form (powder, pellet or bait), liquid form (including as an insecticidal spray) or gel form; still further, the composition may be a coating, paste or powder that may be applied to a substrate to protect the substrate from insect infestation, any substrate or material susceptible to insect infestation or damage caused by insects may be used to protect the substrate from insect infestation.
The compositions of the present invention may be used as baits to attract insects to contact the composition. The bait is designed to attract insects and promote contact with the composition, thereby effecting insect control and management. Suitable bait compositions are selected based on the feeding and behavioral habits of the target insect. The bait composition may be insect-preferred food, food additive, food simulant or other material that is attractive to the target insect. The bait has added active ingredients which may have specific effects on insect control. The active ingredient may be an insecticide, a biopesticide, an insect sex pheromone, a catalyst or other substance harmful to insects or affecting their physiological function. The selected bait ingredients and the composition are mixed to form an attractive bait material. The bait particles may be coated, sprayed, made or otherwise treated as desired to increase their attractiveness and stability. By preparing the composition in the form of a bait, the target insects can be more effectively attracted to the composition. After being attracted by the bait, the insects come into contact with the composition and may ingest or come into contact with the active ingredient therein. The bait composition in the invention can be presented in various forms, such as liquid, particles, tablets, capsules and the like, so as to adapt to different application scenes and use modes.
Embodiments of the composition of the present invention for introduction into plants include (1) aqueous spraying: the dsRNA composition is prepared into an aqueous solution and is uniformly sprayed on the plant leaf surface by using a spraying device. This form of application allows for rapid and uniform delivery of the dsRNA into plant tissue, enabling it to contact and function with the target insect; (2) embedding the dosage form: the dsRNA composition is embedded in a suitable solid dosage form, such as granules or powder, and sprinkled into the soil surrounding the plant root. As the plant grows and the root system expands, dsRNA is gradually released and contacts with rhizosphere insects, so that the effect of insect control is realized; (3) puncture injection: for some trees or large plants, the dsRNA composition may be injected directly into the trunk or main limb of the plant by means of a puncture injection. This mode of application ensures that the dsRNA enters directly into the continued tissue of the plant to achieve insect control. (4) film coverage: a coating film is applied to the plant surface and the dsRNA composition is coated onto the film. This mode of administration delays degradation of the dsRNA, allowing for sustained release and contact and interaction with insects surrounding the plant. (5) Gene transfer: the related genes of the dsRNA composition are introduced into the genome of a plant by using gene transformation technology, so that the plant can express and produce dsRNA. Thus, dsRNA is produced at various parts of the plant to realize the omnibearing insect control effect.
The compositions of the present invention may be delivered to the insect environment by a variety of techniques to achieve a wider range of applications. Including but not limited to: (1) spraying and atomizing: the dsRNA composition is prepared into aqueous solution, and is sprayed to a target area in a form of fine liquid drops or mist through a sprayer or an atomizer, so that the dsRNA composition uniformly covers the plant surface or the air, and the aim of insect control is fulfilled. (2) powder dispersion and dispersion: the dsRNA composition is embedded in a suitable solid dosage form, prepared in powder or granular form, and uniformly spread over the soil, leaves or other insect-active area surrounding the plant by a powder spreader or spreading device, to be contacted with the target insect. (3) pouring and coating seeds: the dsRNA composition is mixed with the seed or coated on the surface of the seed, which is introduced into the soil during sowing. This allows the composition to co-grow with the plant through the process of seed germination and growth and provides protection during early stages of insect infestation. (4) introduction into the soil: the dsRNA composition is introduced into the soil by a soil treatment apparatus or irrigation system. This way, a barrier to insect control can be formed in the soil, affecting the life cycle, reproduction or behavior of the insect. (5) introduction into irrigation water: the dsRNA composition may be mixed with irrigation water, which is introduced into the roots and soil of plants through an irrigation system. This means that the composition can be absorbed by the root system of the plant, allowing the composition to be conducted throughout the plant and affecting the interaction of the insect with the plant. In treating plants susceptible to insect infestation, the composition may be delivered to the plant or part of the plant before the occurrence of the insect (for prophylactic purposes) or after the onset of signs of insect infestation (for control purposes).
In a sixth aspect, the invention also provides a method of using the polynucleotide sequence to control coleopteran pest stress in a plant, the method comprising contacting a coleopteran pest with an effective amount of interfering ribonucleic acid of the polynucleotide sequence. Such contact may be achieved by applying a composition or composition containing interfering ribonucleic acid to the surface of the insect or to the surface of the plant infested by the insect or by allowing the insect to ingest the interfering ribonucleic acid or composition. The interfering ribonucleic acid has a specific sequence, and once ingested by the insect, the metabolic processes within it will result in interaction of the interfering ribonucleic acid with the target gene. By binding to a target gene, interfering ribonucleic acids can down-regulate or inhibit the expression of a particular insect target gene, thereby affecting the physiological function and viability of the insect. Such interference can lead to abnormal development, impaired reproduction, anorexia and behavioral disturbance of the insect, ultimately leading to the prevention and/or control of insect infestation.
In a seventh aspect, the present invention provides the use of a polynucleotide sequence in the preparation of a plant having increased resistance to a coleopteran pest, the method comprising transferring the polynucleotide sequence or a construct comprising an interfering ribonucleic acid sequence of a polynucleotide sequence into a plant, the introduced plant acting to inhibit the growth of the coleopteran pest after consumption by the coleopteran pest; the polynucleotide sequence acts in the form of an expression cassette or expression vector; the plants include corn, cotton, soybean and canola. The coleopteran pest is diabrotica.
The term "target gene" as used herein refers to any sequence that is intended to be down-regulated in insects. By "any sequence" is meant any sequence that has the ability to regulate the physiological processes or functions of an insect. Target genes may include genes associated with insect growth, development, reproduction, appetite, behavior, or other critical physiological processes. These genes may be involved in regulating the hormone levels, metabolic pathways, neurotransmission, immune system or other important biological processes of the insect. By downregulating these target genes, the physiological functions of the insects can be negatively affected, thereby effectively controlling their number and behavior.
The interfering ribonucleic acids of the present invention encompass any type of RNA molecule capable of down-regulating or "silencing" the expression of a target sequence, including, but not limited to, sense RNA, antisense RNA, short interfering RNA (siRNA), microrna (miRNA), double-stranded RNA (dsRNA), hairpin RNA (hRNA), and the like. Methods for assaying functional interfering RNA molecules are well known in the art and have been disclosed.
The dsRNA molecules of the invention achieve sequence-specific downregulation of target gene expression by binding to a target nucleotide sequence within the target gene. Binding occurs because of base pairing between the dsRNA and the complementary region of the target nucleotide sequence. As used herein, the term "silencing element" refers to a portion or region comprising or consisting of a nucleotide sequence complementary or at least partially complementary to a target nucleotide sequence within a target gene, and which acts as an active portion of the interfering RNA to direct down-regulation of expression of the target gene. The silencing element comprises at least 15 contiguous nucleotides complementary to a target nucleotide sequence within a target gene.
The dsRNA of the invention comprises at least one silencing element, which may comprise one or more silencing elements, wherein each silencing element comprises or consists of a nucleotide sequence that is at least partially complementary to a target fragment within a target sequence and functions to down regulate expression of the target sequence upon ingestion by an insect. The term "plurality" means at least two, at least three, at least four, etc. and up to at least 10, 15, 20, or at least 30. The dsRNA of the invention needs to be of a length sufficient to be taken up by the cells of the insect and down-regulate the target sequence of the insect. The upper limit of length may depend on (1) the requirement that the dsRNA is taken up by the insect cell and (2) the requirement that the dsRNA is processed in the insect cell to mediate gene silencing via the RNAi pathway, and the length may also be formulated by the method of production and formulation used to deliver the dsRNA into the cell. Preferably, the dsRNA of the invention will be between 15 and 10000 nucleotides in length.
The silencing element or at least one strand thereof (when the silencing element is double stranded) of the dsRNA of the invention may be fully complementary or partially complementary to a target fragment of a target sequence. The term "fully complementary" means that all bases of the silencing element nucleotide sequence are complementary or "matched" to the bases of the target fragment. The term "at least partially complementary" means that there is less than 100% match between the bases of the silencing element and the bases of the target fragment. Those skilled in the art will appreciate that in order to mediate down-regulation of expression of a target sequence, the silencing element need only be at least partially complementary to the target fragment. It is known in the art that RNA sequences with insertions, deletions, and mismatches relative to the target sequence can still be effective in RNAi. The silencing element shares at least 80% to 99% sequence identity with the target fragment of the target sequence.
There is no upper limit on the concentration and dosage of the double-stranded ribonucleotides of the invention for use in the methods and compositions provided herein, and lower effective concentrations and dosages will be routinely sought by efficiency and economics. Non-limiting embodiments of an effective amount of double stranded ribonucleic acid include about 10ng/ml to about 100ug/ml double stranded ribonucleic acid in liquid form sprayed on the plant, or about 25mg/ha to about 250mg/ha double stranded ribonucleic acid applied to the plant in the field. Applications for the dsRNA compositions of the invention include, but are not limited to, the methods described above.
To improve ease of use and flexibility, the compositions of the present invention may be formulated in a concentrated form for direct administration or as a primary composition and require dilution prior to use. In the form of direct application, the composition is already prepared in the optimum proportions and concentrations and can be used directly for spraying, painting or irrigation of plants or target areas. This form is suitable for small area or on-demand scenarios, reducing the complexity of operation and time costs. Whereas in the concentrated form of the primary composition, the composition is prepared as a concentrate, powder or other high concentration form. This form has the advantage of effectively reducing transportation and storage costs and providing a longer shelf life. The primary composition may be prepared in a manufacturing or central processing facility and provided to the user in a portable and distributed form. Before use, the user needs to dilute the concentrate to an appropriate concentration according to the specific needs and then apply it to the plant or target area. The appropriate amount of the primary composition is mixed with water or other specified solvent in the recommended proportions to achieve the target concentration. This flexibility allows for more controlled use of the composition and allows for adjustment according to the circumstances and needs. The compositions of the present invention are highly adaptable and operable, both in direct administration form and in concentrated form of the primary composition. The user can select a proper use mode according to specific application requirements, insect density and other factors, and dilute the insect control agent according to the requirements so as to achieve the optimal insect control effect.
The term "effective amount" as used herein refers to an amount or concentration of interfering ribonucleic acid that imparts a phenotypic effect to an insect, thereby reducing the number of insects that attack the host organism and/or the amount of damage caused by the insect. Such a phenotypic effect may be manifested as death of the insect, with at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, more preferably at least 80% or 90% of the insect mortality achieved by use of the interfering RNA compared to control insects. In addition, phenotypic effects may include other effects that prevent insect growth, stop feeding, or reduce oviposition. Thus, the method may reduce the total number of insects that attack the host organism by at least 20%, 30%, 40%, preferably by at least 50%, 60%, 70%, more preferably by at least 80% or 90% compared to control insects. Alternatively, the damage caused by the insect may be reduced by at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, more preferably at least 80% or 90% compared to the control insect. Thus, the present invention may be used to achieve at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, more preferably at least 80% or 90% insect control.
In the present invention, the method of introducing interfering ribonucleic acid (RNAi) into plants can be accomplished by direct transformation. Direct transformation refers to the direct introduction of interfering RNA into plant cells for expression and action in plants. In this method, a variety of direct transformation techniques may be used, such as Agrobacterium-mediated transformation, gene gun methods, electroporation, and the like. These techniques can be effective in introducing interfering RNA into plant cells for uptake and expression by the plant cells. In the direct transformation process, the desired interfering RNA sequences can be introduced into plant cells using appropriate vectors and transformation genome construction. These vectors may contain appropriate promoters, transcription terminators and other regulatory elements to ensure proper expression and production of interfering RNAs in plant cells. Such breeding techniques are well known to those skilled in the art.
The target gene is WupA troponin I, namely troponin I, which is one of components of an insect troponin-tropomyosin complex, and insects inhibit contraction and relaxation of muscles through the protein, so that the movement of the insect is controlled.
The target gene is TPS, the gene codes for trehalose synthase (trehalose phosphate synthase, TPS), the trehalose synthase catalyzes and synthesizes trehalose from glucose ingested by insects, and the trehalose is mainly used as blood sugar in blood stranguria and is absorbed and utilized by most tissue cells, thus being a key enzyme in the growth and development process of insects.
The target gene is TPS, the gene codes for trehalose synthase (trehalose phosphate synthase, TPS), the trehalose synthase catalyzes and synthesizes trehalose from glucose ingested by insects, and the trehalose is mainly used as blood sugar in blood stranguria and is absorbed and utilized by most tissue cells, thus being a key enzyme in the growth and development process of insects.
The target gene Ssj is a membrane joint protein, codes a membrane protein related to smooth membrane joints and has the function of intestinal barrier.
The target gene is Sec23A, and the gene codes a sleeve voxel protein which is a component in a sleeve voxel protein complex COPII and mediates the substance transport of an endoplasmic reticulum to a Golgi apparatus.
The target gene is Rpb7, codes for an RNA polymerase II subunit (RNA polymerase II subunit RPB) and is one of the core components of RNA polymerase II for synthesizing mRNA precursor.
The target gene is Rpb2, and the gene codes for an RNA polymerase II subunit (RNA polymerase II subunit RPB 2) and is one of core components of RNA polymerase II for synthesizing mRNA precursor.
The target gene is Rop, the gene codes for a ROP protein, rop (Ras opposite) is a homologous protein of Sec1 family, and Sec1 family proteins such as synaptic fusion protein (syntaxinbinding proteins) are involved in regulating the docking and fusion of synaptic vesicles (vesicle), possibly related to intracellular vacuole transport.
The target gene is Ncm, and the gene codes for a pre-mRNA shearing factor (CWC 22) homolog.
The target gene is Mov34, namely 26S proteasome non-ATPase regulatory subunit 7 (26S proteasome non-ATPase regulatory subunit 7).
The target gene is Hb, and the gene is an insect gap gene (gap gene) hunchback, codes a transcription factor containing a zinc finger structure and plays an important role in the axial mode (development) of insects.
The target gene is Dre4, the gene codes for a FACT complex subunit spt16 (facilitates chromatin transcription complex subunit spt), FACT is a hetero-dimeric protein complex and can influence eukaryotic RNA polymerase II transcriptional elongation, and the encoded protein of Dre4 is one of components of the FACT complex.
The target gene is COPI-b, the gene codes a COPI sleeve voxel subunit beta, which is a component in the sleeve protein compound COPI, and mediates the transportation of intracellular substances from the Golgi apparatus to the endoplasmic reticulum.
Compared with the prior art, the invention has the beneficial effects that:
1. the invention provides a target gene for effectively preventing and controlling double-spotted fluorescent leaf beetles, the coding sequence of the target gene in the double-spotted fluorescent leaf beetles is not reported at present, and the inhibition effect of dsRNA designed by the gene on the target gene in the double-spotted fluorescent leaf beetles is not known. Researchers in the field know that the aim of inhibiting the growth and development of target insects is achieved through an RNA interference technology, and two steps are needed: the first is to define the exact nucleotide sequence of the target gene; and secondly, designing an interference ribonucleic acid sequence according to the target gene sequence. The invention firstly discovers and discloses that the corn double-spotted fluorescent leaf beetles can be effectively prevented and controlled by downregulating target sequences of the double-spotted fluorescent leaf beetles, and the inhibition effect of the obtained nucleic acid inhibitor on target genes in larvae and adults of the double-spotted fluorescent leaf beetles is designed and verified according to the ascertained target gene sequences.
2. Specificity. The interfering ribonucleic acid sequence is developed based on a specific species (diabrotica virgifera), and dsRNA induces a silencing interference effect after being combined with corresponding complementary mRNA in insect cells, so that the interfering ribonucleic acid sequence has the characteristic of nucleic acid specificity. Under the condition that the specific target sequence is not known or the similar sequence of the kindred species is only known, the aim of preventing and controlling the invasion of the diabrotica virgica into plants cannot be achieved by the RNA interference technology used by the invention.
3. High efficiency. RNAi technology has high-efficiency insecticidal effect, can kill target pests at very low dosage, and reduces the influence on environment and non-target organisms.
4. Resistance is avoided. The invention does not depend on the combination of specific dsRNA and receptor protein in the insect body, and can effectively avoid the similar risk of Bt toxic protein resistance generated by insects.
5. The method for preventing and controlling the invasion of the double-spotted fluorescent diabrotica to plants by downregulating the expression of the target gene in the double-spotted fluorescent diabrotica can directly apply the obtained dsRNA to the field control of coleopteran pest invasion without affecting other organisms, and is convenient, low in cost and good in environmental compatibility.
6. Sustainability. RNAi technology is a biological control method that has less impact on the environment and human health and is therefore more sustainable than traditional chemical pesticides.
(IV) description of the drawings
FIG. 1, relative transcript levels of MhWupA troponin I genes after 0 days of dsRNA feeding to double-spotted fluorescent leaf beetles.
FIG. 2, relative transcript levels of MhWupA troponin I genes after 2 days of dsRNA feeding to double-spotted fluorescent leaf beetles.
FIG. 3, relative transcript levels of MhWupA troponin I genes after 4 days of dsRNA feeding to double-spotted fluorescent leaf beetles.
FIG. 4, schematic representation of recombinant expression vector RMhW1 vector of the nucleotide sequence and method for controlling insect attack of the present invention.
FIG. 5, relative transcript levels of the MhTPS gene after 4 days of dsRNA feeding by double-spotted fluorescent leaf beetles.
FIG. 6, schematic representation of recombinant expression vector RMhT1 vector of the nucleotide sequence and method for controlling insect infestation according to the invention.
FIG. 7 relative transcript levels of the MhSsj1 gene after 4 days of dsRNA feeding of P.bifidus.
FIG. 8, schematic representation of recombinant expression vector RMhSj1 vector of the nucleotide sequence and method for controlling insect infestation according to the invention.
FIG. 9, relative transcript levels of the MhSec23A gene after 4 days of dsRNA feeding to double-spotted fluorescent leaf beetles.
FIG. 10, schematic representation of recombinant expression vector RMhS1 vector of the nucleotide sequence and method for controlling insect infestation according to the invention.
FIG. 11, relative transcript levels of the MhRfb 7 gene after 4 days of dsRNA feeding by double-spotted fluorescent leaf beetles.
FIG. 12, schematic representation of a recombinant expression vector RMhRp71 vector of the nucleotide sequence and method for controlling insect infestation according to the invention.
FIG. 13, relative transcript levels of the MhRfb 2 gene after 4 days of dsRNA feeding by double-spotted fluorescent leaf beetles.
FIG. 14, schematic representation of recombinant expression vector RMhRP1 vector of the nucleotide sequence and method for controlling insect infestation according to the invention.
FIG. 15, relative transcript levels of the MhRop gene after 4 days of dsRNA feeding to double-spotted fluorescent leaf beetles.
FIG. 16, schematic representation of recombinant expression vector RMhRop1 vector of the nucleotide sequences and methods of the invention for controlling insect infestation.
FIG. 17 relative transcript levels of the MhNcm gene after 4 days of dsRNA feeding to double-spotted fluorescent leaf beetles.
FIG. 18, schematic representation of recombinant expression vector RMhN1 vector of the nucleotide sequence and method for controlling insect infestation according to the invention.
FIG. 19 relative transcript levels of the MhMov34 gene after 4 days of dsRNA feeding to double-spotted fluorescent leaf beetles.
FIG. 20, schematic representation of recombinant expression vector RMhM1 vector of the nucleotide sequences and methods of the invention for controlling insect infestation.
FIG. 21, relative transcript levels of the MhHb gene after 4 days of dsRNA feeding by double-spotted fluorescent leaf beetles.
FIG. 22, schematic representation of recombinant expression vector RMhH1 vector of the nucleotide sequence and method for controlling insect infestation according to the invention.
FIG. 23, relative transcript levels of the MhDre4 gene after 4 days of dsRNA feeding of double-spotted fluorescent leaf beetles.
FIG. 24, schematic representation of recombinant expression vector RMhD1 vector of the nucleotide sequences and methods of the invention for controlling insect infestation.
FIG. 25, relative transcript levels of the MhCOPI-b gene after 4 days of dsRNA feeding to double-spotted fluorescent leaf beetles.
FIG. 26, schematic representation of recombinant expression vector RMhC1 vector of the nucleotide sequences and methods for controlling insect infestation of the invention.
(fifth) detailed description of the invention
The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:
both molecular biology and biochemical methods used in the following examples of the invention are known techniques. Current Protocols in Molecular Biology published in Ausubel, john Wiley and Sons, inc., and Molecular Cloning: A Laboratory Manual,3 published in J.Sambrook et al, cold Spring Harbor Laboratory Press (2001) rd ED., etc. are described in detail.
Example 1 determination of target genes and target nucleotide sequences of double-spotted fluorescent leaf beetles
1. Extracting total RNA. Taking 10 pieces of adult double-spotted beetles, and extracting total RNA of the double-spotted beetles by adopting a TRIzol method.
2. The total RNA was reverse transcribed. Kit for reverse transcriptionIII 1st Strand cDNA Synthesis Kit (+gDNA wind) (cat. No. R312-01,Version 22.1,Nanjing Vazyme Biotech Co, ltd.) and reverse transcription to give cDNA, the reverse transcription protocol is: preparing a mixed solution in an RNase-free centrifuge tube, adding 1 mug of total RNA, adding RNase-free Water to 8 mug, heating at 65 ℃ for 5min, rapidly quenching on ice, and standing on ice for 2min; adding 5 XgDNA wind Mix 2 mu L into the mixed solution in the last step, lightly blowing and mixing by a liquid transfer device, and keeping the temperature at 42 ℃ for 2min; to the reaction solution of the previous step, 10 XRT Mix 2. Mu.L, hiScript III Enzyme Mix. Mu.L, oligo (dT) was added 20 VN 1μL，RNase-free ddH 2 O5. Mu.L, gently blow and mix with a pipette. The reaction conditions were 25℃for 5min,37℃for 45min and 85℃for 5sec.
3. Determination of target genes and selection of target sequences.
(1) Target gene MhWupA troponin I
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) of the kindred species and the sequence of homologous gene DvWupA troponin I (Genbank Accession NO: MH 001576) of the Western corn rootworm, the following primers MhWupA troponin I-F/R are designed, and a conventional PCR amplification reaction is carried out by taking cDNA of the double-spotted fluorescent leaf beetle as a template to obtain a target gene (marked as MhWupA troponin I, namely troponin I) of the double-spotted fluorescent leaf beetle, the full-length nucleotide sequence of which is shown as SEQ ID NO:1, and the amino acid sequence of which is shown as SEQ ID NO: 2. The target gene is one of the components of the insect troponin-tropomyosin complex, and insects inhibit the contraction and the relaxation of muscles through the protein, so as to control the movement of the insects.
MhWupA troponin I-F：GTCAATCACTTATTTGAGGACGAAC；
MhWupA troponin I-R:TCACATTTTTTAATAAGTTATACATAAACAAATAAT。
Selecting a target sequence: four target sequences were randomly selected at any position of target gene MhWupA troponin I as shown in table 1.
Sequence information of Table 1, 4 target sequences
Target sequences Sequence number
MhWupA troponin I-1 SEQ ID NO:3
MhWupA troponin I-2 SEQ ID NO:4
MhWupA troponin I-3 SEQ ID NO:5
MhWupA troponin I-4 SEQ ID NO:6
(2) Target gene MhTPS
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) of the kindred species and the sequence of the homologous gene DvTPS (Genbank Accession NO: XM_ 028271954) of the Western corn rootworm, the following primers MhTPS-F/R are designed, and conventional PCR amplification reaction is carried out by taking cDNA of the double-spotted fluorescent leaf beetle as a template to obtain a target gene (denoted as MhTPS) of the double-spotted fluorescent leaf beetle, wherein the full-length nucleotide sequence is shown as SEQ ID NO. 10, and the amino acid sequence is shown as SEQ ID NO. 11. The target gene codes a trehalose synthase (trehalose phosphate synthase, TPS), which catalyzes and synthesizes trehalose from glucose ingested by insects, and the trehalose synthase is a key enzyme in the growth and development process of insects, and is absorbed and utilized by most tissue cells when being used as main blood sugar in blood stranguria.
MhTPS-F：CGTTACTTTAATTTATTTGCTATTAATAAAATC；
MhTPS-R:TTTAACAATATGCAAAATTTTAATTTATGAAAC。
Selecting a target sequence:
five target sequences were randomly selected at any position of the target gene MhTPS as shown in table 2.
Sequence information of Table 2, 5 target sequences
Target sequences Sequence number
MhTPS-1 SEQ ID NO:12
MhTPS-2 SEQ ID NO:13
MhTPS-3 SEQ ID NO:14
MhTPS-4 SEQ ID NO:15
MhTPS-5 SEQ ID NO:16
(3) Target gene MhSsj1
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) and the sequence of homologous gene DvSsj1 (Genbank Accession NO: KU 562965) of the Western corn rootworm, the following primers MhSsj1-F/R are designed, and conventional PCR amplification reaction is carried out by taking cDNA of the double-leaf fluorescent leaf beetle as a template to obtain a target gene (designated as MhSsj 1) of the double-leaf fluorescent leaf beetle, wherein the full-length nucleotide sequence is shown as SEQ ID NO:20, and the amino acid sequence is shown as SEQ ID NO: 21. The target gene of the invention is a membrane joint protein, codes a membrane protein related to smooth membrane joints, and has the function of intestinal barrier.
MhSsj1-F：AGAAAATATTGTACAATTTTTATTGGAGAAC；
MhSsj1-R:TTTTTAACTACTGATGTAGGTATATTTATTTAC。
Selecting a target sequence: randomly selecting 2 target sequences at any position of the target gene MhSsj1, as shown in Table 3.
TABLE 3 sequence information of 2 target sequences
Target sequences Sequence number
MhSsj1-1 SEQ ID NO:22
MhSsj1-2 SEQ ID NO:23
(4) Target gene MhSec23A
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) and the sequence of homologous gene DvSec23A (Genbank AccessionNO: MK 474471) of the Western corn rootworm, the following primers MhSec23A-F/R are designed, and conventional PCR amplification reaction is carried out by taking cDNA of double-spotted fluorescent leaf beetle as a template to obtain the target gene (denoted as MhSec23A, namely set voxel) of the double-spotted fluorescent leaf beetle, the full-length nucleotide sequence of which is shown as SEQ ID NO:27, and the amino acid sequence of which is shown as SEQ ID NO: 28. The target gene codes a set voxel protein, which is a component in a set voxel protein complex COPII, and mediates the substance transport of an endoplasmic reticulum to a Golgi apparatus.
MhSec23A-F：TTTCTTATTTCCTCTATGCAAATTATTG；
MhSec23A-R:GATTTACTTAAATGTTTTATTTGTAATATA。
Selecting a target sequence: five target sequences were randomly selected at any position of the target gene MhSec23A, as shown in table 4.
Sequence information of Table 4, 5 target sequences
(5) Target gene MhRfb 7
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) and the sequence of homologous gene DvRpb7 (Genbank Accession NO: XM_ 028299763) of the Western corn rootworm, the following primers MhRpb7-F/R are designed, and conventional PCR amplification reaction is carried out by taking cDNA of the double-spotted fluorescent leaf beetle as a template, so as to obtain the target gene (denoted as MhRpb 7) of the double-spotted fluorescent leaf beetle, the full-length nucleotide sequence of which is shown as SEQ ID NO:37, and the amino acid sequence of which is shown as SEQ ID NO: 38. The target gene codes for an RNA polymerase II subunit (RNA polymerase II subunit RPB) and is one of core components for synthesizing mRNA precursor by RNA polymerase II.
MhRpb7-F：AGAAAACTTACTGAAAGAACAAAAATTTGG；
MhRpb7-R:GTAAAGTAAAAACATTTATTTATTCTGTAATCG。
Selecting a target sequence: randomly selecting 2 target sequences at any position of the target gene MhRfb 7, as shown in Table 5.
Table 5, sequence information of 2 target sequences
Target sequences Sequence number
MhRpb7-1 SEQ ID NO:39
MhRpb7-2 SEQ ID NO:40
(6) Target gene MhRfb 2
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) and the sequence of homologous gene DvRpb2 (Genbank Accession NO: XM_ 028297193) of the Western corn rootworm, the following primers MhRpb2-F/R are designed, and conventional PCR amplification reaction is carried out by taking cDNA of the double-spotted fluorescent leaf beetle as a template, so as to obtain the target gene (denoted as MhRpb 2) of the double-spotted fluorescent leaf beetle, the full-length nucleotide sequence of which is shown as SEQ ID NO:44, and the amino acid sequence of which is shown as SEQ ID NO: 45. The target gene codes for an RNA polymerase II subunit (RNA polymerase II subunit RPB 2) and is one of core components for synthesizing mRNA precursor by RNA polymerase II.
MhRpb2-F：TGTCGATGTCAAACATCCTATAAAATCTG
MhRpb2-R:TCTTTACCAATTTATTTAAAATATAAAATATTCTT
Selecting a target sequence: five target sequences were randomly selected at any position of the target gene MhRpb2 as shown in table 6.
Sequence information of Table 6, 5 target sequences
Target sequences Sequence number
MhRpb2-1 SEQ ID NO:46
MhRpb2-2 SEQ ID NO:47
MhRpb2-3 SEQ ID NO:48
MhRpb2-4 SEQ ID NO:49
MhRpb2-5 SEQ ID NO:50
(7) Target gene MhRop
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) and the sequence of homologous gene DvRop (Genbank Accession NO: XM_ 028277042) of the Western corn rootworm, the following primer MhRop-F/R is designed, and the cDNA of the double-spotted fluorescent leaf beetle is used as a template for carrying out conventional PCR amplification reaction to obtain the target gene (denoted as MhRop) of the double-spotted fluorescent leaf beetle, the full-length nucleotide sequence of which is shown as SEQ ID NO:54, and the amino acid sequence of which is shown as SEQ ID NO: 55. The target gene codes for a ROP protein, rop (Ras opposite) is a homologous protein of the Sec1 family, and Sec1 family proteins such as synaptic fusion protein (syntaxinbinding proteins) are involved in regulating the docking and fusion of synaptic vesicles (vesicle), possibly related to intracellular vacuole transport.
MhRop-F：ACTAGACACTTGGAATATTTGCGC；
MhRop-R:TAGATTTTATTATGTGCAATGTAACTTGAA。
Selecting a target sequence: five target sequences were randomly selected at any position of the target gene MhRop, as shown in table 7.
TABLE 7 sequence information of 5 target sequences
Target sequences Sequence number
MhRop-1 SEQ ID NO:56
MhRop-2 SEQ ID NO:57
MhRop-3 SEQ ID NO:58
MhRop-4 SEQ ID NO:59
MhRop-5 SEQ ID NO:60
(8) Target gene MhNcm
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) of the kindred species and the sequence of the homologous gene DvNcm (Genbank Accession NO: XM_ 028276581) of the Western corn rootworm, the following primers MhNcm-F/R are designed, and conventional PCR amplification reaction is carried out by taking cDNA of the double-spotted fluorescent leaf beetle as a template to obtain the target gene (denoted as MhNcm) of the double-spotted fluorescent leaf beetle, wherein the full-length nucleotide sequence is shown as SEQ ID NO. 64, and the amino acid sequence is shown as SEQ ID NO. 65. The target gene codes for a homologue of pre-mRNA shear factor (CWC 22).
MhNcm-F：ATAAAATGTCAAAACTTGAAACTTGGCG；
MhNcm-R:TTTTAAAAATTGTTAAAAATATTTAATAAAACGT。
Selecting a target sequence: five target sequences were randomly selected at any position of the target gene MhNcm as shown in table 8.
Sequence information of Table 8, 5 target sequences
Target sequences Sequence number
MhNcm-1 SEQ ID NO:66
MhNcm-2 SEQ ID NO:67
MhNcm-3 SEQ ID NO:68
MhNcm-4 SEQ ID NO:69
MhNcm-5 SEQ ID NO:70
(9) Target gene MhMov34
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) and the sequence of homologous gene DvMov34 (Genbank Accession NO: MH 001576) of the Western corn rootworm, the following primers MhMov34-F/R are designed, and conventional PCR amplification reaction is carried out by taking cDNA of double-spotted fluorescent leaf beetle as a template to obtain the target gene (denoted as MhMov34, namely 26S proteasome) of the double-spotted fluorescent leaf beetle, the full-length nucleotide sequence of which is shown as SEQ ID NO:74, and the amino acid sequence of which is shown as SEQ ID NO: 75. The target gene codes a 26S proteasome non-ATPase regulatory subunit 7 (26S proteasome non-ATPase regulatory subunit 7)
MhMov34-F：TTTTGAAGTGTCATCTTGTATCTTGTT；
MhMov34-R:CTTCAAACAGATTAAATTGATCTCAGC。
Selecting a target sequence: four target sequences were randomly selected at any position of the target gene MhMov34 as shown in table 1.
Sequence information of Table 9, 4 target sequences
Target sequences Sequence number
MhMov34-1 SEQ ID NO:76
MhMov34-2 SEQ ID NO:77
MhMov34-3 SEQ ID NO:78
MhMov34-4 SEQ ID NO:79
(10) Target gene MhHb
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) and the sequence of homologous gene DvHb (Genbank Accession NO: XM_ 028272853) of the Western corn rootworm, the following primers MhHb-F/R are designed, and conventional PCR amplification reaction is carried out by taking cDNA of the double-spotted fluorescent leaf beetle as a template to obtain a target gene (marked as MhHb) of the double-spotted fluorescent leaf beetle, the full-length nucleotide sequence of which is shown as SEQ ID NO:83, and the amino acid sequence of which is shown as SEQ ID NO: 84. The target gene is an insect gap gene (gap gene) hunchback, codes a transcription factor containing a zinc finger structure, and plays an important role in the axial mode (development) of insects.
MhHb-F：GTTTACCTACTTCAAACAAAACAACGC；
MhHb-R:AAATATTTAAAAAAATTACATTGCTATTAAAAAAAATTTG。
Selecting a target sequence: five target sequences were randomly selected at any position of the target gene MhHb as shown in table 10.
TABLE 10 sequence information of 5 target sequences
Target sequences Sequence number
MhHb-1 SEQ ID NO:85
MhHb-2 SEQ ID NO:86
MhHb-3 SEQ ID NO:87
MhHb-4 SEQ ID NO:88
MhHb-5 SEQ ID NO:89
(11) Target gene MhDre4
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) and the sequence of homologous gene DvDre4 (Genbank Accession NO: XM_ 028288745) of the Western corn rootworm, the following primers MhDre4-F/R are designed, and conventional PCR amplification reaction is carried out by taking cDNA of the double-spotted fluorescent leaf beetle as a template, so as to obtain the target gene (denoted as MhDre 4) of the double-spotted fluorescent leaf beetle, the full-length nucleotide sequence of which is shown as SEQ ID NO:93, and the amino acid sequence of which is shown as SEQ ID NO: 94. The target gene codes for a FACT complex subunit spt16 (facilitates chromatin transcription complex subunit spt), FACT is a hetero-dimeric protein complex and can influence eukaryotic RNA polymerase II transcriptional elongation, and the code protein of dre4 is one of components of the FACT complex.
MhDre4-F：GGTTGTTGTAATGGTGGTGGTTCTG；
MhDre4-R:TTCTTTTATTTTTATTAAAAAATATTGTTGGCCAAG。
Selecting a target sequence: five target sequences were randomly selected at any position of the target gene MhDre4 as shown in table 11.
Table 11, sequence information of 5 target sequences
Target sequences Sequence number
MhDre4-1 SEQ ID NO:95
MhDre4-2 SEQ ID NO:96
MhDre4-3 SEQ ID NO:97
MhDre4-4 SEQ ID NO:98
MhDre4-5 SEQ ID NO:99
(11) Target gene
Referring to the genome sequence (Genbank RefSeq: GCF_ 917563875.1) of the Western corn rootworm (Diabrotica virgifera virgifera) and the sequence of homologous gene DvCOPI-b (Genbank AccessionNO: XM_ 028291201) of the Western corn rootworm, the following primer MhCOPI-b-F/R is designed, and the cDNA of the double-spot fluorescent leaf beetle is used as a template to perform conventional PCR amplification reaction to obtain the target gene (denoted as MhCOPI-b) of the double-spot fluorescent leaf beetle, the full-length nucleotide sequence of which is shown as SEQ ID NO:103, and the amino acid sequence of which is shown as SEQ ID NO: 104. The target gene codes COPI sleeve voxel subunit beta, which is a component in the sleeve protein compound COPI, and mediates the transportation of intracellular substances from a golgi body to an endoplasmic reticulum.
MhCOPI-b-F：GTCATAACGTCAACAAATTGACACGT；
MhCOPI-b-R:GATATCTTTATTCAAATATAATATAACCAATAATCTG。
Selecting a target sequence: five target sequences were randomly selected at any position of the target gene MhCOPI-b, as shown in table 12.
Table 12, sequence information of 5 target sequences
Target sequences Sequence number
MhCOPI-b-1 SEQ ID NO:105
MhCOPI-b-2 SEQ ID NO:106
MhCOPI-b-3 SEQ ID NO:107
MhCOPI-b-4 SEQ ID NO:108
MhCOPI-b-5 SEQ ID NO:109
Example 2 acquisition of dsRNA of target sequence
1. Obtaining of double-spot fluorescent leaf beetle target gene MhWupA troponin I dsRNA
(1) PCR amplification was performed using the double-spotted fluorescent leaf beetle genome cDNA as a template, using the primer MhWupA troponin I-F/R of example 1, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN company Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.), plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in liquid LB medium with 50mg/L Kana resistance and sent to company (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The target gene MhWupA troponin I full-length sequence fragment with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 1.
The LB liquid culture medium comprises the following components: 10g/L peptone, 5g/L yeast extract and 10g/L sodium chloride, and sterilizing at 120deg.C under high temperature and high pressure for 15 min; the LB solid culture medium is obtained by adding 15g/L agar into LB liquid culture medium, sterilizing at high temperature under high pressure, and cooling in sterilized culture dish.
(2) The correct plasmid was confirmed by sequencing in step (1) as a template, primers WupA1-F and WupA1-R in Table 13 were used to amplify target sequences MhWupA troponin I-1 (nucleotide sequence shown as SEQ ID NO: 3), wupA2-F and WupA2-R in which nucleotide sequence shown as SEQ ID NO: 4) were used to amplify target sequences MhWupA troponin I-2, wupA3-F and WupA3-R in which nucleotide sequence shown as SEQ ID NO:5 was used, wupA4-F and WupA4-R in which nucleotide sequence shown as SEQ ID NO:6 was used to recover and purify amplified products to obtain fragments of target sequences MhWupA troponin I-1, mhWupA troponin I-2, mhWupA troponin I-3, mhWupA I-4 at the temperature of MhWupA-4, and storing them in a refrigerator for use at a temperature of 20 ℃.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in the table 13, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product was used as a template for dsRNA synthesis, double-stranded RNA was synthesized according to the instructions using reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA), the synthesis quality and the band size were detected by 2% agarose gel electrophoresis, and dsRNA products-dsMhWupA troponin I-1, dsMhWupA troponin I-2, dsMhWupA troponin I-3, dsMhWupA troponin I-4 were obtained, respectively, and stored at-80℃for use. Meanwhile, homologous genes DvTropin I (SEQ ID NO: 7) and green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhWupA troponin I in western corn rootworm were synthesized by Shanghai worker company, and double chains RNA dsDvTroponin I and dsGFP were synthesized by the method described in step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 13 primer sequence information
/>
2. Obtaining of double-spot fluorescent leaf beetle target gene MhTPS dsRNA
(1) PCR amplification was performed using the primer MhTPS-F/R of example 1 as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.), plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in liquid LB medium with 50mg/L Kana resistance and sent to Co. (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhTPS with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 10.
(2) Taking the plasmid with the correct sequence verified in the step (1) as a template, using primers TPS1-F and TPS1-R amplification target sequences MhTPS-1 (nucleotide sequence is shown as SEQ ID NO: 12) in the table 14, recovering and purifying the amplified products to obtain fragments of target sequences MhTPS-1, mhTPS-2, mhTPS-3, mhTPS-4 and MhTPS-4 (nucleotide sequence is shown as SEQ ID NO: 14), TPS5-F and TPS5-R amplification target sequences MhTPS-5 (nucleotide sequence is shown as SEQ ID NO: 15), and MhTPS-1, mhTPS-2, mhTPS-3, mhTPS-4 and MhTPS-5 in a refrigerator at the temperature of-20 ℃ for later use.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in table 14, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product is used as a template for dsRNA synthesis, a reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA) is used for synthesizing double-stranded RNA according to instructions, 2% agarose gel electrophoresis is used for detecting the synthesis quality and the band size, so that dsRNA products dsMhTPS-1, dsMhTPS-2, dsMhTPS-3, dsMhTPS-4 and dsMhTPS-5 are respectively obtained, and the obtained products are stored at the temperature of minus 80 ℃ for standby. Meanwhile, the homologous gene DvTPS (SEQ ID NO: 17) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhTPS in western corn rootworm are synthesized by Shanghai, and double-stranded RNA dsDvTPS and dsGFP are synthesized by the method described in the step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 14 primer sequence information
3. Obtaining of double-spot fluorescent leaf beetle target gene MhSsj1 dsRNA
(1) PCR amplification was performed using the primer MhSsj1-F/R of example 1 as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.), plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in 50mg/L Kana liquid LB medium and sent to company (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhSsj1 with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 20.
(2) The plasmid with correct sequencing verification in the step (1) is used as a template, primers Ssj-F and Ssj-R in the table 15 are used for amplifying a target sequence MhSsj1-1 (the nucleotide sequence is shown as SEQ ID NO: 22), ssj-F and Ssj-R are used for amplifying the target sequence MhSsj1-2 (the nucleotide sequence is shown as SEQ ID NO: 23), amplified products are recovered and purified, and fragments of the target sequences MhSsj1-1 and MhSsj1-2 are obtained and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in the table 15, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product is used as a template for dsRNA synthesis, a reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA) is used for synthesizing double-stranded RNA according to instructions, 2% agarose gel electrophoresis is used for detecting the synthesis quality and the band size, so that dsRNA products-dsMhSsj 1-1 and dsMhSsj1-2 are respectively obtained, and the dsRNA products are stored at-80 ℃ for standby. Meanwhile, the homologous gene DvSsj1 (SEQ ID NO: 24) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhSsj1 in western corn rootworm are synthesized by Shanghai, and double-stranded RNA dsDvSsj1 and dsGFP are synthesized by the method described in the step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 15 primer sequence information
4. Obtaining of double-spot fluorescent leaf A target gene MhSec23A dsRNA
(1) PCR amplification was performed using the primer MhSec23A-F/R of example 1 as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.) and plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in 50mg/L Kana liquid LB medium and sent to company (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhSec23A with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 27.
(2) The plasmids with correct sequencing verification in the step (1) are used as templates, primers Sec23A1-F and Sec23A1-R amplification target sequences MhSec23A-1 (nucleotide sequences shown as SEQ ID NO: 29), sec23A2-F and Sec23A2-R amplification target sequences MhSec23A-2 (nucleotide sequences shown as SEQ ID NO: 30), sec23A3-F and Sec23A3-R amplification target sequences MhSec23A-3 (nucleotide sequences shown as SEQ ID NO: 31), sec23A4-F and Sec23A4-R amplification target sequences MhSec23A-4 (nucleotide sequences shown as SEQ ID NO: 32), sec23A5-F and Sec23A5-R amplification target sequences MhSec23A-5 (nucleotide sequences shown as SEQ ID NO: 30) are used for recovery and purification of amplification products, and the reserve fragments of the sequences MhSec23A-1, sec23A-2, mh 23A-3, mh 23A-5, mh 2-Mh 3, and the reserve fragments of the sequences stored in the refrigerator.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in table 16, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product was used as a template for dsRNA synthesis, double-stranded RNA was synthesized according to the instructions using a reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA), and the synthesized quality and band size were detected by 2% agarose gel electrophoresis to obtain dsRNA products, dsMhSec23A-1, dsMhSec23A-2, dsMhSec23A-3, dsMhSec23A-4, and dsMhSec23A-5, respectively, and stored at-80℃for use. Meanwhile, the homologous gene DvSec23A (SEQ ID NO: 34) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhSec23A in Western corn rootworm were synthesized by Shanghai, and double-stranded RNA dsDvSec23A and dsGFP were synthesized by the method described in step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 16 primer sequence information
5. Obtaining of double-spot fluorescent leaf first target gene MhRfb 7 dsRNA
(1) PCR amplification was performed using the primer MhRpb7-F/R of example 1 as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.), plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in liquid LB medium with 50mg/L Kana resistance and sent to company (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhRfb 7 with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 37.
(2) The plasmid with correct sequence verification in the step (1) is used as a template, primers Rpb-F and Rpb-R in the table 17 are used for amplifying a target sequence MhRpb7-1 (the nucleotide sequence is shown as SEQ ID NO: 39), rpb-F and Rpb-R are used for amplifying the target sequence MhRpb7-2 (the nucleotide sequence is shown as SEQ ID NO: 40), amplified products are recovered and purified, and fragments of the target sequences MhRpb7-1 and MhRpb7-2 are obtained and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing the T7 promoter in the table 17, adding the T7 promoter sequences at the two ends of the target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product was used as a template for dsRNA synthesis, double-stranded RNA was synthesized according to the instructions using reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA), the synthesis quality and the band size were detected by 2% agarose gel electrophoresis, and dsRNA products-dsMhRfb 7-1 and dsMhRfb 7-2 were obtained, respectively, and stored at-80℃for use. Meanwhile, the homologous gene DvRpb7 (SEQ ID NO: 41) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhRpb7 in western corn rootworm were synthesized by Shanghai, and double-stranded RNA dsDvRpb7 and dsGFP were synthesized by the method described in step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 17 primer sequence information
Rpb7-1-F TTCTACCATATATCGTTGGAGCACG
Rpb7-1-R GACTTCACCTTTAAACGGTCGAAA
Rpb7-2-F GATGCAGTCGTTAGACAAGTAAACAA
Rpb7-2-R CAATCCCAAGTAATCATCCATTAATGTTC
T7-Rpb7-1-F taatacgactcactataggg TTCTACCATATATCGTTGGAGCACG
T7-Rpb7-1-R taatacgactcactataggg GACTTCACCTTTAAACGGTCGAAA
T7-Rpb7-2-F taatacgactcactataggg GATGCAGTCGTTAGACAAGTAAACAA
T7-Rpb7-2-R taatacgactcactataggg CAATCCCAAGTAATCATCCATTAATGTTC
T7-DvRpb7-F taatacgactcactataggg GTTTTACCACATATCTCTAGAACACGA
T7-DvRpb7-R taatacgactcactataggg GACTTCACCTTTGAATGGACGG
T7-GFP-F taatacgactcactatagggGTAAACGGCCACAAGTTCAGC
T7-GFP-R taatacgactcactatagggGTCCTTGAAGAAGATGGTGCGC
6. Obtaining of double-spot fluorescent leaf first target gene MhRfb 2 dsRNA
(1) PCR amplification was performed using the primer MhRpb2-F/R of example 1 as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.), plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in liquid LB medium with 50mg/L Kana resistance and sent to company (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhRfb 2 with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 44.
(2) The correct plasmid was confirmed by sequencing in step (1) as a template, primers Rpb-F and Rpb21-R amplification target sequences MhRpb2-1 (nucleotide sequence shown as SEQ ID NO: 46), rpb-F and Rpb-R amplification target sequences MhRpb2-2 (nucleotide sequence shown as SEQ ID NO: 47), rpb-F and Rpb-R amplification target sequences MhRpb2-3 (nucleotide sequence shown as SEQ ID NO: 48), rpb-24-F and Rpb-R amplification target sequences MhRpb2-4 (nucleotide sequence shown as SEQ ID NO: 49), rpb-25-F and Rpb-R amplification target sequences MhRpb2-5 (nucleotide sequence shown as SEQ ID NO: 50), and the amplified products were recovered and purified to obtain fragments of the target sequences MhRpb2-1, mhRpb2-2, mhRpb2-3, mhRpb2-4 and MhRpb2-5, and stored in a refrigerator at a temperature of 20℃for use.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in the table 18, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product was used as a template for dsRNA synthesis, double-stranded RNA was synthesized according to the instructions using a reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA), and the synthesis quality and the band size were detected by 2% agarose gel electrophoresis to obtain dsMhRpb2-1, dsMhRpb2-2, dsMhRpb2-3, dsMhRpb2-4, and dsMhRpb2-5, respectively, and stored at-80℃for use. Meanwhile, the homologous gene DvRpb2 (SEQ ID NO: 51) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhRpb2 in western corn rootworm were synthesized by Shanghai, and double-stranded RNA dsDvRpb2 and dsGFP were synthesized by the method described in step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 18 primer sequence information
Rpb21-F GAACAAGAAGATGATCAATTTGATGATG
Rpb21-R CAAATACCTAGGTGGGTTTTCAATTTCT
Rpb22-F CCAATAATGTTGAGATCAACTTATTGTCT
Rpb22-R GAGGGTTGAAGTTGGTCTCGA
Rpb23-F CCGTCATTGGATGAGGCATTTG
Rpb23-R TTCCATAGTGATCTCGATCATCTAATTCAC
Rpb24-F TGCCCTGCAGAAACTCCAGAA
Rpb24-R CATCTGACGACGAAGTTTGCGA
Rpb25-F CGTTTCGGCGAAATGGAACG
Rpb25-R TCTTGGAGCTATATTCATAGCCATCA
T7-Rpb21-F taatacgactcactataggg GAACAAGAAGATGATCAATTTGATGATG
T7-Rpb21-R taatacgactcactataggg CAAATACCTAGGTGGGTTTTCAATTTCT
T7-Rpb22-F taatacgactcactataggg CCAATAATGTTGAGATCAACTTATTGTCT
T7-Rpb22-R taatacgactcactataggg GAGGGTTGAAGTTGGTCTCGA
T7-Rpb23-F taatacgactcactataggg CCGTCATTGGATGAGGCATTTG
T7-Rpb23-R taatacgactcactataggg TTCCATAGTGATCTCGATCATCTAATTCAC
T7-Rpb24-F taatacgactcactataggg TGCCCTGCAGAAACTCCAGAA
T7-Rpb24-R taatacgactcactataggg CATCTGACGACGAAGTTTGCGA
T7-Rpb25-F taatacgactcactataggg CGTTTCGGCGAAATGGAACG
T7-Rpb25-R taatacgactcactataggg TCTTGGAGCTATATTCATAGCCATCA
T7-DvRpb2 taatacgactcactatagggCCCAGATCACAACCAGAGTCC
T7-DvRpb2 taatacgactcactatagggGCATTCAAGATAACAGAATCTTCCTG
T7-GFP-F taatacgactcactatagggGTAAACGGCCACAAGTTCAGC
T7-GFP-R taatacgactcactatagggGTCCTTGAAGAAGATGGTGCGC
7. Obtaining of double-spot fluorescent leaf A target gene MhRop dsRNA
(1) PCR amplification was performed using the primer MhRop-F/R of example 1 as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.), plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in liquid LB medium with 50mg/L Kana resistance and sent to company (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhRop with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 54.
(2) The correct plasmid was confirmed by sequencing in step (1) as a template, the primers Rop1-F and Rop1-R amplification target sequences MhRop-1 (nucleotide sequence shown as SEQ ID NO: 56), rop2-F and Rop2-R amplification target sequences MhRop-2 (nucleotide sequence shown as SEQ ID NO: 57), rop3-F and Rop3-R amplification target sequences MhRop-3 (nucleotide sequence shown as SEQ ID NO: 58), rop4-F and Rop4-R amplification target sequences MhRop-4 (nucleotide sequence shown as SEQ ID NO: 59), rop5-F and Rop5-R amplification target sequences MhRop-5 (nucleotide sequence shown as SEQ ID NO: 60) were used, and the amplified products were recovered and purified to obtain fragments of the target sequences MhRop-1, mhRop-2, mhRop-3, mhRop-4, mhRop-5, and MhRop-5, which were stored in a refrigerator at-20℃for use.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in the table 19, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product was used as a template for dsRNA synthesis, double-stranded RNA was synthesized according to the instructions using a reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA), the synthesis quality and the band size were detected by 2% agarose gel electrophoresis, and dsMhRop-1, dsMhRop-2, dsMhRop-3, dsMhRop-4, and dsMhRop-5 were obtained, respectively, and stored at-80℃for use. Meanwhile, the homologous gene DvRop (SEQ ID NO: 61) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhRop in Western corn rootworm were synthesized by Shanghai, and double-stranded RNA dsDvRop and dsGFP were synthesized by the method described in step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 19 primer sequence information
Rop1-F CTTAAAGGTCAAGTGGGCCAAA
Rop1-R TGGTGTAATCAAATATACTGCCTCCA
Rop2-F CTGTGTCACCATTCAGTAGCAA
Rop2-R CAATTCGACGTTCCTCTCCC
Rop3-F CCGGAAAAGGCGAGATCTCAG
Rop3-R CGTGAATTTCTTGAGATTCTTGGTGAC
Rop4-F GACAAACTTTGCAAAGTGGAACAAGA
Rop4-R GCCAAGCAACTGGAGATTGGC
Rop5-F GGTCGAGCACAATCTACGGGA
Rop5-R GGCTAACGTCGCCAGATTGC
T7-Rop1-F taatacgactcactatagggCTTAAAGGTCAAGTGGGCCAAA
T7-Rop1-R taatacgactcactatagggTGGTGTAATCAAATATACTGCCTCCA
T7-Rop2-F taatacgactcactataggg CTGTGTCACCATTCAGTAGCAA
T7-Rop2-R taatacgactcactatagggCAATTCGACGTTCCTCTCCC
T7-Rop3-F taatacgactcactataggg CCGGAAAAGGCGAGATCTCAG
T7-Rop3-R taatacgactcactataggg CGTGAATTTCTTGAGATTCTTGGTGAC
T7-Rop4-F taatacgactcactataggg GACAAACTTTGCAAAGTGGAACAAGA
T7-Rop4-R taatacgactcactataggg GCCAAGCAACTGGAGATTGGC
T7-Rop5-F taatacgactcactataggg GGTCGAGCACAATCTACGGGA
T7-Rop5-R taatacgactcactataggg GGCTAACGTCGCCAGATTGC
T7-DvRop taatacgactcactatagggGACTTTGAACCACCAAGACAGATG
T7-DvRop taatacgactcactatagggGTTCTGCCATTCTTTCCATGTTGG
T7-GFP-F taatacgactcactatagggGTAAACGGCCACAAGTTCAGC
T7-GFP-R taatacgactcactatagggGTCCTTGAAGAAGATGGTGCGC
8. Obtaining of double-spot fluorescent leaf beetle target gene MhNcm dsRNA
(1) PCR amplification was performed using the primer MhNcm-F/R of example 1 as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.), plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in liquid LB medium with 50mg/L Kana resistance and sent to company (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhNcm with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 64.
(2) The correct plasmid is verified by sequencing in the step (1) as a template, ncm-1 (nucleotide sequence shown as SEQ ID NO: 66) and Ncm2-F and Ncm2-R amplified target sequences MhNcm-2 (nucleotide sequence shown as SEQ ID NO: 67) are used as primers Ncm1-F and Ncm1-R amplified target sequences MhNcm-1 (nucleotide sequence shown as SEQ ID NO: 68) in the table 20, ncm4-F and Ncm4-R amplified target sequences MhNcm-4 (nucleotide sequence shown as SEQ ID NO: 69), and Ncm5-F and Ncm5-R amplified target sequences MhNcm-5 (nucleotide sequence shown as SEQ ID NO: 70) are recovered and purified to obtain fragments of the target sequences MhNcm-1, mhNcm-2, mhNcm-3, mhNcm-4 and MhNcm-5, and stored in a refrigerator at a temperature of-20 ℃ for later use.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in the table 20, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product was used as a template for dsRNA synthesis, double-stranded RNA was synthesized according to instructions using a reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA), and the synthesized quality and band size were detected by 2% agarose gel electrophoresis to obtain dsMhNcm-1, dsMhNcm-2, dsMhNcm-3, dsMhNcm-4, and dsMhNcm-5, respectively, and stored at-80℃for use. Meanwhile, the homologous gene DvNcm (SEQ ID NO: 71) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhNcm in western corn rootworm were synthesized from Shanghai, and double-stranded RNA dsDvNcm and dsGFP were synthesized by the method described in step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 20 primer sequence information
9. Obtaining of double-spot fluorescent leaf first target gene MhMov34 dsRNA
(1) PCR amplification was performed using the primers of example 1MhMov34-F/R using the double-spot fluorescent leaf beetle genome cDNA as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.) and plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in 50mg/L Kana liquid LB medium and sent to company (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhMov34 with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 74.
(2) Taking plasmids with correct sequencing verification in the step (1) as templates, using primers Mov341-F and Mov341-R in Table 21 to amplify target sequences MhMov34-1 (nucleotide sequences are shown as SEQ ID NO: 76), mov342-F and Mov342-R amplifying target sequences MhMov34-2 (nucleotide sequences are shown as SEQ ID NO: 77), mov343-F and Mov343-R amplifying target sequences MhMov34-3 (nucleotide sequences are shown as SEQ ID NO: 78), and Mov344-F and Mov344-R amplifying target sequences MhMov34-4 (nucleotide sequences are shown as SEQ ID NO: 79), recovering and purifying amplified products to obtain fragments of the target sequences MhMov34-1, mhMov34-2, mhMov34-3 and MhMov34-4, and storing the fragments in a refrigerator at a temperature of minus 20 ℃ for later use.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in the table 21, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product was used as a template for dsRNA synthesis, double-stranded RNA was synthesized according to the instructions using reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA), and the synthesized quality and band size were detected by 2% agarose gel electrophoresis to obtain dsRNA products, dsMhMov34-1, dsMhMov34-2, dsMhMov34-3, and dsMhMov34-4, respectively, and stored at-80℃for use. Meanwhile, the homologous gene DvMov34 (SEQ ID NO: 80) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhMov34 in western corn rootworm were synthesized by Shanghai, and double-stranded RNA dsDvMov34 and dsGFP were synthesized by the method described in step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 21 primer sequence information
Mov341-F AGCCAAGAAGTAACCACTACTAAAG
Mov341-R GAACATACCATACATATTTTCCAAATAATC
Mov342-F GGTTGGTATCATACTGGTCCCA
Mov342-R GTGTTCGACTCCAACTTCCTCT
Mov343-F AGAGATATTAAAGACACAACAGTAGGAAC
Mov343-R CATTTGATCATTATTTTTTACATAGAATGA
Mov344-F GCCGGATATAAACCAAGATGCTT
Mov344-R CTTCTTTATCTTTTTCTTTCTCTTTCTCC
T7-Mov341-F taatacgactcactataggg AGCCAAGAAGTAACCACTACTAAAG
T7-Mov341-R taatacgactcactataggg GAACATACCATACATATTTTCCAAATAATC
T7-Mov342-F taatacgactcactataggg GGTTGGTATCATACTGGTCCCA
T7-Mov342-R taatacgactcactataggg GTGTTCGACTCCAACTTCCTCT
T7-Mov343-F taatacgactcactataggg AGAGATATTAAAGACACAACAGTAGGAAC
T7-Mov343-R taatacgactcactataggg CATTTGATCATTATTTTTTACATAGAATGA
T7-Mov344-F taatacgactcactataggg GCCGGATATAAACCAAGATGCTT
T7-Mov344-R taatacgactcactataggg CTTCTTTATCTTTTTCTTTCTCTTTCTCC
T7-DvMov34-F taatacgactcactataggg GCCATTAATGAGTTAATCAGAAGGTA
T7-DvMov34-R taatacgactcactataggg CTGTGACAAAGTACCAACAGTTG
T7-GFP-F taatacgactcactatagggGTAAACGGCCACAAGTTCAGC
T7-GFP-R taatacgactcactatagggGTCCTTGAAGAAGATGGTGCGC
10. Obtaining of double-spot fluorescent leaf first target gene MhHb dsRNA
(1) PCR amplification was performed using the primer MhHb-F/R of example 1 as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.), plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in liquid LB medium with 50mg/L Kana resistance and sent to Co. (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhHb with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 83.
(2) The plasmid with correct sequence in step (1) is used as template, the primers Hb1-F and Hb1-R amplification target sequence MhHb-1 (nucleotide sequence shown as SEQ ID NO: 85), hb2-F and Hb2-R amplification target sequence MhHb-2 (nucleotide sequence shown as SEQ ID NO: 86), hb3-F and Hb3-R amplification target sequence MhHb-3 (nucleotide sequence shown as SEQ ID NO: 87), hb4-F and Hb4-R amplification target sequence MhHb-4 (nucleotide sequence shown as SEQ ID NO: 88), hb5-F and Hb5-R amplification target sequence MhHb-5 (nucleotide sequence shown as SEQ ID NO: 89) are used, and the amplified products are recovered and purified to obtain fragments of the target sequences MhHb-1, mhHb-2, mhHb-3, mhHb-4 and MhHb-5, and are stored in a refrigerator at-20 ℃ for standby.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in the table 22, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product was used as a template for dsRNA synthesis, double-stranded RNA was synthesized according to the instructions using a reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA), and the synthesized quality and band size were detected by 2% agarose gel electrophoresis to obtain dsRNA products dsMhHb-1, dsMhHb-2, dsMhHb-3, dsMhHb-4, and dsMhHb-5, respectively, and stored at-80℃for use. Meanwhile, the homologous gene DvHb (SEQ ID NO: 90) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhHb in Western corn rootworm were synthesized by the Shanghai Biotechnology company, and double-stranded RNA dsDvHb and dsGFP were synthesized by the method described in step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 22 primer sequence information
11. Obtaining of double-spot fluorescent leaf beetle target gene MhDre4 dsRNA
(1) PCR amplification was performed using the primer MhDre4-F/R of example 1 as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.), plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in liquid LB medium with 50mg/L Kana resistance and sent to company (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhDre4 with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 93.
(2) The plasmids with correct sequence verification in the step (1) are used as templates, primers Dre41-F and Dre41-R in the table 23 are used for amplifying target sequences MhDre4-1 (the nucleotide sequences are shown as SEQ ID NO: 95), dre42-F and Dre42-R are used for amplifying target sequences MhDre4-2 (the nucleotide sequences are shown as SEQ ID NO: 96), dre43-F and Dre43-R are used for amplifying target sequences MhDre4-3 (the nucleotide sequences are shown as SEQ ID NO: 97), dre44-F and Dre44-R are used for amplifying target sequences MhDre4-4 (the nucleotide sequences are shown as SEQ ID NO: 98), and Dre45-F and Dre45-R are used for recovering and purifying the amplified products to obtain fragments of the target sequences MhDre4-1, mhDre4-2, mhDre4-3, mhDre4-5, and MhDre 4-20 ℃ which are stored in a refrigerator for standby.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in the table 23, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product was used as a template for dsRNA synthesis, double-stranded RNA was synthesized according to instructions using a reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA), and the synthesized quality and band size were detected by 2% agarose gel electrophoresis to obtain dsMhDre4-1, dsMhDre4-2, dsMhDre4-3, dsMhDre4-4, and dsMhDre4-5, respectively, and stored at-80℃for use. Meanwhile, the homologous gene DvDre4 (SEQ ID NO: 100) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhDre4 in western corn rootworm were synthesized by Shanghai, and double-stranded RNA dsDvDre4 and dsGFP were synthesized by the method described in step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 23 primer sequence information
12. Obtaining of double-spot fluorescent leaf beetle target gene MhCOPI-b dsRNA
(1) PCR amplification was performed using the primer MhCOPI-b-F/R of example 1 as a template, the amplified product was recovered and purified using the FastPure Gel DNA kit (Nanjing Vazyme Biotech Co., ltd.) and the recovered product was ligated to pLB Vector using TIANGEN Lethal Based Fast Cloning Kit, transferred to TG1 competent cells (Angyu Biotech Co., ltd.) and plated on LB solid screening medium with 50mg/L kanamycin (Kana) resistance, and positive single colonies were picked up in 50mg/L Kana liquid LB medium and sent to company (Zhejiang Sunya Biotech Co., ltd.) for sequencing. The full-length sequence fragment of the target gene MhCOPI-b with correct sequencing is obtained, and the nucleotide sequence is shown as SEQ ID NO. 103.
(2) The plasmids with correct sequencing verification in the step (1) are used as templates, primers COPI-b1-F and COPI-b1-R amplification target sequences MhCOPI-b-1 (nucleotide sequence shown as SEQ ID NO: 105), COPI-b2-F and COPI-b2-R amplification target sequences MhCOPI-b-2 (nucleotide sequence shown as SEQ ID NO: 106), COPI-b3-F and COPI-b3-R amplification target sequences MhCOPI-b-3 (nucleotide sequence shown as SEQ ID NO: 107), COPI-b4-F and COPI-b4-R amplification target sequences MhCOPI-b-4 (nucleotide sequence shown as SEQ ID NO: 108), and COPI-b5-F and COPI-b5-R amplification target sequences MhCOPO-b-5 (nucleotide sequence shown as SEQ ID NO: 109) are used for recovery and purification of the amplification products to obtain the sequences MhCOPI-b-1, mhCOPI-b-2, mhCOPI-b-4-b-5, mhCOPI-b-5, and MhCOPI-b-20-b-4, and the fragments stored in a refrigerator.
(3) And (3) taking the recovered product in the step (2) as a template, respectively carrying out PCR amplification by using forward and reverse primers containing a T7 promoter in the table 24, adding T7 promoter sequences at two ends of a target sequence fragment, and recovering and purifying the amplified product. Then, the amplified product was used as a template for dsRNA synthesis, double-stranded RNA was synthesized according to instructions using a reverse transcription kit MEGAscript T7 transcription kit (Ambion, austin, TX, USA), the synthesis quality and the band size were detected by 2% agarose gel electrophoresis, and dsMhCOPI-b-1, dsMhCOPI-b-2, dsMhCOPI-b-3, dsMhCOPI-b-4, and dsMhCOPI-b-5 were obtained, respectively, and stored at-80℃for use. Meanwhile, the homologous gene DvCOPI-b (SEQ ID NO: 110) and the green fluorescent protein gene (GFP, SEQ ID NO: 121) of MhCOPI-b in Western corn rootworm were synthesized by Shanghai, and double-stranded RNA dsDvCOPI-b and dsGFP were synthesized by the method described in step (3). The concentration of the dsRNA was measured with a NanoDrop 2000 (Thermo Scientific), and stored in a refrigerator at-80℃for use.
TABLE 24 primer sequence information
Example 3 double-plaque diabrotica dsRNA injection experiments
dsRNA injection of diabrotica adults: a groove suitable for lying of double-spotted fluorescent leaf beetles is made of 2% agarose and CO 2 The anesthetized double-spot fluorescent leaf beetles are horizontally placed in the grooves upwards for standby application; drawing the glass capillary to a proper size by a capillary needle drawing instrument (P-97,Sutter Instrument);10. Mu.L of the dsRNA prepared in example 2 was pipetted into a capillary at a concentration of 100 ng/. Mu.L and injected into the diabrotica leaf beetle. After injection, the cultures were kept in a climatic chamber at a temperature of 25 ℃ (+ -0.5 ℃), a photoperiod of 14:10h (L: D) and a relative humidity of 80% (+ -2%). Mortality of adult diabrotica was counted after 7 days.
1. Target gene MhWupA troponin I
dsRNA of homologous gene DvTropin I in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. The dsRNA injection results show (Table 25) that the dsRNA of the target sequences MhWupA troponin I-1 to MhWupA troponin I-4 of the target gene MhWupA troponin I has obvious lethal effect on double-spotted fluorescent leaf beetles, and the mortality rate is more than 80%. The dsRNA injection of DvTropin I has no obvious lethal effect on the double-spotted fluorescent leaf beetles, which indicates that dsRNA taking similar sequences of related species as targets cannot control the double-spotted fluorescent leaf beetles.
TABLE 25 statistical mortality following dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 10
2 DvTroponin I 15
3 MhWupA troponin I-1 100
4 MhWupA troponin I-2 98
5 MhWupA troponin I-3 100
6 MhWupA troponin I-4 100
2. Target gene MhTPS
dsRNA of homologous gene DvTPS in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. The dsRNA injection results show (Table 26) that the dsRNA of the target sequences MhTPS-1 to MhTPS-5 of the target genes MhTPS has obvious lethal effect on double-spotted fluorescent leaf beetles, and the mortality rate is more than 80%. The dsRNA injection of DvTPS has no obvious lethal effect on the double-spotted fluorescent leaf beetles, which indicates that dsRNA taking similar sequences of related species as targets cannot control the double-spotted fluorescent leaf beetles.
TABLE 26 statistical mortality after dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 15
2 DvTPS 20
3 MhTPS-1 97
4 MhTPS-2 96
5 MhTPS-3 100
6 MhTPS-4 98
7 MhTPS-5 100
3. Target gene MhSsj1
dsRNA of homologous gene DvSsj I in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. The dsRNA injection results show (Table 27) that the dsRNA of the target sequences MhSsj1-1 and MhSsj1-2 of the target genes MhSsj1 has obvious lethal effect on the diabrotica that the death rate is more than 80 percent. dsRNA injection of DvSsj1 has no obvious lethal effect on double-spotted fluorescent leaf beetles, which indicates that dsRNA targeting similar sequences of closely related species cannot control double-spotted fluorescent leaf beetles.
TABLE 27 statistical mortality after dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 10
2 DvSsj1 16
3 MhSsj1-1 100
4 MhSsj1-2 100
4. Target gene MhSec23A
dsRNA of homologous gene DvSec23A in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. The dsRNA injection results show (Table 28) that the dsRNA of the target sequences MhSec23A-1 to MhSec23A-5 of the target genes MhSec23A has obvious lethal effect on the double-spotted fluorescent leaf beetles, and the mortality rate is more than 80%. dsRNA injection of DvSec23A did not have obvious lethal effect on double-spotted fluorescent leaf beetles, indicating that dsRNA targeting similar sequences of closely related species could not control double-spotted fluorescent leaf beetles.
TABLE 28 statistical mortality after dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 12
2 DvSec23A 18
3 MhSec23A-1 100
4 MhSec23A-2 100
5 MhSec23A-3 95
6 MhSec23A-4 96
7 MhSec23A-5 100
5. Target gene MhRfb 7
dsRNA of homologous gene DvRpb7 in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. The dsRNA injection results show (Table 3) that the dsRNA of the target sequences MhRfb 7-1 and MhRfb 7-2 of the target genes MhRfb 7 has obvious lethal effect on the double-spot fluorescent leaf beetles, and the mortality rate is more than 80 percent. The dsRNA injection of DvRpb7 has no obvious lethal effect on the double-spotted fluorescent leaf beetles, which indicates that dsRNA targeting similar sequences of closely related species cannot control the double-spotted fluorescent leaf beetles.
TABLE 29 statistical mortality after dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 14
2 DvRpb7 19
3 MhRpb7-1 95
4 MhRpb7-2 100
6. Target gene MhRfb 2
dsRNA of homologous gene DvRpb2 in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. The dsRNA injection results show (Table 30) that dsRNA of the target sequences MhRfb 2-1 to MhRfb 2-5 of the target genes MhRfb 2 has obvious lethal effect on the double-spotted fluorescent leaf beetles, and the mortality rate is more than 80%. The dsRNA injection of DvRpb2 has no obvious lethal effect on double-spotted fluorescent leaf beetles, which indicates that dsRNA targeting similar sequences of closely related species cannot control double-spotted fluorescent leaf beetles.
TABLE 30 statistical mortality after dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 13
2 DvRpb2 20
3 MhRpb2-1 98
4 MhRpb2-2 100
5 MhRpb2-3 94
6 MhRpb2-4 96
7 MhRpb2-5 95
7. Target gene MhRop
dsRNA of homologous gene DvRop in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. The dsRNA injection results show (Table 31) that the dsRNA of the target sequences MhRop-1 to MhRop-5 of the target genes MhRop has obvious lethal effect on the double-spotted fluorescent leaf beetles, and the mortality rate is more than 80%. The dsRNA injection of DvRop has no obvious lethal effect on the double-spotted fluorescent leaf beetles, which shows that dsRNA taking similar sequences of related species as targets cannot control the double-spotted fluorescent leaf beetles.
TABLE 31 statistical mortality after dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 10
2 DvRop 16
3 MhRop-1 98
4 MhRop-2 98
5 MhRop-3 93
6 MhRop-4 100
7 MhRop-5 100
8. Target gene MhNcm
dsRNA of homologous gene DvNcm in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. The dsRNA injection results show (Table 32) that the dsRNA of the target sequences MhNcm-1 to MhNcm-5 of the target genes have obvious lethal effect on the double-spotted fluorescent leaf beetles, and the mortality rate is more than 80%. DvNcm's dsRNA injection did not have obvious lethal effect on double-spotted fluorescent diabrotica, indicating that dsRNA targeting similar sequences of closely related species could not control double-spotted fluorescent diabrotica.
TABLE 32 statistical mortality after dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 15
2 DvNcm 20
3 MhNcm-1 100
4 MhNcm-2 100
5 MhNcm-3 100
6 MhNcm-4 95
7 MhNcm-5 100
9. Target gene MhMov34
dsRNA of homologous gene DvMov34 in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. The injection result of dsRNA shows (Table 33) that dsRNA of the target sequences MhMov34-1 to MhMov34-4 of the target genes MhMov34 has obvious lethal effect on double-spotted fluorescent leaf beetles, and the mortality rate is more than 80%. The dsRNA injection of DvMov34 has no obvious lethal effect on the double-spotted fluorescent leaf beetles, which indicates that dsRNA targeting similar sequences of closely related species cannot control the double-spotted fluorescent leaf beetles.
TABLE 33 statistical mortality after dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 9
2 DvMov34 15
3 MhMov34-1 98
4 MhMov34-2 95
5 MhMov34-3 100
6 MhMov34-4 100
10. Target gene MhHb
dsRNA of homologous gene DvHb in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. After injection, the cultures were kept in a climatic chamber at a temperature of 25 ℃ (+ -0.5 ℃), a photoperiod of 14:10h (L: D) and a relative humidity of 80% (+ -2%). After 7 days, the death rate of the adult double-spotted fluorescent beetles is counted, and dsRNA injection results show (Table 34) that dsRNA of target sequences MhHb-1 to MhHb-5 of target genes MhHb has obvious lethal effect on the double-spotted fluorescent beetles, and the death rate is more than 80%. dsRNA injection of DvHb has no obvious lethal effect on double-spotted fluorescent diabrotica, which indicates that dsRNA targeting similar sequences of closely related species cannot control double-spotted fluorescent diabrotica.
TABLE 34 mortality statistics following dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 10
2 DvHb 14
3 MhHb-1 100
4 MhHb-2 96
5 MhHb-3 100
6 MhHb-4 94
7 MhHb-5 95
11. Target gene MhDre4
dsRNA of homologous gene DvDre4 in western corn rootworm (western corn rootworm) is used as a control, and dsRNA of Green Fluorescent Protein (GFP) is used as a negative control. The dsRNA injection results show (Table 35) that the dsRNA of the target sequences MhDre4-1 to MhDre4-5 of the target genes MhDre4 has obvious lethal effect on the double-spotted fluorescent leaf beetles, and the mortality rate is more than 80 percent. The dsRNA injection of DvDre4 has no obvious lethal effect on the double-spotted fluorescent leaf beetles, which indicates that dsRNA targeting similar sequences of closely related species cannot control the double-spotted fluorescent leaf beetles.
TABLE 35 statistical mortality after dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 13
2 DvDre4 20
3 MhDre4-1 95
4 MhDre4-2 96
5 MhDre4-3 90
6 MhDre4-4 96
7 MhDre4-5 90
12. Target gene MhCOPI-b
The dsRNA injection results show (Table 36) that the dsRNA of the target sequences MhCOPI-b-1 to MhCOPI-b-5 of the target genes MhCOPI-b has obvious lethal effect on the double-spotted fluorescent leaf beetles, and the mortality rate is more than 80 percent. The dsRNA injection of DvCOPI-b has no obvious lethal effect on the double-spotted fluorescent leaf beetles, which shows that dsRNA taking similar sequences of related species as targets cannot control the double-spotted fluorescent leaf beetles.
TABLE 36 mortality statistics following dsRNA injection of target sequence into adult double-spotted fluorescent beetles
Sequence number Gene name Double spot fluorescent leaf beetle mortality (%)
1 GFP 15
2 DvCOPI-b 20
3 MhCOPI-b-1 95
4 MhCOPI-b-2 100
5 MhCOPI-b-3 100
6 MhCOPI-b-4 96
7 MhCOPI-b-5 100
Example 4 feeding experiments with double-spotted fluorescent diabrotica dsRNA
The dsRNA obtained in example 2 was added to artificial feed at a rate of 50ng/g feed, and the dsRNA of Green Fluorescent Protein (GFP) was used as a negative control, and the other conditions were completely identical. The artificial feed formulation for feeding ophraella bifidus was modified according to the method published by Man p.huynh et al (Scientific Reports,2019, 9:16009), the operation steps being: 15.8g of agar powder (A7002, sigma-Aldrich) was added to 900ml of sterile water and boiled for 1 minute with periodic stirring or until the agar was completely melted. The agar solution was then transferred to a stirrer. When the agar solution was cooled to 65 ℃, 4.0g of egg powder (Jiangsu Baixin Biotech Co., ltd.), 1.0g of glucose (cat No. 15023021,Fisher Scientific Co.), 6.0g of wheat germ (cat No. 1661, bio-Serv Co.), 1.0g of cellulose (cat No. 3425, bio-Serv Co.), 6mg of cholesterol (cat No. C8503, sigma-Aldrich Co.), 0.93g of a salting agent (cat No. F8680, bio-Serv Co.), 0.9g of a vitamin mixture (cat No. V1007, sigma-Aldrich Co.), 0.1g of p-hydroxybenzoic acid (cat No. H5501, sigma-Aldrich Co.), 64mg of sorbic acid (cat No. S1626, sigma-Aldrich Co.), 6.4mg of streptomycin (cat No. 15140122,Thermo Fisher Scientific), 6.4mg of tetracycline (cat No. T1291, gentild Co.), were thoroughly mixed in a stirrer at low speed. The components of Bio-Serv can be all
https:// interpositioning.com/product-category/set-ingparameters/find. The pH was adjusted to 9.0 by adding 0.1g/mL of aqueous KOH (product No. R21230, fisher Scientific) to a volume of 1L. Next, the feed solution was immediately dispensed into 96-well plates using a pipette (200. Mu.L/well) or an appropriate container, the excess water was evaporated in a biological tank at 65℃for 10 minutes, and the prepared feed was stored in a refrigerator at 4℃and used for one week.
Culturing the first hatched larva of double-spotted fluorescent leaf beetles by using the prepared feed, putting 10 first hatched larva of double-spotted fluorescent leaf beetles into each dish, replacing the feed containing dsRNA every 48 hours, counting the death rate of insects every two days from the beginning of feeding, and repeating 5 times for each treatment.
1. Target gene MhWupA troponin I
The dsRNA feeding results showed (Table 37) that dsRNA of the target sequences MhWupA troponin I-1 to MhWupA troponin I-4 of the target gene MhWupA troponin I had obvious lethal effect on double-spotted fluorescent leaf beetles, and most of the insects had died on day 12 of feeding.
TABLE 37 survival rate experiment results of dsRNA fed double-spotted fluorescent leaf beetles
2. Target gene MhTPS
The dsRNA feeding results show (Table 38) that dsRNA of the target sequences MhTPS-1 to MhTPS-5 of the target genes have obvious lethal effect on double-spotted fluorescent leaf beetles, and most of insects die on the 12 th day of feeding.
TABLE 38 survival assay results of dsRNA fed double-spotted fluorescent leaf beetles
3. Target gene MhSsj1
The dsRNA feeding results show (Table 39) that the dsRNA of the target sequences MhSsj1-1 and MhSsj1-2 of the target genes MhSsj1 has obvious lethal effect on the diabrotica that most of the insect bodies die on the 12 th day of feeding.
TABLE 39 survival assay results of dsRNA fed double-spotted fluorescent leaf beetles
Material numbering DAY 0 DAY 2 DAY 4 DAY 6 DAY 8 DAY 10 DAY 12
dsGFP 100％ 100％ 96％ 92％ 92％ 90％ 90％
MhSsj1-1 100％ 100％ 90％ 63％ 57％ 35％ 23％
MhSsj1-2 100％ 100％ 85％ 61％ 55％ 31％ 21％
4. Target gene MhSec23A
The dsRNA feeding results show (Table 40) that dsRNA of the target sequences MhSec23A-1 to MhSec23A-5 of the target genes MhSec23A has obvious lethal effect on double-spotted fluorescent leaf beetles, and most of insects die on day 12 of feeding.
TABLE 40 survival assay results of dsRNA fed double-spotted fluorescent leaf beetles
Material numbering DAY 0 DAY 2 DAY 4 DAY 6 DAY 8 DAY 10 DAY 12
dsGFP 100％ 100％ 96％ 96％ 90％ 87％ 85％
MhSec23A-1 100％ 100％ 90％ 67％ 60％ 30％ 20％
MhSec23A-2 100％ 100％ 80％ 53％ 47％ 33％ 25％
MhSec23A-3 100％ 100％ 90％ 60％ 53％ 32％ 27％
MhSec23A-4 100％ 100％ 92％ 65％ 55％ 34％ 20％
MhSec23A-5 100％ 100％ 93％ 66％ 51％ 28％ 18％
5. Target gene MhRfb 7
The dsRNA feeding results show (Table 41) that dsRNA of the target sequences MhRfb 7-1 and MhRfb 7-2 of the target genes MhRfb 7 has obvious lethal effect on double-spotted fluorescent leaf beetles, and most of insect bodies die on the 12 th day of feeding.
TABLE 41 survival assay results of dsRNA fed double-spotted fluorescent leaf beetles
6. Target gene MhRfb 2
The dsRNA feeding results showed (table 42) that dsRNA of target sequences MhRpb2-1 to MhRpb2-5 of target gene MhRpb2 had a remarkable lethal effect on diabrotica, most of the insects had died on day 12 feeding.
TABLE 42 survival rate experiment results of dsRNA fed double-spotted fluorescent leaf beetles
Material numbering DAY 0 DAY 2 DAY 4 DAY 6 DAY 8 DAY 10 DAY 12
dsGFP 100％ 100％ 95％ 95％ 89％ 85％ 83％
MhRpb2-1 100％ 100％ 89％ 66％ 59％ 29％ 19％
MhRpb2-2 100％ 100％ 79％ 52％ 46％ 32％ 24％
MhRpb2-3 100％ 100％ 89％ 59％ 52％ 31％ 26％
MhRpb2-4 100％ 100％ 91％ 64％ 54％ 33％ 19％
MhRpb2-5 100％ 100％ 92％ 65％ 50％ 27％ 17％
7. Target gene MhRop
The dsRNA feeding results show (Table 43) that dsRNA of the target sequences MhRop-1 to MhRop-5 of the target genes MhRop has obvious lethal effect on double-spotted fluorescent diabrotica, and most of the insects die on day 12 of feeding.
Table 43 survival rate experiment results of dsRNA fed double-spotted fluorescent leaf beetles
Material numbering DAY 0 DAY 2 DAY 4 DAY 6 DAY 8 DAY 10 DAY 12
dsGFP 100％ 100％ 94％ 94％ 90％ 85％ 85％
MhRop-1 100％ 100％ 90％ 65％ 60％ 28％ 18％
MhRop-2 100％ 100％ 80％ 51％ 45％ 31％ 23％
MhRop-3 100％ 100％ 91％ 58％ 51％ 30％ 25％
MhRop-4 100％ 100％ 90％ 63％ 53％ 32％ 21％
MhRop-5 100％ 100％ 91％ 64％ 50％ 26％ 17％
8. Target gene MhNcm
The dsRNA feeding results show (Table 44) that dsRNA of the target sequences MhNcm-1 to MhNcm-5 of the target genes have obvious lethal effect on double-spotted fluorescent leaf beetles, and most of insect bodies die on the 12 th day of feeding.
TABLE 44 survival assay results of dsRNA fed double-spotted fluorescent leaf beetles
Material numbering DAY 0 DAY 2 DAY 4 DAY 6 DAY 8 DAY 10 DAY 12
dsGFP 100％ 100％ 94％ 94％ 90％ 85％ 83％
MhNcm-1 100％ 100％ 90％ 64％ 57％ 27％ 17％
MhNcm-2 100％ 100％ 80％ 50％ 44％ 30％ 22％
MhNcm-3 100％ 100％ 90％ 57％ 50％ 30％ 24％
MhNcm-4 100％ 100％ 90％ 62％ 52％ 31％ 19％
MhNcm-5 100％ 100％ 90％ 63％ 50％ 25％ 17％
9. Target gene MhMov34
The dsRNA feeding results showed (table 45) that dsRNA of the target sequences MhMov34-1 to MhMov34-4 of the target genes MhMov34 had a remarkable lethal effect on diabrotica, most of the insects had died on day 12 feeding.
Table 45 survival rate experiment results of dsRNA fed double-spotted fluorescent leaf beetles
Material numbering DAY 0 DAY 2 DAY 4 DAY 6 DAY 8 DAY 10 DAY 12
dsGFP 100％ 100％ 95％ 94％ 91％ 85％ 85％
MhMov34-1 100％ 100％ 91％ 67％ 61％ 30％ 22％
MhMov34-2 100％ 100％ 82％ 54％ 48％ 35％ 27％
MhMov34-3 100％ 100％ 90％ 60％ 51％ 34％ 21％
MhMov34-4 100％ 100％ 91％ 64％ 55％ 33％ 20％
10. Target gene MhHb
The dsRNA feeding results indicated (table 46) that dsRNA of target sequences MhHb-1 to MhHb-5 of target genes MhHb had a significant lethal effect on diabrotica, most of the worms had died on day 12 feeding.
TABLE 46 survival assay results of dsRNA fed double-spotted fluorescent leaf beetles
Material numbering DAY 0 DAY 2 DAY 4 DAY 6 DAY 8 DAY 10 DAY 12
dsGFP 100％ 100％ 98％ 94％ 90％ 90％ 87％
MhHb-1 100％ 100％ 90％ 63％ 60％ 28％ 18％
MhHb-2 100％ 100％ 81％ 53％ 49％ 35％ 27％
MhHb-3 100％ 100％ 90％ 61％ 51％ 33％ 20％
MhHb-4 100％ 100％ 92％ 66％ 54％ 35％ 22％
MhHb-5 100％ 100％ 94％ 61％ 50％ 36％ 24％
11. Target gene MhDre4
The dsRNA feeding results show (Table 47) that dsRNA of the target sequences MhDre4-1 to MhDre4-5 of the target genes MhDre4 has obvious lethal effect on double-spotted fluorescent beetles, and most of the insects die on day 12 of feeding.
TABLE 47 survival assay results of dsRNA fed double-spotted fluorescent leaf beetles
Material numbering DAY 0 DAY 2 DAY 4 DAY 6 DAY 8 DAY 10 DAY 12
dsGFP 100％ 100％ 95％ 95％ 90％ 85％ 85％
MhDre4-1 100％ 100％ 90％ 68％ 60％ 40％ 25％
MhDre4-2 100％ 100％ 82％ 54％ 48％ 33％ 27％
MhDre4-3 100％ 100％ 91％ 61％ 54％ 33％ 30％
MhDre4-4 100％ 100％ 92％ 64％ 57％ 30％ 21％
MhDre4-5 100％ 100％ 93％ 67％ 52％ 32％ 28％
12. Target gene MhCOPI-b
The dsRNA feeding results show (Table 48) that the dsRNA of the target sequences MhCOPI-b-1 to MhCOPI-b-5 of the target genes MhCOPI-b have obvious lethal effect on double-spotted fluorescent leaf beetles, and most of the insects die on day 12 of feeding.
Table 48, survival rate experiment results of dsRNA fed double-spotted fluorescent leaf beetles
Material numbering DAY 0 DAY 2 DAY 4 DAY 6 DAY 8 DAY 10 DAY 12
dsGFP 100％ 100％ 95％ 95％ 90％ 90％ 85％
MhCOPI-b-1 100％ 100％ 90％ 65％ 60％ 32％ 26％
MhCOPI-b-2 100％ 100％ 82％ 55％ 48％ 34％ 22％
MhCOPI-b-3 100％ 100％ 91％ 59％ 51％ 31％ 23％
MhCOPI-b-4 100％ 100％ 92％ 66％ 56％ 33％ 26％
MhCOPI-b-5 100％ 100％ 90％ 60％ 50％ 26％ 20％
Example 5 fluorescent quantitative PCR experiments on double-spotted fluorescent leaf beetle target genes
(1) The insects fed with the dsRNA feed in example 4 were collected on days 0, 2 and 4, respectively, and frozen in liquid nitrogen.
(2) And extracting total RNA of the insect bodies respectively by adopting a Trizol method.
(3) For total RNAReverse transcription, reverse transcription utilization kitIII 1st Strand cDNA Synthesis Kit (+gDNA wind), version 22.1, cDNA was obtained by reverse transcription, reverse transcription protocol: preparing a mixed solution in an RNase-free centrifuge tube, adding 1 mug of total RNA, adding RNase-free Water to 8 mug, heating at 65 ℃ for 5min, rapidly quenching on ice, and standing on ice for 2min; adding 5 XgDNA wind Mix 2 mu L into the mixed solution in the last step, lightly blowing and mixing by a liquid transfer device, and keeping the temperature at 42 ℃ for 2min; to the reaction solution of the previous step, 10 XRT Mix 2. Mu.L, hiScript III Enzyme Mix. Mu.L, oligo (dT) was added 20 VN 1μL，RNase-free ddH 2 O5. Mu.L, gently blow and mix with a pipette. The reaction conditions were 25℃for 5min,37℃for 45min and 85℃for 5sec.
(4) The cDNA obtained by reverse transcription is used for fluorescent quantitative PCR, the double-spotted fluorescent leaf beetle 18s gene (SEQ ID NO: 120) is used as an internal reference gene, the mRNA expression quantity is detected, and the inhibition effect of the dsRNA of the target sequence on the double-spotted fluorescent leaf beetle target gene expression is judged. The reagent used for fluorescent quantitative PCR was AceQ qPCR SYBR Green Master Mix (Nanjing Vazyme Biotech co., ltd), the reaction system of which was: template 0.5. Mu.L, forward Primer 0.4. Mu.L, reverse Primer 0.4. Mu.L, 2X AceQ qPCR SYBR Green Master Mix, 10.0. Mu.L, ddH 2 O8.7. Mu.L. The reaction conditions are as follows: 95 ℃ for 5min;95℃10s,60℃30s,40 cycles.
The primers set by taking the double-spotted fluorescent leaf beetle 18s gene as an internal reference gene are as follows:
CTGAACGACTCAAGGATGC；GGATATAGCCCAAGCTATGTTAG。
(5) By 2 -△△Ct The relative transcript levels of the genes of interest are calculated.
Each treatment in the above experiment was repeated 5 times.
1. Target gene MhWupA troponin I
The forward primer and the reverse primer of the quantitative PCR of the double-spotted fluorescent leaf beetle MhWupA troponin I gene are as follows: GGTACGGAGAACCAGCAGGAC; CTTCGATAAAATGAAAAGCAACGCCG.
As can be seen from fig. 1, 2 and 3, after feeding the dsRNA of the target sequence fragment of MhWupA troponin I, the transcription level of MhWupA troponin I gene in vivo was also significantly inhibited, indicating that the feeding of dsRNA resulted in MhWupA troponin I gene silencing of the double-spotted fluorescent leaf beetles.
2. Target gene MhTPS
The forward primer and the reverse primer of the quantitative PCR of the double-spotted fluorescent leaf beetle MhTPS gene are as follows: CACACAAGAGGACCATGATGATATTG; CAGGAATGTTTGAGAGTCTTTGTAAAAC.
As can be seen from fig. 5, after feeding the dsRNA of the target sequence fragment of MhTPS, the transcription level of the MhTPS gene in vivo is also significantly inhibited, indicating that the feeding of the dsRNA causes the silencing of the MhTPS gene of the phlozenia bifasciata.
3. Target gene MhSsj1
The forward primer and the reverse primer of the quantitative PCR of the M.bifidus MhSsj1 gene are as follows:
GACTCTGAAAGACAAGTTGGTCTG；GAGATAACGGGTATGGAAAGGTTAC。
as can be seen from FIG. 7, after feeding dsRNA of the target sequence fragment of MhSsj1, the transcription level of the MhSsj1 gene in the body is also significantly inhibited, which indicates that the feeding of the dsRNA causes the silencing of the MhSsj1 gene of the double-spotted fluorescent leaf beetle.
4. Target gene MhSec23A
The forward primer and the reverse primer of the quantitative PCR of the double-spotted fluorescent leaf beetle MhSec23A gene are as follows: GTAGATTATAGGGCAAAACTCTGG; CAATATTGCTCGGCAATTATTTCTTG.
As can be seen from FIG. 9, after feeding dsRNA of the target sequence fragment of MhSec23A, the transcription level of the MhSec23A gene in the body is also significantly inhibited, indicating that the feeding of the dsRNA causes the silencing of the MhSec23A gene of the double-spotted fluorescent leaf beetle.
5. Target gene MhRfb 7
The forward primer and the reverse primer of the quantitative PCR of the double-spotted fluorescent leaf beetle MhRpb7 gene are as follows: GACCGTTTAAAGGTGAAGTCCTAG; GCATCCACTCTTGTACCAAC.
As can be seen from FIG. 11, after feeding dsRNA of the target sequence fragment of MhRpb7, the transcription level of the MhRpb7 gene in the body is also significantly inhibited, indicating that the feeding of dsRNA causes the MhRpb7 gene silencing of the double-spotted fluorescent leaf beetle.
6. Target gene MhRfb 2
The forward primer and the reverse primer of the quantitative PCR of the double-spotted fluorescent leaf beetle MhRpb2 gene are as follows: CGCCAAGACAAAGAATATGCTTATTG; GTGGATAATACAATACGTGAGCTAAGG.
As can be seen from fig. 13, after feeding the dsRNA of the target sequence fragment of MhRpb2, the transcription level of the MhRpb2 gene in vivo was also significantly inhibited, indicating that the feeding of dsRNA resulted in the silencing of the MhRpb2 gene of the diabrotica spp.
7. Target gene MhRop
The forward primer and the reverse primer of the quantitative PCR of the double-spotted fluorescent leaf beetle MhRop gene are as follows: CAACGTCATCAATGATGGTGG; CTGGAAGGGGCTGCATG.
As can be seen from fig. 15, after feeding the dsRNA of the target sequence fragment of MhRop, the transcription level of the MhRop gene in vivo was also significantly inhibited, indicating that feeding the dsRNA resulted in the silencing of the MhRop gene of the phloem.
8. Target gene MhNcm
The forward primer and the reverse primer of the quantitative PCR of the double-spotted fluorescent leaf beetle MhNcm gene are as follows: GATGGAATTAAAGTTAGCGACAGGC; CTTCCACGTGTTTTGATCGTG.
As can be seen from FIG. 17, after feeding dsRNA of the target sequence fragment of MhNcm, the transcription level of the MhNcm gene in the body is also significantly inhibited, which indicates that the feeding of dsRNA causes the silencing of the MhNcm gene of the double-spotted fluorescent leaf beetle.
9. Target gene MhMov34
The forward primer and the reverse primer of the quantitative PCR of the double-spotted fluorescent leaf beetle MhMov34 gene are as follows: GGTACGGAGAACCAGCAGGAC; CTTCGATAAAATGAAAAGCAACGCCG.
As can be seen from fig. 19, after feeding the dsRNA of the target sequence fragment of MhMov34, the transcription level of the MhMov34 gene in vivo was also significantly inhibited, indicating that feeding the dsRNA resulted in the silencing of the MhMov34 gene of the diabrotica.
10. Target gene MhHb
The forward primer and the reverse primer of the quantitative PCR of the double-spotted fluorescent leaf methyl MhHb gene are: GATAAAAGCGTGTTGAGTGAAGGTTC; CACTTGGGGCAATTAAGAAGTTTG
As can be seen from fig. 21, after feeding the dsRNA of the target sequence fragment of MhHb, the transcription level of the MhHb gene in vivo was also significantly inhibited, indicating that the feeding of dsRNA resulted in the silencing of the MhHb gene of the diabrotica.
11. Target gene MhDre4
The forward primer and the reverse primer of the quantitative PCR of the double-spotted fluorescent leaf beetle MhDre4 gene are as follows: GATACACCCTTCCGAGAATTGG; GGAATTGCATTGACCATGACAG.
As can be seen from FIG. 23, after feeding dsRNA of the target sequence fragment of MhDre4, the transcription level of the MhDre4 gene in the body is also significantly inhibited, which indicates that feeding of the dsRNA causes the silencing of the MhDre4 gene of the double-spotted fluorescent leaf beetle.
12. Target gene MhCOPI-b
The forward primer and the reverse primer of the quantitative PCR of the MhCOPI-b gene of the double-spotted fluorescent leaf beetle are as follows: GATCAGTTTCCTGCAGTTAGAAACCG; GGTTAACGTGGACGTACGC.
As can be seen from FIG. 25, after feeding the dsRNA of the target sequence fragment of MhCOPI-b, the transcription level of the MhCOPI-b gene in the body is also significantly inhibited, indicating that the feeding of the dsRNA causes the silencing of the MhCOPI-b gene of the MhCOPI.
Example 6 construction of plant transformation vectors
1. Target gene MhWupA troponin I
In this example, transformation vectors were constructed based on the pCambia1300 (NCBI SEQ ID NO: AF 234296) vector, and the reader of the present invention can achieve the same effect on other plant genetic transformation vectors, e.g., pCambia1301, pCambia2301, etc., according to the methods provided in this example.
Taking RMhW1 transformation vector as an example, the schematic diagram is shown in fig. 4, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); w1 (SEQ ID NO: 8): the w1 nucleotide sequence is the sequence of a target fragment MhWup A troponin I-1 (SEQ ID NO: 3) +the spacer sequence (SEQ ID NO: 114) +the reverse complement sequence of the target fragment MhWup A troponin I-1 (SEQ ID NO: 9); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 8 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
The RMhW1 transformation vector was constructed as follows:
(1) Vector fragment: to screen positive tissues using glyphosate during plant tissue culture, pCambia1300 was double digested with restriction enzymes KpnI, xhoI (purchased from ThermoFisher company), the original hygromycin screening gene expression cassette in 1300 vector was excised, incubated at 37℃for 1 hour, and then electrophoretically separated, recovering vector fragment 1300-FV having a size of about 6.8 kb.
(2) dsRNA expression cassette:
the dsRNA expression frame is formed by sequentially connecting a figwort mosaic virus FMV35S promoter-TRA (target sequence sense strand-spacer sequence-target sequence antisense strand) -cauliflower mosaic virus 35S terminator together.
The amplified fragments of the corresponding sizes were recovered by conventional PCR reactions using the fmvdsrna fragment as template and the primers dsRNA-F/R of Table 49, and the dsRNA expression cassettes (pFMV-dsRNA-tNos) were synthesized.
(3) G10-2 expression cassette:
the G10-2 expression cassette is constructed from the marker gene G10-epsps conferring glyphosate resistance selection, whose expression is initiated by the yellow leaf curl virus promoter pCmYLCV, and terminated using the original t35s terminator on pCambia 1300.
The cmpg102 fragment was used as a template, and a conventional PCR reaction was performed using the primer G102-F/R of Table 49, and amplified fragments of the corresponding sizes were recovered to synthesize the G10-2 expression cassette (pCmYLCV-G102).
(4) Transformation vector
Methods for seamless cloning by homologous recombination (e.g. Nanjinouzan Co., ltdMultiS kit, product number C113-01) was used to ligate dsRNA expression cassette and G10-2 expression cassette between HindIII and XhoI sites of 1300-FV vector. According to the specification, after the seamless cloning reaction solution is uniformly mixed, incubating for 30min at 37 ℃, and after the completion, rapidly placing the mixture on ice and cooling for more than 2 min.
TABLE 49 primer sequences for PCR reactions and corresponding amplified fragment lengths
Amplification can be performed using conventional PCR reactions. For example, the reaction system was carried out according to instructions using Hi-Fi enzyme 2X Phanta Max Master Mix (Nuo-vogue, cat. P515-01).
TABLE 50PCR reaction procedure
And (3) after the PCR product is subjected to agarose gel electrophoresis and rubber tapping recovery, measuring the concentration of the recovered product.
Table 51 reaction System
(5) Transformation of transformation vector: e.coli DH 5. Alpha. Competent cells (Shanghai Weidi Biotechnology Co., CAT#: DL 1001) were thawed on ice, the reaction solution after completion of the reaction after completion of the seamless cloning was added, the ice bath was carried out for 25 minutes, followed by heat shock in a water bath at 42℃for 45 seconds, then the mixture was cooled rapidly on ice for 2 minutes, 1ml of LB medium was added, shaking culture was carried out at 37℃for 1 hour, then plates were plated on LB solid medium containing 50mg/L kanamycin, and single clones were picked for sequencing identification after overnight culture at 37 ℃.
(6) Identification of transformation vector: and (3) picking the monoclonal colony in the step (5) for sequencing identification, and storing the glycerinum which identifies the correct clone in a refrigerator at the temperature of minus 80 ℃. The recombinant expression vector RMhW1 is used for transforming competent cells of the escherichia coli TG1 by a heat shock method, and the operation steps are as follows: placing TG1 competent cells in ice for melting (or placing palm or room temperature for a moment, quickly inserting the cells into the ice when the cells are in an ice water mixed state), adding recombinant expression vector RMhW1 mu L, stirring EP pipe bottom by hand, gently mixing, and standing on the ice for 25 minutes; heat shock in 42 deg.c water bath for 45 sec, fast returning to ice and standing for 2 min; 700 mu L of LB sterile medium without antibiotics is added into the centrifuge tube, and after uniform mixing, the mixture is resuscitated for 60 minutes at 37 ℃ and 200 rpm; centrifuging at 5000rpm for one minute to collect bacteria, reserving about 100 mu L of supernatant, lightly blowing a re-suspended bacterial block, and coating the re-suspended bacterial block on LB culture medium containing 50mg/L kanamycin antibiotics; the plates were placed in an incubator at 37℃overnight. The monoclonal plaques were picked up and shake-cultured overnight at 220rpm in LB liquid medium at 37 ℃. Plasmids were extracted using the AxyPrep plasmid DNA miniprep kit. The operation method comprises the following steps: taking 1-4ml of bacterial liquid cultured overnight in LB culture medium, centrifuging at 12,000rpm for 1min, and discarding the supernatant; adding 250 mu L Buffer S1 to suspend bacterial sediment, wherein the suspension is uniform and small bacterial blocks are not required to be remained; adding 250 μL Buffer S2, gently and fully turning up and down for 4-6 times, and uniformly mixing to enable the thalli to be fully cracked until a transparent solution is formed, wherein the step is not suitable for more than 5min; adding 350 μL Buffer S3, gently and fully turning up and down, mixing for 6-8 times, and centrifuging at 12,000rpm for 10min; the supernatant from the previous step was aspirated and transferred to a preparation tube (placed in a 2ml centrifuge tube), centrifuged at 12,000rpm for 1min, and the filtrate was discarded; the preparation tube was placed back into a centrifuge tube, 500. Mu.L Buffer W1 was added, and the mixture was centrifuged at 12,000rpm for 1min, and the filtrate was discarded; the preparation tube was placed back into a centrifuge tube, 700. Mu.L Buffer W2 was added, and the mixture was centrifuged at 12,000rpm for 1min, and the filtrate was discarded; the mixture was washed once again with 700. Mu.L Buffer W2 in the same manner, and the filtrate was discarded; the preparation tube was placed back into a 2ml centrifuge tube and centrifuged at 12,000rpm for 1min; the preparation tube was transferred into a new 1.5ml centrifuge tube, 60-80. Mu.L of Eluent or deionized water was added to the center of the preparation tube membrane, and the tube was allowed to stand at room temperature for 1min. Centrifuge at 12,000rpm for 1min. The plasmid of RMhW1 was obtained and stored in a refrigerator at-20℃for use.
According to the method, a w2 nucleotide sequence, a w3 nucleotide sequence and a w4 nucleotide sequence are respectively adopted to construct recombinant expression vectors RMhW2, RMhW3 and RMhW4, wherein the w2 nucleotide sequence, the w3 nucleotide sequence and the w4 nucleotide sequence are respectively different from the w1 nucleotide sequence in that the sequences of a target fragment MhWupA troponin I-1 are respectively replaced by a target fragment MhWupA troponin I-2 (SEQ ID NO: 4), a target fragment MhWupA troponin I-3 (SEQ ID NO: 5) and a target fragment MhWupA troponin I-4 (SEQ ID NO: 6). The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
2. Target gene MhTPS
The method of step 1 is adopted, and the difference is that: taking RMhT1 transformation vector as an example, the schematic diagram is shown in fig. 6, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); t1 (SEQ ID NO: 18): the T1 nucleotide sequence is the sequence (SEQ ID NO: 12) +the spacer sequence (SEQ ID NO: 114) +the reverse complement sequence (SEQ ID NO: 19) of the target fragment MhTPS-1; tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 18 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
The T2 nucleotide sequence, the T3 nucleotide sequence, the T4 nucleotide sequence and the T5 nucleotide sequence are respectively adopted to construct recombinant expression vectors RMhT2, RMhT3, RMhT4 and RMhT5, wherein the T2 nucleotide sequence, the T3 nucleotide sequence, the T4 nucleotide sequence and the T5 nucleotide sequence are respectively different from the T1 nucleotide sequence in that the sequence (SEQ ID NO: 12) of the target fragment MhTPS-1 is respectively replaced by the target fragment MhTPS-2 (SEQ ID NO: 13), the target fragment MhTPS-3 (SEQ ID NO: 14), the target fragment MhTPS-4 (SEQ ID NO: 15) and the target fragment MhTPS-5 (SEQ ID NO: 16). The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
3. Target gene MhSsj1
Taking RMhSj1 transformation vector as an example, the schematic diagram is shown in fig. 8, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); sj1 (SEQ ID NO: 25): the sj1 nucleotide sequence is the sequence of the target fragment MhSsj1-1 (SEQ ID NO: 22) +the spacer sequence (SEQ ID NO: 114) +the reverse complement sequence of the target fragment MhSsj1-1 (SEQ ID NO: 26); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 25 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
A recombinant expression vector RMhSj2 is constructed by adopting a sj2 nucleotide sequence, wherein the sj2 nucleotide sequence is different from the sj1 nucleotide sequence in that the sequence (SEQ ID NO: 22) of the target fragment MhSj 1-1 is replaced by the target fragment MhSj 1-2 (SEQ ID NO: 23). The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
4. Target gene MhSec23A
Taking RMhS1 transformation vector as an example, the schematic diagram is shown in fig. 10, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); s1 (SEQ ID NO: 35): the s1 nucleotide sequence is the sequence of the target fragment MhSec23A-1 (SEQ ID NO: 29) +the spacer sequence (SEQ ID NO: 113) +the reverse complement sequence of the target fragment MhSec23A-1 (SEQ ID NO: 36); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 35 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
Recombinant expression vectors RMhS2, RMhS3, RMhS4 and RMhS5 are constructed by adopting an s2 nucleotide sequence, an s3 nucleotide sequence, an s4 nucleotide sequence and an s5 nucleotide sequence, wherein the s2 nucleotide sequence, the s3 nucleotide sequence, the s4 nucleotide sequence and the s5 nucleotide sequence are different from the s1 nucleotide sequence in that the sequence of the target fragment MhSec23A-1 (SEQ ID NO: 29) is replaced by the target fragment MhSec23A-2 (SEQ ID NO: 30), the target fragment MhSec23A-3 (SEQ ID NO: 31), the target fragment MhSec23A-4 (SEQ ID NO: 32) and the target fragment MhSec23A-5 (SEQ ID NO: 33) respectively. The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
5. Target gene MhRfb 7
Taking RMhRp71 transformation vector as an example, the schematic diagram is shown in fig. 12, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); rp71 (SEQ ID NO: 42): the Rp71 nucleotide sequence is the sequence of the target fragment MhRpb7-1 (SEQ ID NO: 39) +the spacer sequence (SEQ ID NO: 114) +the reverse complement sequence of the target fragment MhRpb7-1 (SEQ ID NO: 43); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 42 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
A recombinant expression vector RMhRp72 is constructed using the Rp72 nucleotide sequence, wherein the Rp72 nucleotide sequence differs from the Rp71 nucleotide sequence in that the sequence of the target fragment MhRpb7-1 (SEQ ID NO: 39) is replaced with the target fragment MhRpb7-2 (SEQ ID NO: 40). The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
6. Target gene MhRfb 2
Taking RMhRP1 transformation vector as an example, the schematic diagram is shown in fig. 14, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); RP1 (SEQ ID NO: 52): the nucleotide sequence of RP1 is the sequence of a target fragment MhRpb2-1 (SEQ ID NO: 46) +the spacer sequence (SEQ ID NO: 114) +the reverse complement sequence of the target fragment MhRpb2-1 (SEQ ID NO: 53); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 52 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
Recombinant expression vectors RMhRP2, RMhRP3, RMhRP4 and RMhRP5 are respectively constructed by adopting an RP2 nucleotide sequence, an RP3 nucleotide sequence, an RP4 nucleotide sequence and an RP5 nucleotide sequence, wherein the RP2 nucleotide sequence, the RP3 nucleotide sequence, the RP4 nucleotide sequence and the RP5 nucleotide sequence are respectively different from the RP1 nucleotide sequence in that the sequence (SEQ ID NO: 46) of the target fragment MhRpb2-1 is respectively replaced by the target fragment MhRpb2-2 (SEQ ID NO: 47), the target fragment MhRpb2-3 (SEQ ID NO: 48), the target fragment MhRpb2-4 (SEQ ID NO: 49) and the target fragment MhRpb2-5 (SEQ ID NO: 50). The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
7. Target gene MhRop
Taking RMhRop1 transformation vector as an example, the schematic diagram is shown in fig. 16, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); rop1 (SEQ ID NO: 62): the Rop1 nucleotide sequence is the sequence of the target fragment MhRop-1 (SEQ ID NO: 56) +the spacer sequence (SEQ ID NO: 114) +the reverse complement of the target fragment MhRop-1 (SEQ ID NO: 63); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 62 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
Recombinant expression vectors RMhRop2, RMhRop3, RMhRop4, RMhRop5 were constructed using the Rop2, rop3, rop4, and Rop5 nucleotide sequences, respectively, wherein the Rop2, rop3, rop4, and Rop5 nucleotide sequences differ from the Rop1 nucleotide sequences in that the sequence of the target fragment MhRop-1 (SEQ ID NO: 56) was replaced with the target fragment MhRop-2 (SEQ ID NO: 57), the target fragment MhRop-3 (SEQ ID NO: 58), the target fragment MhRop-4 (SEQ ID NO: 59), and the target fragment MhRop-5 (SEQ ID NO: 60), respectively. The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
8. Target gene MhNcm
Taking RMhN1 transformation vector as an example, the schematic diagram is shown in fig. 18, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); n1 (SEQ ID NO: 72): the N1 nucleotide sequence is the sequence (SEQ ID NO: 66) +the spacer sequence (SEQ ID NO: 114) +the reverse complement sequence (SEQ ID NO: 73) of the target fragment MhNcm-1 with N1 as the target fragment MhNcm-1; tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 72 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
The N2 nucleotide sequence, the N3 nucleotide sequence, the N4 nucleotide sequence and the N5 nucleotide sequence are respectively adopted to construct recombinant expression vectors RMhN2, RMhN3, RMhN4 and RMhN5, wherein the N2 nucleotide sequence, the N3 nucleotide sequence, the N4 nucleotide sequence and the N5 nucleotide sequence are respectively different from the N1 nucleotide sequence in that the sequence (SEQ ID NO: 66) of the target fragment MhNcm-1 is respectively replaced by the target fragment MhNcm-2 (SEQ ID NO: 67), the target fragment MhNcm-3 (SEQ ID NO: 68), the target fragment MhNcm-4 (SEQ ID NO: 69) and the target fragment MhNcm-5 (SEQ ID NO: 70). The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
9. Target gene MhMov34
Taking RMhM1 transformation vector as an example, the schematic diagram is shown in fig. 20, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); m1 (SEQ ID NO: 81): the M1 nucleotide sequence is the sequence of the target fragment MhMov34-1 (SEQ ID NO: 76) +spacer sequence (SEQ ID NO:114 the reverse complement of the target fragment MhMov34-1 (SEQ ID NO: 82), tNos the terminator of the nopaline synthase gene (SEQ ID NO: 115), pCmYLCV the yellow leaf curl virus promoter (SEQ ID NO: 116), sp corn chloroplast signal peptide (SEQ ID NO: 117), G10-2:5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118), poly (A) signal polyadenylation signal (SEQ ID NO: 119), LB T-DNA repeat: left border. SEQ ID NO:113, SEQ ID NO:81, the fragments sequentially connected to SEQ ID NO:115 are fmvdsrna, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119 are cm 102, respectively, and are synthesized by the marine engineering company.
The M2 nucleotide sequence, the M3 nucleotide sequence and the M4 nucleotide sequence are respectively adopted to construct recombinant expression vectors RMhM2, RMhM3 and RMhM4, wherein the M2 nucleotide sequence, the M3 nucleotide sequence and the M4 nucleotide sequence are respectively different from the M1 nucleotide sequence in that the sequence (SEQ ID NO: 76) of the target fragment MhMov34-1 is respectively replaced by the target fragment MhMov34-2 (SEQ ID NO: 77), the target fragment MhMov34-3 (SEQ ID NO: 78) and the target fragment MhMov34-4 (SEQ ID NO: 79). The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
10. Target gene MhHb
Taking RMhH1 transformation vector as an example, the schematic diagram is shown in fig. 22, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); h1 (SEQ ID NO: 91): the H1 nucleotide sequence is the sequence of a target fragment MhHb-1 (SEQ ID NO: 85) +the spacer sequence (SEQ ID NO: 114) +the reverse complement sequence of the target fragment MhHb-1 (SEQ ID NO: 92); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 91 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
Recombinant expression vectors RMhH2, RMhH3, RMhH4 and RMhH5 are constructed by respectively adopting an H2 nucleotide sequence, an H3 nucleotide sequence, an H4 nucleotide sequence and an H5 nucleotide sequence, wherein the H2 nucleotide sequence, the H3 nucleotide sequence, the H4 nucleotide sequence and the H5 nucleotide sequence are different from the H1 nucleotide sequence in that the sequence of a target fragment MhHb-1 (SEQ ID NO: 85) is respectively replaced by a target fragment MhHb-2 (SEQ ID NO: 86), a target fragment MhHb-3 (SEQ ID NO: 87), a target fragment MhHb-4 (SEQ ID NO: 88) and a target fragment MhHb-5 (SEQ ID NO: 89). The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
11. Target gene MhDre4
Taking RMhD1 transformation vectors as an example, the schematic diagram is shown in fig. 24, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); d1 (SEQ ID NO: 101): the nucleotide sequence D1 is the sequence of the target fragment MhDre4-1 (SEQ ID NO: 95) +the spacer sequence (SEQ ID NO: 114) +the reverse complement sequence of the target fragment MhDre4-1 (SEQ ID NO: 102); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 101 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
Recombinant expression vectors RMhD2, RMhD3, RMhD4 and RMhD5 are constructed by respectively adopting a D2 nucleotide sequence, a D3 nucleotide sequence, a D4 nucleotide sequence and a D5 nucleotide sequence, wherein the D2 nucleotide sequence, the D3 nucleotide sequence, the D4 nucleotide sequence and the D5 nucleotide sequence are different from the D1 nucleotide sequence in that the sequence of the target fragment MhDre4-1 (SEQ ID NO: 95) is replaced by the target fragment MhDre4-2 (SEQ ID NO: 96), the target fragment MhDre4-3 (SEQ ID NO: 97), the target fragment MhDre4-4 (SEQ ID NO: 98) and the target fragment MhDre4-5 (SEQ ID NO: 99) respectively. The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
12. Target gene MhCOPI-b
Taking RMhC1 transformation vector as an example, the schematic diagram is shown in fig. 26, kan: kanamycin gene; RB T-DNA repeat: a right boundary; pFMV: the figwort mosaic virus 35S promoter (SEQ ID NO: 113); c1 (SEQ ID NO: 111): the C1 nucleotide sequence is the sequence of a target fragment MhCOPI-b-1 (SEQ ID NO: 105) +the spacer sequence (SEQ ID NO: 114) +the reverse complement sequence of the target fragment MhCOPI-b-1 (SEQ ID NO: 112); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 115); pCmYLCV: yellow leaf curl virus promoter (SEQ ID NO: 116); a corn chloroplast signal peptide (SEQ ID NO: 117); g10-2: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 118); poly (a) signal: polyadenylation signal (SEQ ID NO: 119); LB T-DNA repeat: left boundary. The fragments sequentially connected with SEQ ID NO. 113, SEQ ID NO. 111 and SEQ ID NO. 115 are marked as fmvdsrna; the fragments of SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, which were sequentially linked, were designated as cmpg102, and were respectively subjected to gene synthesis by Shanghai Biotechnology.
Recombinant expression vectors RMhC2, RMhC3, RMhC4 and RMhC5 are respectively constructed by adopting a C2 nucleotide sequence, a C3 nucleotide sequence, a C4 nucleotide sequence and a C5 nucleotide sequence, wherein the C2 nucleotide sequence, the C3 nucleotide sequence, the C4 nucleotide sequence and the C5 nucleotide sequence are respectively different from the C1 nucleotide sequence in that the sequence (SEQ ID NO: 105) of the target fragment MhCOPI-b-2 (SEQ ID NO: 106), the target fragment MhCOPI-b-3 (SEQ ID NO: 107), the target fragment MhCOPI-b-4 (SEQ ID NO: 108) and the target fragment MhCOPI-b-5 (SEQ ID NO: 109) are respectively replaced by the sequence (SEQ ID NO: 105) of the target fragment MhCOPI-b-1. The recombinant expression vector is transformed into competent cells of escherichia coli TG1 by a heat shock method, and plasmids thereof are extracted and stored in a refrigerator at the temperature of minus 20 ℃ for standby.
Example 7 transformation of Agrobacterium with recombinant plant transformation vector
The recombinant expression vector constructed in example 6 was transformed into competent cells of agrobacterium tumefaciens (Agrobacterium tumefaciens) LBA4404 strain by electric shock transformation (2200V), respectively, to prepare agrobacterium tumefaciens strain for maize genetic transformation.
The method comprises transferring the plasmid obtained in example 6 into competent cells of Agrobacterium LBA4404 by electric shock transformation, plating on a YEP solid medium containing 50mg/L kanamycin, 25mg/L rifampicin and 15mg/L tetracycline, culturing at 28deg.C for 48-72 hr, picking single colony after monoclonal growth into YEP liquid medium containing 50mg/L kanamycin, 25mg/L rifampicin and 15mg/L tetracycline, culturing at 28deg.C for 48-72 hr to obtain Agrobacterium culture solution (OD 600 =1.5 to 2.0), extracting plasmids for sequencing and identifying, and identifying correct positive clone bacteria to be stored in a refrigerator at the temperature of minus 80 ℃ for standby.
YEP medium composition: 10g/L peptone, 10g/L, naCl g/L yeast extract, water as solvent, and sterilizing at high temperature and high pressure; if a solid medium is prepared, 15g/L agar is added.
Example 8 obtaining transgenic maize plants
Genetic transformation of maize with Agrobacterium is carried out, in particular according to the method and the medium formulation reported by Frame et al (Plant Physiol,2002, 129:13-22), using glyphosate as screening agent, the following steps are followed: collecting the corncob 8-10 days after pollination, and collecting immature embryo with the size of 1.0-1.5 mm. Agrobacterium solution (OD) containing transformation vector of example 7 600 Approximately 1.0) were co-cultured with immature embryos at 22℃for 3-5 days. The immature embryos after cultivation are transferred to callus induction medium containing 200mg/L of timentin antibiotic (ghatti, usa) and dark-cultured at 28 ℃ for 10-14 days to kill agrobacterium. All calli after induction culture were transferred to screening medium containing final concentration of 2mM glyphosate and dark cultured at 28℃for 2-3 weeks. Transferring the surviving embryogenic tissue to a regeneration culture medium, culturing in dark at 28 ℃ for 10-14 days, transferring to a fresh regeneration culture medium, and culturing in light at 26 ℃ for 10-14 days. And (3) picking the plants with complete growth on a rooting culture medium, carrying out illumination culture at 26 ℃ until the roots are complete in growth, and transplanting the rooted regenerated seedlings into a greenhouse for seed reproduction.
1. Transgenic corn events transformed by the recombinant vectors RMhW1, RMhW2, RMhW3 and RMhW4 are respectively named as RW1, RW2, RW3 and RW4 and are used for screening analysis.
2. Transgenic corn events transformed by the recombinant vectors RMhT1, RMhT2, RMhT3, RMhT4 and RMhT5 are respectively named RT1, RT2, RT3, RT4 and RT5 and are used for screening analysis.
3. Transgenic corn events transformed by the recombinant vectors RMhSj1 and RMhSj2 are named RSJ1 and RSJ2 respectively and are used for screening analysis.
4. Transgenic corn events transformed by the recombinant vectors RMhS1, RMhS2, RMhS3, RMhS4 and RMhS5 are respectively named as RS1, RS2, RS3, RS4 and RS5 and are used for screening analysis.
5. Transgenic corn events transformed with the recombinant vectors RMhRp71, RMhRp72 were designated as RRp71, RRp72, respectively, for screening analysis.
6. Transgenic corn events transformed by the recombinant vectors RMhRP1, RMhRP2, RMhRP3, RMhRP4 and RMhRP5 are respectively named as RRP1, RRP2, RRP3, RRP4 and RRP5 and are used for screening analysis.
7. Transgenic maize events transformed with recombinant vectors RMhRop1, RMhRop2, RMhRop3, RMhRop4, RMhRop5 were designated as RROP1, RROP2, RROP3, RROP4, RROP5, respectively, for screening analysis.
8. Transgenic corn events transformed by the recombinant vectors RMhN1, RMhN2, RMhN3, RMhN4 and RMhN5 are respectively named as RN1, RN2, RN3, RN4 and RN5 and are used for screening analysis.
9. Transgenic corn events transformed by the recombinant vectors RMhM1, RMhM2, RMhM3 and RMhM4 are named RM1, RM2, RM3 and RM4 respectively and are used for screening analysis.
10. Transgenic corn events transformed by the recombinant vectors RMhH1, RMhH2, RMhH3, RMhH4 and RMhH5 are named RH1, RH2, RH3, RH4 and RH5 respectively and are used for screening analysis.
11. Transgenic corn events transformed by the recombinant vectors RMhD1, RMhD2, RMhD3, RMhD4 and RMhD5 are named RD1, RD2, RD3, RD4 and RD5 respectively and are used for screening analysis.
12. Transgenic maize events transformed by the recombinant vectors RMhC1, RMhC2, RMhC3, RMhC4, RMhC5 were designated as RC1, RC2, RC3, RC4, RC5, respectively, for screening analysis.
Example 9 transgenic maize target Gene detection
1. Extraction of corn genome
Corn genome DNA is extracted by adopting a CTAB (cetyl trimethyl ammonium bromide) method.
Taking 1000mg g of tender leaves of the transgenic corn event constructed in the example 8, grinding the leaves into powder in liquid nitrogen, adding 0.8mL of CTAB buffer solution (20 g/L CTAB,1.4M NaCl,100mM Tris-HCl,20mM EDTA,pH 8.0) preheated in a water bath kettle at 65 ℃, fully and uniformly mixing, and then carrying out water bath in the water bath kettle at 65 ℃ for 60min; adding equal volume of chloroform, mixing, centrifuging at 12000rpm for 10min, and sucking supernatant into a new centrifuge tube; adding 0.7 times of isopropanol, gently shaking the centrifuge tube, centrifuging at 12000rpm for 1min, and collecting DNA to the bottom of the tube; discarding supernatant, adding 1mL of ethanol with mass concentration of 75%, washing precipitate, centrifuging at 12000rpm for 1min, repeatedly washing once, and blow-drying in a super clean bench; the DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl,1mM EDTA,pH 8.0), the concentration of DNA was determined by Nanodrop, and the genomic DNA concentration of the above sample was adjusted to the same concentration value in the range of 80-100 ng/. Mu.L, and stored in a refrigerator at-20℃for use.
2. Detecting copy number of target sequence
The copy number of the G10-2 gene is detected by SYBR Green fluorescent quantitative PCR method to determine the copy number of the transferred target sequence. zSSIIb in the maize genome was selected as an internal reference gene, with samples of wild-type maize plants as controls, 3 replicates per sample.
This example uses SYBR Green fluorescent quantitative PCR kit (BIO RAD) using Bio-Rad Rad CFX96 TM The reaction was performed by a Real-Time PCR instrument, and the results were analyzed by Ct value comparison. The system and procedure are described in the instructions of SYBR Green fluorescent quantitative PCR kit, and the primer sequences are shown in Table 52.
Table 52, target sequence copy number detection primers
zSSIIb-1F CTCCCAATCCTTTGACATCTGC
zSSIIb-1R TCGATTTCTCTCTTGGTGACAGG-3
G10-2-F CTAACCTCCGCGAGCACGAC
G10-2-R CACGTTCTCCCAGGTGGTGTC
The maize reference gene zSSIIb is homozygous (i.e., two copies) in the maize genome. The insertion copy number of the exogenous T-DNA in the transgenic corn genome can be analyzed by Ct value comparison of qPCR results. For example, 2 per transformant -△Ct(sample-zSSIIb) Calculating a value of 0.5.+ -. 0.1, the transformant can be considered as a single copy (i.e., half of the reference gene); 2 of transformant -△Ct(sample-zSSIIb) Calculated values greater than 1.0, the transformant can be considered to be double-or multicopy (i.e., identical or more to the reference gene); if the value is between 0.6 and 1.0, the value is generally caused by a systematic error and can be solved by repeated experiments; if the number is 0, then a negative NGM maize transformant is identified. The qPCR method provided by the embodiment can analyze the copy number of the G10-2 gene, so that positive transformant plants can be identified, and single-copy transgenic corn plants can be obtained through rapid screening.
Example 10 identification of insecticidal Effect of transgenic maize on Apocynum bifidum
Cutting 3cm of filaments from a selected corn plant in a filament drawing period, spreading the filaments in a living measuring box paved with moisturizing filter paper in a flat way, wetting the filter paper with ultrapure water, and covering the two ends of the filaments with the filter paper to keep the filaments fresh; putting 15 adult double-spotted fluorescent beetles with consistent development duration into each biological measurement box, closing the cover of the biological measurement box, putting the biological measurement boxes into biological measurement boxes with the temperature of 25 ℃ (+/-0.5 ℃) and the photoperiod of 14:10h (L: D) and the relative humidity of 80% (+/-2 percent); counting the number of surviving double-spotted fluorescent leaf beetles from the outside of the culture dish every day until the end of day 14; the surviving double leaf beetles in the petri dishes were transferred every 48 hours to a fresh maize filament-containing bioassay box.
1. Target sequence of target gene MhWupA troponin I
The insect-resistant effect of the double-spot fluorescent leaf beetles on the transgenic corn plants transferred with the WX nucleotide sequences (X is 1-4) is detected. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RW1 maize transformants, 10 positive single copy RW2 maize transformants, 10 positive single copy RW3 maize transformants, 10 positive single copy RW4 maize transformants, and 3 NGM maize transformants identified as negative in example 9, with wild type maize plants as Controls (CK); planting in a greenhouse until a silk pulling period. The experimental results are shown in Table 53.
Table 53 Experimental results of filament fed double-spotted fluorescent leaf beetles at corn transformation event
The result shows that the transgenic corn plants transferred with the WX (X is 1-4) nucleotide sequence have better inhibition effect on the adult double-spotted fluorescent beetles, and the survival rate of the double-spotted fluorescent beetles on the 14 th day is below 30% (survival rate=survival number/test number).
2. Target sequence of target gene MhTPS
The insect-resistant effect of the transgenic corn plants transferred with the TX nucleotide sequence (X is 1-5) on the diabrotica. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RT1 maize transformants10 positive single copy RT2 maize transformants, 10 positive single copy RT3 maize transformants, 10 positive single copy RT4 maize transformants, 10 positive single copy RT5 maize transformants, and 3 NGM maize transformants identified as negative in example 9, with wild-type maize plants as Control (CK); planting in a greenhouse until a silk pulling period. The experimental results are shown in Table 54.
Table 54, experimental results of filament feeding of maize transformation event
The result shows that the transgenic corn plants transferred with the TX (X is 1-5) nucleotide sequence have good inhibition effect on the adult double-spotted fluorescent beetles, and the survival rate of the adult double-spotted fluorescent beetles on the 14 th day is below 30%.
3. Target sequence of target gene MhSsj1
And (3) carrying out insect resistance effect detection on the diabrotica virgifera by using the transgenic corn plants transferred into the Sj1 and Sj2 nucleotide sequences. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copies of RSJ1 maize transformants, 10 positive single copies of RSJ2 maize transformants, and 3 NGM maize transformants identified as negative in example 9, with wild-type maize plants as Controls (CK); planting in a greenhouse until a silk pulling period. The experimental results are shown in table 55.
TABLE 55 Experimental results of filament fed double-spotted fluorescent leaf beetles for maize transformation event
The results show that the transgenic corn plants transferred into the nucleotide sequences Sj1 and Sj2 have good inhibition effect on the adult diabrotica that has the survival rate of less than 30 percent (survival rate=survival number/test number) on the 14 th day.
4. Target sequence of target gene MhSec23A
The insect-resistant effect of the double-spot fluorescent leaf beetles on the transgenic corn plants transferred with the SX nucleotide sequences (X is 1-5) is detected. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RS1 maize transformants, 10 positive single copy RS2 maize transformants, 10 positive single copy RS3 maize transformants, 10 positive single copy RS4 maize transformants, 10 positive single copy RS5 maize transformants, and 3 NGM maize transformants identified as negative in example 9, with wild-type maize plants as Controls (CK); planting in a greenhouse until a silk pulling period. The results of the experiment are shown in Table 56.
Table 56 Experimental results of filament feeding of double-spotted fluorescent leaf beetles at corn transformation event
5. Target gene MhRfb 7
Transgenic corn plants transformed with Rp71 and Rp72 nucleotide sequences were tested for insect-resistant effect on P.bifidus. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RRp71 maize transformants, 10 positive single copy RRp72 maize transformants, and 3 NGM maize transformants identified as negative in example 9, with wild-type maize plants as Controls (CK); planting in a greenhouse until a silk pulling period. The experimental results are shown in Table 57.
Table 57 Experimental results of filament feeding of double-spotted fluorescent leaf beetles at corn transformation event
The result shows that the transgenic corn plants transferred with Rp71 and Rp72 nucleotide sequences have better inhibition effect on the adult diabrotica that has the survival rate of less than 30 percent (survival rate=survival number/test number) on the 14 th day.
6. Target gene MhRfb 2
The insect-resistant effect of the double-spot fluorescent leaf beetles on the transgenic corn plants transferred with the RPX nucleotide sequences (X is 1-5) is detected. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RRP1 maize transformants, 10 positive single copy RRP2 maize transformants, 10 positive single copy RRP3 maize transformants, 10 positive single copy RRP4 maize transformants, 10 positive single copy RRP5 maize transformants, and 3 NGM maize transformants identified as negative in example 9, with wild-type maize plants as Controls (CK); planting in a greenhouse until a silk pulling period. The results of the experiment are shown in Table 58.
Table 58 Experimental results of filament fed double-spotted fluorescent leaf beetles at corn transformation event
The result shows that the transgenic corn plants transferred with the RPX (X is 1-5) nucleotide sequence have better inhibition effect on the adult double-spotted fluorescent beetles, and the survival rate of the double-spotted fluorescent beetles on the 14 th day is below 30% (survival rate=survival number/test number).
7. Target gene MhRop
The insect-resistant effect of the double-spot fluorescent leaf beetles on the transgenic corn plants transferred with the ROPX nucleotide sequences (X is 1-5) is detected. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RROP1 maize transformants, 10 positive single copy RROP2 maize transformants, 10 positive single copy RROP3 maize transformants, 10 positive single copy RROP4 maize transformants, 10 positive single copy RROP5 maize transformants, and 3 example 9NGM maize transformants identified as negative in (a) with wild-type maize plants as a Control (CK); planting in a greenhouse until a silk pulling period. The experimental results are shown in Table 59.
Table 59, results of experiments with double-spotted fluorescent leaf beetles fed with corn transformation event
The result shows that the transgenic corn plants transferred with the ROPX (X is 1-5) nucleotide sequence have better inhibition effect on the adult double-spotted fluorescent beetles, and the survival rate of the double-spotted fluorescent beetles on the 14 th day is below 30% (survival rate=survival number of heads/test number of heads).
8. Target gene MhNcm
The insect-resistant effect of the double-spot fluorescent leaf beetles on transgenic corn plants transferred with NX nucleotide sequences (X is 1-5) is detected. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RN1 maize transformants, 10 positive single copy RN2 maize transformants, 10 positive single copy RN3 maize transformants, 10 positive single copy RN4 maize transformants, 10 positive single copy RN5 maize transformants, and 3 NGM maize transformants identified as negative in example 9, with wild type maize plants as Control (CK); planting in a greenhouse until a silk pulling period. The experimental results are shown in table 60.
TABLE 60 Experimental results of filament fed double-spotted fluorescent leaf beetles for corn transformation event
9. Target gene MhMov34
Transgenic maize plants transformed with MX nucleotide sequences (X is 1-4) were pairedThe insect-resistant effect of the diabrotica is detected. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RM1 maize transformants, 10 positive single copy RM2 maize transformants, 10 positive single copy RM3 maize transformants, 10 positive single copy RM4 maize transformants, and 3 NGM maize transformants identified as negative in example 9, with wild-type maize plants as Controls (CK); planting in a greenhouse until a silk pulling period. The experimental results are shown in Table 61.
Table 61, experimental results of feeding double-spotted fluorescent leaf beetles with corn transformation event filaments
The result shows that the transgenic corn plants with the nucleotide sequence of MX (X is 1-4) have better inhibition effect on the adult diabrotica that has the survival rate of less than 30 percent (survival rate=survival number/test number) on the 14 th day.
10. Target gene MhHb
The insect-resistant effect of the double-spot fluorescent leaf beetles on transgenic corn plants transferred with HX nucleotide sequences (X is 1-5) is detected. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RH1 maize transformants, 10 positive single copy RH2 maize transformants, 10 positive single copy RH3 maize transformants, 10 positive single copy RH4 maize transformants, 10 positive single copy RH5 maize transformants, and 3 NGM maize transformants identified as negative in example 9, with wild-type maize plants as Controls (CK); planting in a greenhouse until a silk pulling period. The experimental results are shown in Table 62.
Table 62, experimental results of filament feeding of maize transformation event
The result shows that the transgenic corn plants transferred with HX (X is 1-5) nucleotide sequences have better inhibition effect on the adult double-spotted fluorescent beetles, and the survival rate of the double-spotted fluorescent beetles on the 14 th day is below 30% (survival rate=survival number of heads/test number of heads).
11. Target gene MhDre4
The insect-resistant effect of the double-spot fluorescent leaf beetles on transgenic corn plants transferred with DX nucleotide sequences (X is 1-5) is detected. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RD1 maize transformants, 10 positive single copy RD2 maize transformants, 10 positive single copy RD3 maize transformants, 10 positive single copy RD4 maize transformants, 10 positive single copy RD5 maize transformants, and 3 NGM maize transformants identified as negative in example 9, with wild-type maize plants as Controls (CK); planting in a greenhouse until a silk pulling period. The results of experiment 63 are shown in Table.
Table 63 Experimental results of feeding double-spotted fluorescent leaf beetles with corn transformation event filaments
The result shows that the transgenic corn plants transferred with DX (X is 1-5) nucleotide sequences have better inhibition effect on the adult double-spotted fluorescent beetles, and the survival rate of the double-spotted fluorescent beetles on the 14 th day is below 30% (survival rate=survival number of heads/test number of heads).
12. Target gene MhCOPI-b
The insect-resistant effect of the double-spot fluorescent leaf beetles on transgenic corn plants transferred with CX nucleotide sequences (X is 1-5) is detected. Screening 2 by the method provided in example 9 -△Ct(sample-zSSIIb) Transformants with values between 0.5.+ -. 0.1 were calculated: 10 positive single copy RC1 maize transformants, 10 positive single copy RC2 maize transformants, 10 positive single copy RC3 maize transformants, 10 positive single copy RC4 maize transformants, 10 positive single copy RC5 maize transformantsA transformant, and 3 NGM maize transformants identified as negative in example 9, with wild-type maize plants as Control (CK); planting in a greenhouse until a silk pulling period. The results of the experiment are shown in Table 64.
TABLE 64 Experimental results of filament fed double-spotted fluorescent leaf beetles for corn transformation event
The result shows that the transgenic corn plants transferred with CX (X is 1-5) nucleotide sequences have better inhibition effect on the adult diabrotica that has the survival rate of less than 30 percent (survival rate=survival number of heads/test number of heads) on the 14 th day.
EXAMPLE 11 control Effect of dsRNA on double-spotted fluorescent diabrotica
1. Target gene MhWupA troponin I
1. dsRNA seed coating agent
(1) dsRNA solution: dsRNA 50mg/L,50mM Na 2 HPO 4 (pH 7.0), 10mM beta-mercaptoethanol, 10mM EDTA, 0.1% sodium cetyl sulfonate, 0.1% polyethylene glycol octyl phenyl ether, and H were added 2 O makes up 1L. The dsRNA was dsMhWupA troponin I-1 prepared by the method of example 2.
(2) Chitosan solution: chitosan (CAS number 9012-76-4, sigma-Aldrich) was dissolved in NaAc buffer to prepare a 0.2mg/mL chitosan solution. NaAc (CAS number 127-09-3, sigma-Aldrich) was formulated as NaAc buffer at pH 4.5,0.1mol/mL NaAc-0.1mol/mL acetate buffer.
(3) Nanocrystallized RNAi formulation: mixing 0.2mg/mL chitosan solution and dsRNA solution, enabling the volume of the chitosan solution to be 100ul/30ug based on the mass of dsRNA in the dsRNA solution, and oscillating and uniformly mixing to enable the dsRNA to be adsorbed on the surface of the chitosan, thus obtaining the nano RNAi preparation.
(4) Seed coating agent
During seed treatment, the seeds are placed in the self-sealing bags, the seed coating agent is added to enable the self-sealing bags to be filled with air, the bag openings are tightly held for shaking, the liquid medicine and the seeds are poured out after being fully and uniformly mixed, and the seeds are numbered and dried in the shade.
The seed coating agent is grouped as follows:
chitosan control group: 0.2mg/mL chitosan solution.
Drug control group: 70% imidacloprid (manufacturing enterprise: bayer crop science Chinese Co., ltd., pesticide registration number PD 20120072) and 25% thiamethoxam (manufacturing enterprise: shandong Bainong Si Dairy Biotechnology Co., ltd., pesticide registration number PD 20171923) are used, and the drug seed ratio is 600g/100kg.
Nanocrystallized RNAi formulation group: the drug control group was supplemented with 1% by volume of the nanocrystallized RNAi formulation.
Blank group: no seed coating agent was added.
Seeds treated with each group of seed coating agents were individually spot-sown in the test plots.
3 replicates per treatment, each replicate cell area of 50m 2 The investigation time is 20d after sowing, 40d after sowing and 60d after sowing, each district is sampled at random 5 points, 10 plants are counted at each point, 50 plants are counted, and the quantity of the double-spotted fluorescent leaf beetles on the corn plants is recorded.
The calculation formula of the control effect of the double-spot fluorescent leaf beetles comprises the following steps:
table 65, investigation of control effect of dsRNA seed coating agent on double-spotted fluorescent leaf beetles
The statistical results are recorded in table 65, and the results show that the prevention and treatment effects of the seed coating agent added with the nano RNAi agent on the double-spotted fluorescent leaf beetles are remarkably improved compared with the control group using the pesticide alone as the seed coating agent.
2. dsRNA liquid spray
The nano RNAi preparation in the step 1 is applied to corn plants for preventing and treating double leaf beetles in a spray mode: when the maize plant is in the silking pollination period, the nano RNAi preparation is sprayed on the tassel and the female spike of the maize plant.
Blank group: and (5) clean water.
Chitosan control group: 0.2mg/mL chitosan solution.
Drug control group: 25% thiamethoxam FS 600g/100kg (manufacturing company: shandong Bainong da Biotechnology Co., ltd., pesticide accession number PD 20171923).
RNAi agent treatment group: the nano RNAi preparation is diluted into a solution with the volume concentration of dsRNA solution of 1v/v% by using clear water.
3 replicates per treatment, each replicate cell area of 50m 2 . The control effect of 10d,20d and 30d after spraying is investigated, each district is sampled at random 5 points, 10 plants are counted at each point, 50 plants are counted, and the quantity of the double-spot fluorescent leaf beetles on the corn plants is recorded respectively. The statistics are recorded in table 66.
Table 66, investigation of the control effect of the spray of the nanocrystallized RNAi preparation on the double-spotted fluorescent leaf beetles
The result shows that the nano RNAi preparation can achieve 75% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
2. Target gene MhTPS
The procedure was followed except that dsRNA was dsMhTPS-1 prepared by the method of example 2.
Table 67, investigation of control effect of dsRNA seed coating agent on double-spotted fluorescent leaf beetles
/>
The statistical results are recorded in table 67, and the results show that the prevention and treatment effects of the seed coating agent added with the nano RNAi agent on the double-spotted fluorescent leaf beetles are remarkably improved compared with the control group using the pesticide alone as the seed coating agent.
Table 68, investigation of control effect of nanocrystallized RNAi preparation spray on double-spotted fluorescent diabrotica
The result shows that the nano RNAi preparation can achieve 83% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
3. Target gene
The procedure was followed except that dsRNA was dsMhSsj1-1 prepared by the method of example 2.
Table 69, investigation of control effect of dsRNA seed coating agent on double-spotted fluorescent leaf beetles
The statistical results are recorded in table 69, and the results show that the seed coating agent added with the nano RNAi agent has significantly improved control effect on the double-spotted fluorescent leaf beetles compared with the control group using the pesticide alone as the seed coating agent.
Table 70, investigation of control effect of nanocrystallized RNAi preparation spray on double-spotted fluorescent diabrotica
The result shows that the nano RNAi preparation can achieve 73% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
4. Target gene MhSec23A
The procedure was followed except that dsRNA was prepared using dsMhSec23A-1 as described in example 2.
TABLE 71 investigation of control effect of dsRNA seed coating agent on double-spotted fluorescent leaf beetles
The statistical results are recorded in table 71, and the results show that the prevention and treatment effects of the seed coating agent added with the nano RNAi agent on the double-spotted fluorescent leaf beetles are remarkably improved compared with the control group using the pesticide alone as the seed coating agent.
Table 72, investigation of control effect of nanocrystallized RNAi preparation spray on double-spotted fluorescent diabrotica
The result shows that the nano RNAi preparation can achieve 74% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
5. Target gene MhRfb 7
The procedure was followed except that dsRNA was dsMhRfb 7-1 prepared as described in example 2.
Table 73, investigation of control Effect of dsRNA seed coating agent on Apriona
The statistical results are recorded in table 73, and the results show that the prevention and treatment effects of the seed coating agent added with the nano RNAi agent on the double-spotted fluorescent leaf beetles are remarkably improved compared with the control group using the pesticide alone as the seed coating agent.
Table 74, investigation of control effect of nanocrystallized RNAi preparation spray on double-spotted fluorescent diabrotica
The result shows that the nano RNAi preparation can achieve 76% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
6. Target gene MhRfb 2
The procedure was followed except that dsRNA was dsMhRpb2-1 prepared by the method of example 2.
TABLE 75 investigation of control Effect of dsRNA seed coating agent on Apriona bifasciata
The results show that compared with a control group using the pesticide alone as the seed coating agent, the seed coating agent added with the nano RNAi preparation has obviously improved control effect on the double-spotted fluorescent leaf beetles.
Table 76, investigation of control Effect of nanocrystallized RNAi preparation spray on Apriona bifascus
The result shows that the nano RNAi preparation can achieve 85% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
7. Target gene MhRop
The procedure was followed except that dsRNA was prepared using dsMhRop-1 as described in example 2.
Table 77, investigation of control effect of dsRNA seed coating agent on double-spotted fluorescent leaf beetles
The results show that compared with a control group using the pesticide alone as the seed coating agent, the seed coating agent added with the nano RNAi preparation has obviously improved control effect on the double-spotted fluorescent leaf beetles.
Surface 78, investigation of prevention and treatment effects of nanocrystallized RNAi preparation spray on double-spotted fluorescent diabrotica
The result shows that the nano RNAi preparation can achieve 86% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
8. Target gene MhNcm
The procedure was followed except that dsRNA was dsMhNcm-1 prepared by the procedure of example 2.
Table 79, investigation of control effect of dsRNA seed coating agent on double-spotted fluorescent leaf beetles
The results show that compared with a control group using the pesticide alone as the seed coating agent, the seed coating agent added with the nano RNAi preparation has obviously improved control effect on the double-spotted fluorescent leaf beetles.
Table 80, investigation of the control Effect of nanocrystallized RNAi preparation spray on Apriona
The result shows that the nano RNAi preparation can achieve 81% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
9. Target gene MhMov34
The procedure was followed except that dsRNA was dsMhMov34-1 prepared as described in example 2.
Table 81, investigation of control effect of dsRNA seed coating agent on double-spotted fluorescent leaf beetles
The results show that compared with a control group using the pesticide alone as the seed coating agent, the seed coating agent added with the nano RNAi preparation has obviously improved control effect on the double-spotted fluorescent leaf beetles.
Table 82, investigation of control effect of nanocrystallized RNAi preparation spray on double-spotted fluorescent diabrotica
The result shows that the nano RNAi preparation can achieve 80% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
10. Target gene MhHb
The procedure was followed except that dsRNA was dsMhHb-1 prepared using the procedure of example 2.
Table 83, dsRNA seed coating agent investigation of control effect on double-spotted fluorescent leaf beetles
The results show that compared with a control group using the pesticide alone as the seed coating agent, the seed coating agent added with the nano RNAi preparation has obviously improved control effect on the double-spotted fluorescent leaf beetles.
Table 84, investigation of control effect of nanocrystallized RNAi preparation spray on double-spotted fluorescent diabrotica
The result shows that the nano RNAi preparation can achieve 84% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
11. Target gene MhDre4
The procedure was followed except that dsRNA was dsMhDre4-1 prepared as described in example 2.
Table 85, investigation of control effect of dsRNA seed coating agent on double-spotted fluorescent leaf beetles
The results show that compared with a control group using the pesticide alone as the seed coating agent, the seed coating agent added with the nano RNAi preparation has obviously improved control effect on the double-spotted fluorescent leaf beetles.
Surface 86, nanocrystallization RNAi preparation spray investigation of control effect on double-spotted fluorescent leaf beetles
The result shows that the nano RNAi preparation can achieve 82% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
12. Target gene MhCOPI-b
The procedure was followed except that dsRNA was prepared using the method of example 2 as dsMhCOPI-b-1.
Table 87, investigation of control Effect of dsRNA seed coating agent on Apriona bifasciata
The results show that compared with a control group using the pesticide alone as the seed coating agent, the seed coating agent added with the nano RNAi preparation has obviously improved control effect on the double-spotted fluorescent leaf beetles.
Table 88, investigation of control effect of spray of nanocrystallized RNAi preparation on double-spotted fluorescent diabrotica
The result shows that the nano RNAi preparation can achieve 77% of control effect on the diabrotica after 30d after spraying. The nano RNAi preparation spray can be used for preventing and controlling the damage of the diabrotica to the corn plants.
Finally, all materials and methods disclosed and claimed herein can be made and used as indicated by the above disclosure. Although the materials and methods of this invention have been described in terms of preferred embodiments and illustrative examples, it will be apparent to those of skill in the art that variations may be applied to the materials and methods described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Claims (10)

1. A polynucleotide sequence for controlling coleopteran pest stress in a plant, said polynucleotide sequence being a target nucleotide sequence derived from a target gene of coleopteran pest diabrotica, said target nucleotide sequence having at least 15-21 consecutive nucleotides of the target gene nucleotide sequence or its complement;
the target gene is one of the following: (1) The nucleotide sequence of the troponin I coding gene is shown as SEQ ID NO. 1; (2) The coding gene of trehalose synthase has a nucleotide sequence shown as SEQ ID NO. 10; (3) The encoding gene of the diaphragm joint protein has a nucleotide sequence shown as SEQ ID NO. 20; (4) The nucleotide sequence of the voxel protein Sec23A coding gene is shown as SEQ ID NO. 27; (5) The nucleotide sequence of the coding gene of the subunit RPB7 of the RNA polymerase II is shown as SEQ ID NO. 37; (6) The nucleotide sequence of the coding gene of the subunit II of the RNA polymerase is shown as SEQ ID NO. 44; (7) The nucleotide sequence of the ROP protein coding gene is shown as SEQ ID NO. 54; (8) The nucleotide sequence of the coding gene of the precursor mRNA shear factor is shown as SEQ ID NO. 64; (9) The nucleotide sequence of the coding gene of the 26S proteasome is shown as SEQ ID NO. 74; (10) The nucleotide sequence of the insect gap gene hunchback is shown as SEQ ID NO. 83; (11) The nucleotide sequence of the coding gene of the FACT complex subunit is shown as SEQ ID NO. 93; (12) The nucleotide sequence of the coding gene COPI-b of the COPI sleeve voxel subunit beta is shown as SEQ ID NO. 103.
2. The polynucleotide sequence of claim 1, wherein when the target gene is a troponin I encoding gene, the polynucleotide sequence is set forth in one of SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6;
when the target gene is a trehalose synthase encoding gene, the polynucleotide sequence is shown as one of SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15 or SEQ ID NO. 16;
when the target gene is a diaphragm joint protein coding gene, the polynucleotide sequence is shown as one of SEQ ID NO. 22 and SEQ ID NO. 23;
when the target gene is a set voxel protein Sec23A coding gene, the polynucleotide sequence is shown as one of SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32 or SEQ ID NO. 33;
when the target gene is the coding gene of the RNA polymerase II subunit RPB7, the polynucleotide sequence is shown as one of SEQ ID NO. 39 and SEQ ID NO. 40;
when the target gene is the coding gene of RNA polymerase II subunit, the polynucleotide sequence is shown as one of SEQ ID NO. 46, SEQ ID NO. 47, SEQ ID NO. 48, SEQ ID NO. 49 and SEQ ID NO. 50;
when the target gene is the ROP protein coding gene, the polynucleotide sequence is shown as one of SEQ ID NO. 56, SEQ ID NO. 57, SEQ ID NO. 58, SEQ ID NO. 59 and SEQ ID NO. 60;
When the target gene is the coding gene of the precursor mRNA shearing factor, the polynucleotide sequence is shown as one of SEQ ID NO. 66, SEQ ID NO. 67, SEQ ID NO. 68, SEQ ID NO. 69 and SEQ ID NO. 70;
when the target gene is the coding gene of the 6S proteasome, the polynucleotide sequence is shown as one of SEQ ID NO. 76, SEQ ID NO. 77, SEQ ID NO. 78 and SEQ ID NO. 79;
when the target gene is insect gap gene hunchback, the polynucleotide sequence is shown as one of SEQ ID NO. 85, SEQ ID NO. 86, SEQ ID NO. 87, SEQ ID NO. 88 and SEQ ID NO. 89;
when the target gene is the coding gene of FACT complex subunit, the polynucleotide sequence is shown as one of SEQ ID NO. 95, SEQ ID NO. 96, SEQ ID NO. 97, SEQ ID NO. 98 and SEQ ID NO. 99;
when the target gene is a coding gene COPI-b of COPI sleeve voxel subunit beta, the polynucleotide sequence is shown as one of SEQ ID NO. 105, SEQ ID NO. 106, SEQ ID NO. 107, SEQ ID NO. 108 and SEQ ID NO. 109.
3. A dsRNA expression cassette of the polynucleotide sequence of claim 1, wherein said dsRNA expression cassette is a promoter, a polynucleotide sequence, a spacer sequence, a sequence complementary to a polynucleotide sequence, a sequence operably linked to a terminator; the interval sequence is shown as SEQ ID NO. 114; the promoter is a figwort mosaic virus 35S promoter, and the nucleotide sequence is shown as SEQ ID NO. 113; the terminator is a terminator of nopaline synthase gene, and the nucleotide sequence is shown as SEQ ID NO. 115.
4. A plant expression vector constructed from the dsRNA expression cassette of claim 3.
5. The plant expression vector of claim 4, wherein the plant expression vector comprises a G10-2 expression cassette, the G10-2 expression cassette comprising a promoter, a signal peptide, a G10-2 gene, a terminator; the promoter is yellow leaf curly virus promoter pCmYLCV, and the nucleotide sequence is shown as SEQ ID NO. 116; the signal peptide is corn chloroplast signal peptide sp, and the nucleotide sequence is shown as SEQ ID NO. 117; the G10-2 gene is a 5-enolpyruvylshikimate-3-phosphate synthase gene, and the nucleotide sequence is shown as SEQ ID NO. 118; the terminator is a polyadenylation signal, and the nucleotide sequence is shown as SEQ ID NO. 119.
6. Use of the polynucleotide sequence of claim 1 in the preparation of a formulation that interferes with expression of a target gene of a plant coleopteran pest or inhibits growth of a plant coleopteran pest.
7. The use of claim 6, wherein the agent comprises interfering ribonucleic acids of a polynucleotide sequence, the interfering ribonucleic acids comprising at least one silencing element that is a double stranded RNA region comprising annealed complementary strands, wherein one strand comprises or consists of a nucleotide sequence that is at least partially complementary to a polynucleotide sequence.
8. A composition for controlling a coleopteran pest prepared from the polynucleotide sequence of claim 1, said composition comprising an interfering ribonucleic acid sequence capable of silencing the polynucleotide sequence of claim 1.
9. The use of claim 8, wherein the interfering ribonucleic acid sequence comprises dsRNA and the composition comprises a dsRNA activity enhancer, an insecticide, an agriculturally acceptable carrier.
10. Use of the polynucleotide sequence of claim 1 in the preparation of a plant having increased resistance to coleopteran pests.
CN202311272554.2A 2023-09-28 2023-09-28 Polynucleotide sequence for controlling coleopteran pest stress of plants and application Pending CN117535289A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311272554.2A CN117535289A (en) 2023-09-28 2023-09-28 Polynucleotide sequence for controlling coleopteran pest stress of plants and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311272554.2A CN117535289A (en) 2023-09-28 2023-09-28 Polynucleotide sequence for controlling coleopteran pest stress of plants and application

Publications (1)

Publication Number Publication Date
CN117535289A true CN117535289A (en) 2024-02-09

Family

ID=89788745

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311272554.2A Pending CN117535289A (en) 2023-09-28 2023-09-28 Polynucleotide sequence for controlling coleopteran pest stress of plants and application

Country Status (1)

Country Link
CN (1) CN117535289A (en)

Similar Documents

Publication Publication Date Title
ES2750007T3 (en) Downregulation of gene expression in insect pests
US20140143906A1 (en) Method for improving plant resistance to insects
KR20160014762A (en) Novel pest control methods
JP2017515474A (en) SEC23 nucleic acid molecules that confer resistance to Coleoptera and Hemiptera pests
CN105543224B (en) Nucleotide sequences and methods for controlling insect infestation
CN110669762B (en) Nucleotide sequences and methods for controlling insect infestation
WO2015070765A1 (en) Rnai-based pest control method using irrigation, and application thereof
CN107603984B (en) Nucleotide sequences and methods for controlling insect infestation
US10246710B2 (en) Double strand RNA as molecular biopesticides for RNA interference through feeding in the hemipteran invasive insect pest, brown marmorated stink bug
CN110669761B (en) Nucleotide sequences and methods for controlling insect infestation
CN110551718B (en) Nucleotide sequences and methods for controlling insect infestation
CN117535289A (en) Polynucleotide sequence for controlling coleopteran pest stress of plants and application
CN110669760B (en) Nucleotide sequences and methods for controlling insect infestation
RU2775717C1 (en) Polynucleotide and method used to control an insect outbreak
RU2775943C1 (en) Polynucleotide and method for control of insect infestation
RU2781829C2 (en) Polynucleotide and method for control of insect infestation
CN116426541B (en) Target gene segment, dsRNA and nano pesticide composition for preventing and treating verticillium wilt of crops
CN107893079B (en) Polynucleotide sequence composition for controlling pests
KR20170105006A (en) Parental rnai suppression of kruppel gene to control hemipteran pests
JP2017530709A (en) GHO / SEC24B2 and SEC24B1 nucleic acid molecules for controlling Coleoptera and Hemiptera pests
CN116200383A (en) Nucleotide sequence and method for controlling plant pest stress
CN115074360A (en) RNAi (ribonucleic acid interfere) insecticidal target effective for vegetable pest flea beetles and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination