RU2775943C1 - Polynucleotide and method for control of insect infestation - Google Patents

Abstract

FIELD: biochemistry.

SUBSTANCE: invention relates to the field of biochemistry, in particular to isolated polynucleotide for the inhibition of growth of Monolepta hieroglyphica insect pest. Ribonucleic acid, a composition, an expression cassette, and an expression vector containing the specified polynucleotide are also disclosed. The use of the specified polynucleotide for the suppression of infestation of Monolepta hieroglyphica insect pest, a method for the suppression of infestation of Monolepta hieroglyphica insect pest, and a method for increasing the plant resistance to Monolepta hieroglyphica insect, using the specified polynucleotide, are disclosed.

EFFECT: invention allows for effectively combating Monolepta hieroglyphica insect pest.

15 cl, 2 dwg, 5 tbl, 12 ex

Description

Field of invention

The present invention relates to the field of plant protection, especially crop protection. In particular, the present invention relates to a polynucleotide and a method for controlling insect infestations, especially a method for controlling infestations of Monolepta hieroglyphics (Motschulsky) by reducing or suppressing the expression of a target sequence in the body of Monolepta hieroglyphica (Motschulsky) using RNAi technology ( RNA interference).

Prior Art

Agricultural crops are commonly targeted by insect attacks. Over the past few decades, significant advances have been made in the development of more effective methods and compositions for controlling insect infestations in crops. For example, chemical pesticides, microbial pesticides, and genetic engineering techniques have been used to control pest infestations.

Chemical pesticides are a relatively effective means of controlling pest infestations. However, the use of chemical pesticides also has many disadvantages. First, chemical pesticides are non-selective, and because people tend to use chemical pesticides to control insects that are harmful to many crops and other plants, chemical pesticides also harm non-target organisms such as earthworms due to their lack of selectivity. Also, after applying chemical pesticides for a period of time, the field usually becomes barren. Chemical pesticides will be constantly present in the environment and will usually be slowly metabolized. This slow metabolism results in chemical pesticide residues in crops and the environment, which will accumulate in the food chain, especially in the food chain of higher carnivores. The accumulation of these chemical pesticides leads to causing diseases in higher species, such as cancer in humans. Thus, there is a strong need for an environmentally friendly method to control or eliminate insect infestations in crop production, namely a selective, environmentally friendly method with biodegradability, which can also be successfully used in a pest resistance management system.

Over the past few decades, the development of an effective way to control insect pests of plants has made significant progress. Chemical pesticides are very effective in killing plant pests; however, these pesticides also act on non-target insects, and in addition, chemical pesticides are constantly present in the environment, which not only causes irreversible pollution of the environment, but also leads to the emergence of drug-resistant insects. Microbial pesticides, in particular pesticides derived from the strain of Bacillus thuringiensis (abbreviated as Bt), play an important role in agricultural production as a substitute for chemical pesticides and have certain insecticidal activity against insects, including Lepidoptera, Diptera, Coleoptera, etc. However, microbial pesticides have relatively high requirements for pesticide application conditions, and if these conditions are not suitable for the growth of these microorganisms, it is necessary to re-apply during cultivation, and in some cases, even re-application cannot achieve the goal of control. over pests, significantly increasing, as a result, production costs. Some transgenic plants that have increased resistance to pests can be obtained by introducing one or more genes encoding Bt insecticidal proteins into plants through genetic engineering, for example, genetically engineered corn and cotton plants capable of producing Cry toxins are widely used in agricultural manufactured in the USA and provide farmers with a solution that is an alternative to traditional methods of pest control. However, currently developed transgenic crops containing Cry toxins can only be used to prevent and control a narrow range of Coleoptera pests such as corn root beetle and Colorado potato beetle. However, there is no relevant report on the use of Cry toxins to control Monolepta hieroglyphica (Motschulsky), one of the main pests of corn. Meanwhile, Monolepta hieroglyphica (Motschulsky) is present in the soil in the form of eggs throughout the winter, and in June of the following year, the larvae hatched from these eggs also actively move in the soil. Due to the widespread popularity in recent years of measures to return straw to the field, every year it is more and more difficult to control Monolepta hieroglyphica (Motschulsky) through the use of chemical pesticides. In particular, in late July and early August, when adult Monolepta hieroglyphica (Motschulsky) insects emerge from the ground and corn grows to a certain height, it is more difficult to control adult insects through the use of chemical pesticides.

RNA interference or RNAi is a method of down-regulating gene expression in a sequence-specific manner in a cell or throughout an organism, in which the goal of targeting gene expression can be achieved by selecting a specific target and effectively repressing the mRNA. While it is known in the art that RNAi technology can be used to prevent and control pests, since there are many types of insects, this technology not only differs in its vastly different effects on different insects, and a key factor for using such a technique as a measure to control insect infestations, it additionally consists in selecting the most suitable target gene, namely the gene whose function will be lost, thus leading to a serious disruption of vital biological processes and/or death of organisms. Thus, the present invention achieves control of insect infestations, in particular control of insect infestations in a plant, by down-regulating a particular target gene in the pest.

Brief summary of the invention

The purpose of the present invention is to provide a polynucleotide and a method for controlling insect infestations, namely down-regulating target gene expression using RNAi technology by impairing the ability of an insect to survive, grow, reproduce, colonize in a particular environment and/or infect a host, thereby to control insect infestations and the damage they cause.

In order to achieve the above object, the present invention proposes the following technical solutions.

In one aspect, the present invention provides an isolated polynucleotide which is selected from:

(a) a polynucleotide sequence as shown in SEQ ID NO: 1; or

(b) a polynucleotide sequence of at least 15 consecutive nucleotides of SEQ ID NO: 1, wherein a double-stranded RNA containing at least one strand complementary to the polynucleotide sequence, when ingested by an insect pest of the order Coleoptera (Coleoptera), inhibits the growth of that insect pest order Coleoptera; or

(c) a polynucleotide sequence of at least 17 consecutive nucleotides of SEQ ID NO: 1, wherein the double-stranded RNA comprising at least one strand complementary to the polynucleotide sequence, when ingested by an insect pest of the order Coleoptera, inhibits the growth of that insect pest of the order Coleoptera; or

(d) a polynucleotide sequence of at least 19 consecutive nucleotides of SEQ ID NO: 1, wherein the double-stranded RNA comprising at least one strand complementary to the polynucleotide sequence, when ingested by an insect pest of the order Coleoptera, inhibits the growth of that insect pest of the order Coleoptera; or

(e) a polynucleotide sequence of at least 21 consecutive nucleotides of SEQ ID NO: 1, wherein the double-stranded RNA comprising at least one strand complementary to the polynucleotide sequence, when ingested by an insect pest of the order Coleoptera, inhibits the growth of that insect pest of the order Coleoptera; or

(f) any of the polynucleotide sequences as shown in SEQ ID NO: 3 - SEQ ID NO: 6; or

(g) a polynucleotide sequence that hybridizes to or is complementary to a polynucleotide sequence as defined in any of (a)-(f) above, under stringent conditions.

Preferably, the polynucleotide also contains a complementary sequence to the polynucleotide sequence.

More preferably, the polynucleotide sequence also contains a spacer sequence.

Most preferably, the spacer sequence is SEQ ID NO: 9.

Based on the technical solutions mentioned above, the insect pest of the order Coleoptera is Monolepta hieroglyphica (Motschulsky).

In yet another aspect, the present invention provides an expression cassette comprising a polynucleotide sequence under the control of an effectively linked regulatory sequence.

In yet another aspect, the present invention provides a recombinant vector containing a polynucleotide sequence or an expression cassette.

In yet another aspect, the present invention also provides the use of a polynucleotide sequence to prevent the expression of a target sequence in an insect pest of the order Coleoptera or to inhibit the growth of an insect pest of the order Coleoptera.

In yet another aspect, the present invention also provides an interfering ribonucleic acid, wherein the interfering ribonucleic acid acts to down-regulate the expression of at least one target gene in an insect pest of the order Coleoptera after ingestion by the insect pest, wherein the interfering ribonucleic acid comprises at least one silencer, where the silencer is a region of double-stranded RNA containing complementary strands that have been annealed, and of which one strand contains or consists of a nucleotide sequence at least partially complementary to the target sequence within the target gene, and the gene -target contains a polynucleotide sequence.

Preferably, the silencer element comprises or consists of a sequence of at least 15 consecutive nucleotides that is complementary or at least partially complementary to a target fragment within the target sequence.

Preferably, the silencer element comprises or consists of a sequence of at least 17 consecutive nucleotides that is complementary or at least partially complementary to a target fragment within the target sequence.

Preferably, the silencer element comprises or consists of a sequence of at least 19 consecutive nucleotides that is complementary or at least partially complementary to a target fragment within the target sequence.

Preferably, the silencer element comprises or consists of a sequence of at least 21 consecutive nucleotides that is complementary or at least partially complementary to a target fragment within the target sequence.

Optionally, the interfering ribonucleic acid contains at least two silencers, each of which contains or consists of a nucleotide sequence at least partially complementary to the target sequence within the target gene.

Preferably, each of the silencers contains or consists of a different nucleotide sequence that is complementary to a different target sequence.

More preferably, the different target sequence is from the same target gene or from a different target gene from the target gene.

Even more preferably, the target gene other than the target gene is from the same insect pest of the order Coleoptera or another insect pest of the order Coleoptera.

Most preferably, the insect pest of the order Coleoptera is Monolepta hieroglyphica (Motschulsky).

Based on the technical solutions mentioned above, the interfering ribonucleic acid also contains a spacer sequence.

In particular, the spacer sequence is SEQ ID NO: 9.

In yet another aspect, the present invention also provides a composition for controlling an infestation of the Coleoptera insect pest, comprising at least one interfering ribonucleic acid and at least one suitable carrier, adjuvant or diluent.

Preferably, the composition comprises a host cell expressing or capable of expressing an interfering ribonucleic acid. In particular, the host cell is a bacterial cell.

More preferably, the composition is a solid, liquid or gel. In particular, the composition is an insecticidal spray.

Optionally, the composition also contains at least one pesticide, where the pesticide is a chemical pesticide, a potato tuber specific protein, a Bacillus thuringiensis insecticidal protein, a Xenorhabdus ehlersii insecticidal protein, a Photorhabdus insecticidal protein, a Bacillus laterosporus insecticidal protein, or a Bacillus sphaericus insecticidal protein.

In yet another aspect, the present invention also provides the use of a composition for controlling a Coleoptera pest infestation to prevent and/or control an infestation of a Coleoptera insect pest.

Preferably, the insect pest of the order Coleoptera is Monolepta hieroglyphica (Motschulsky).

In yet another aspect, the present invention also provides a method for controlling a Coleoptera pest infestation, comprising contacting the Coleoptera pest with an effective amount of at least one of the interfering ribonucleic acid sequences.

In yet another aspect, the present invention also provides a method for increasing the resistance of a plant to an insect pest of the order Coleoptera, comprising introducing into the plant a polynucleotide, an expression cassette, a recombinant vector, or a construct containing an interfering ribonucleic acid.

In another aspect, the present invention also provides a method for producing a plant capable of controlling an insect pest of the order Coleoptera, comprising introducing into the plant a polynucleotide, an expression cassette, a recombinant vector, or a construct containing an interfering ribonucleic acid.

In another aspect, the present invention also provides a method for protecting a plant from damage caused by an insect pest of the Coleoptera order, comprising introducing into a plant a polynucleotide, an expression cassette, a recombinant vector or a construct containing an interfering ribonucleic acid, and the plant into which said introduction is carried out, has an inhibitory effect on the growth of an insect pest of the Coleoptera order when this plant is absorbed by an insect pest of the Coleoptera order.

Based on the technical solutions mentioned above, the plant is soybean, wheat, barley, corn, tobacco, rice, rapeseed, cotton or sunflowers. The present invention includes a method for regulating or inhibiting the expression of one or more target genes in an insect pest of the order Coleoptera, and includes: introducing a portion or all of a stabilized double-stranded RNA (such as dsRNA) or a modified form thereof (such as a sequence of small interfering RNAs) into the cell of an invertebrate pest or its extracellular environment. In the body of an insect, dsRNA or siRNA enters the cell, inhibits the expression of at least one or more target genes, and such inhibition leads to a weakening of the insect's ability to survive, grow, reproduce, and attack the host.

The present invention provides an isolated and purified polynucleotide having the sequence as shown in SEQ ID NO: 1. The present invention also provides any RNA expressed by a polynucleotide, including dsRNA. In addition, the present invention provides a stabilized double-stranded RNA molecule for inhibiting the expression of a target sequence in a pest of the order Coleoptera. The stabilized double-stranded RNA contains at least two coding sequences that are located in the sense and antisense directions relative to at least one promoter, where the nucleotide sequences containing the sense strand and the antisense strand are connected or linked by a spacer sequence of at least about 5-1000 nucleotides , where the sense strand and the antisense strand can be of different lengths, and where at least one of the two given coding sequences has at least 80%, at least 90%, at least 95%, at least 98% noah or 100% sequence identity with any nucleotide sequence shown in SEQ ID NO: 1.

When expressed as dsRNA and administered to a pest, a fragment can be defined as a fragment that results in death and inhibition, retardation, or interruption of the pest's feeding activity. A fragment may, for example, contain at least about 19, 21, 23, 25, 40, 60, 80, 100, 125 or more consecutive nucleotides, or from about 19 to about 100 nucleotides or more of any one or more sequences of SEQ ID NO: 1 or its complementary sequences, such as SEQ ID NO: 3 - SEQ ID NO: 6. Particularly useful is a dsRNA sequence containing about 19-300 nucleotides homologous to the pest target sequence. The present invention also provides an RNA expressed by any of the polynucleotide sequences, including dsRNA. The sequence selected for the expression of a gene inhibitor and for the expression of an RNA that inhibits one gene or family of genes in one or more target pests may be constructed using a single sequence from one or more target pests, or the DNA sequence may be designed as a chimera from a plurality of DNA sequences.

The plant in the present invention may include any plant propagation or reproduction material and may also include a plant cell, a plant protoplast, a plant tissue culture, a plant callus, and an intact plant cell in a plant or parts thereof, where these plant parts are, for example, embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, pits, spikelets, cobs, sheaths, stems, roots or root hairs.

Monolepta hieroglyphica (Motschulsky) in the present invention is a fully metamorphosed Galeruca insect belonging to the Coleoptera family Chrysomelidae. Its eggs, larvae and pupae live in the soil, and adult insects will fly out of the soil after hatching. It produces one generation a year and overwinters as dormant eggs that begin to hatch in May each year; larvae can be observed in the soil on the field from May to early July; pupae can often be observed in the field from late June to mid-July; adult insects after emergence usually fly to fields of corn, soybeans or other plants, causing harm in mid-July; the period of maximum occurrence is the end of July - the beginning of August. Adult insects will be ready to lay eggs about 15 days after they emerge. The laying period lasts for about 1 month.

The larvae of Monolepta hieroglyphica (Motschulsky) feed mainly on the roots of agricultural crops in the arable field, and thus the damage thus caused cannot be seen above ground level; in mid-July every year, their adult insects can be found damaging the leaves in corn and soybean fields; from late July to early August, large numbers of adult insects damage stigma corn bollards by biting off stigma corn bollards and severely disrupt pollination resulting in pointed and fusiform cobs and thus lower corn yields. Then, adult Monolepta hieroglyphica (Motschulsky) insects will migrate to soybean fields to feed on soybean leaves, or to nearby vegetable fields, damaging vegetables. The area affected by corn caused by Monolepta hieroglyphica (Motschulsky) from 2009 to 2016 in China was doubled from 16 million mu (i.e. approximately 1.07 million hectares) to 40 million mu (i.e. approximately 2.67 million hectares), and affected areas have spread from the Northwest to major corn growing areas such as Northeast and North China.

Meanwhile, with the continuous improvement of measures to return the straw to the field, the humus in the fields and the substances covering the soil surface are more and more enriched and accumulated, and thus it is more difficult to apply pesticides to the soil, and control Monolepta hieroglyphica (Motschulsky) also becomes more problematic. In other words, the return of straw to the field, which provides natural shelter for Monolepta hieroglyphica (Motschulsky) larvae, can lead to a much higher survival rate of Monolepta hieroglyphica (Motschulsky) larvae, which consequently leads to a higher population density of Monolepta hieroglyphica insects ( Motschulsky). Adult insects Monolepta hieroglyphica (Motschulsky), as insects that can fly and jump adeptly, will start damaging corn in mid to late July after emergence, when the corn is growing at the pistil stage. In this case, the corn has grown to a certain height; and the application of pesticides is becoming more difficult and likely to lead to the unfortunate tragedy of accidentally harming the person who applies them. In addition, non-selective insecticidal action can harm crops and non-target organisms. In addition, chemical pesticides can have a cumulative effect in the human body, becoming mutagens or carcinogens. Thus, there is a need to find an accurate and environmentally sound method that can be used simply and easily by the farmer to control the damage caused by Monolepta hieroglyphica (Motschulsky). Through the use of genetic modification, crops can have a certain insecticidal efficacy against pests throughout their growing season, and whole plants are protected throughout their growing season. To solve the above problem, the best solution is to adopt a method of controlling Monolepta hieroglyphica (Motschulsky) through the use of RNAi-based genetic modification agents in such a way that maize has full control of the whole plant throughout the growing season.

The expression "insect control" or "pest control" in the present invention means any effect on an insect that can lead to limiting the harm caused by this insect, including, but not limited to the destruction of the insect, inhibition of insect development, alteration of fertility, or growing the insect so that the insect can only cause less damage to the plant, by reducing the number of offspring the insect produces, by producing fewer healthy insects, by producing insects that are more easily attacked by predators, or by preventing insects from eating the plants.

The expression "target gene" in the present invention means any sequence to be down-regulated in an insect. Insect infestations are controlled by down-regulating the target gene, for example by disrupting essential biological processes in insects. As a result, preferred target genes include, but are not limited to, those playing vital roles in regulating feeding activity, survival, growth, development, reproduction, invasion, and infection. When the expression of the target gene is down-regulated or inhibited, at least 30% of the insects are killed; or growth of at least 30% of insects is prevented/slowed/inhibited/delayed/blocked, reproduction of at least 30% of insects is prevented, and transformation into at least 30% of insects during their life cycle is prevented; or the damage caused by these insects and/or the ability of insects to infect or infect the environment, surface and/or plants or crop species is reduced; or at least 30% of the insects are no longer fed from their natural food sources (such as a plant and plant product). These target genes may be expressed in all or part of the cells of the insect. In addition, these target genes can only be expressed at a particular stage in the life cycle of insects, such as the adult stage, the larval stage, or the egg stage.

In the present invention, the term "pest" is preferably an insect that causes plant invasion/plant damage/plant infection and belongs to Coleoptera, preferably Monolepta hieroglyphica (Motschulsky). The terms "defeat", "infection" and/or "invasion" can usually be used interchangeably throughout the document.

The term "RNA interference (RNAi)" in the present invention means some RNA that can highly effectively and specifically block the expression of a particular gene in vivo, stimulate mRNA degradation, and cause a cell to exhibit a deletion phenotype of a particular gene; this technology is also called RNA interference or interference. RNA interference is a highly specific gene silencing mechanism at the mRNA level.

The term "nucleic acid" in the present invention means a single-stranded or double-stranded polymer of deoxyribonucleic acid or ribonucleic acid bases, read from the 5' end to the 3' end. Possibly, the term "nucleic acid" may also include non-naturally occurring bases or altered bases that allow correct reading by the polymerase and will not reduce the level of expression of the polypeptide encoded by the nucleic acid. The term "nucleotide sequence" means the sense strand and the antisense strand of a nucleic acid present as separate single strands or present in a dimer. The term "ribonucleic acid" (RNA) includes RNAi (RNA interference), dsRNA (double-stranded RNA), miRNA (small interfering RNA), mRNA (messenger RNA), miRNA (miRNA), tRNA (transfer RNA, loaded with or without appropriate acylated amino acids) and cDNA and genomic DNA, as well as DNA-RNA hybrids. One skilled in the art will understand that the term "nucleic acid fragment", "nucleic acid sequence fragment", or the more commonly known term "fragment" includes a genomic sequence, a ribosomal RNA sequence, a transfer RNA sequence, a messenger RNA sequence, an operon sequence, and a smaller an engineered nucleotide sequence, wherein these sequences express or can be engineered to express a protein, polypeptide, or peptide.

The term "interfering ribonucleic acid" as used herein encompasses any type of RNA molecule capable of down-regulating or "silencing" the expression of a target sequence, including sense RNA, antisense RNA, siRNA, miRNA, dsRNA, hairpin RNA (ssRNA), and the like. , but not limited to them. Methods for measuring functional interfering RNA molecules are well known in the art and disclosed.

The interfering ribonucleic acid of the present invention achieves specific downregulation of the expression of a target gene by binding to a target sequence within the target gene. Binding is caused by base pairing between complementary regions of the interfering RNA and the target sequence.

The present invention encompasses nucleic acid molecules or fragments thereof that hybridize (in particular hybridize specifically) with a polynucleotide according to the present invention under "stringent conditions". As known to the person skilled in the art, nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. In the present invention, if two nucleic acid molecules can form an antiparallel double stranded nucleic acid structure, it can be determined that the two molecules can specifically hybridize with each other. If two nucleic acid molecules are completely complementary, one of these two molecules is called the "complement" of the other molecule. In the present invention, when each nucleotide of a nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, it is identified that the two molecules are "fully complementary". If two nucleic acid molecules can hybridize with each other with sufficient stability such that they can anneal and bind to each other under at least normal "low stringency" conditions, the two nucleic acids are identified as "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with each other with sufficient stability such that they can anneal and bind to each other under normal "high stringency" conditions, the two nucleic acids are identified as "complementary". Deviation from "fully complementary" may be acceptable, provided that the deviation does not completely prevent the two molecules from forming a double-stranded structure. A nucleic acid molecule that can be used as a primer or probe must have sequences that are sufficiently complementary to form a stable double-stranded structure in a particular solvent at a particular salt concentration. In the present invention, a substantially homologous sequence refers to a nucleic acid molecule that can specifically hybridize to the complementary strand of another corresponding nucleic acid molecule under "highly stringent" conditions. Stringent conditions for DNA hybridization are well known to those skilled in the art, such as treatment with 6.0× sodium chloride/sodium citrate (SSC) at about 45°C and washing with 2.0×SSC at 50°C. For example, the salt concentration in the wash step is selected from 2.0xSSC and 50°C for "low stringency" conditions and 0.2xSSC and 50°C for "high stringency" conditions. In addition, the temperature during the washing step is in the range from about 22°C in the case of "low-stringent" conditions to about 65°C in the case of "high-stringent" conditions. Both temperature and salt concentration can vary simultaneously, or one of them can remain constant while the other variable changes. Preferably, the polynucleotide of the present invention hybridizes specifically in 6.0×SSC and 0.5% SDS (sodium dodecyl sulphate) at 65°C under "high-stringency" conditions; the membrane is then washed once with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS, respectively.

The term "silencing element" refers to a portion or region of an interfering ribonucleic acid containing or consisting of a nucleotide sequence that is complementary or at least partially complementary to a target sequence within a target gene, where the portion or region acts as an active part of the interfering ribonucleic acid in a manner to direct downregulation of target gene expression. Silencing element contains a sequence having at least 15 consecutive nucleotides, preferably at least 18 or 19 consecutive nucleotides, more preferably at least 21 consecutive nucleotides, and even more preferably at least 22, 23, 24 or 25 consecutive nucleotides, complementary to the sequence -targets within the target gene; or interfering ribonucleic acid consisting of them.

The term "target gene expression" in the present invention refers to the transcription and accumulation of RNA transcripts encoded by the target gene and/or translation of mRNA into protein.

The term "down regulation" refers to any of the methods known in the art, by which an interfering ribonucleic acid reduces the level of the primary RNA transcript, mRNA, or protein derived from a target gene. Down regulation refers to a situation in which the level of RNA or proteins produced from a gene is reduced by at least 10%, preferably at least 33%, more preferably at least 50%, and even more preferably at least 80%. %. Specifically, downregulation refers to a decrease in the level of RNA or proteins produced from a gene in an insect cell by at least 80%, preferably at least 90%, more preferably at least 95%, and most preferably at least 99%. %, compared to an appropriately controlled insect (eg, an insect that has not been exposed to interfering ribonucleic acid or has been exposed to a control interfering ribonucleic acid). Methods for detecting a decrease in RNA and protein levels are well known in the art and include RNA hybridization in solution, Northern blot hybridization, reverse transcription (e.g., quantitative RT-PCR (reverse transcription PCR)), microarray, antibody binding, solid phase enzyme-linked immunosorbent assay (ELISA) and Western blotting. Meanwhile, down regulation may also mean that, compared to a suitable insect control, the level of RNA or proteins is reduced to a level sufficient to result in an insect phenotype that generates a detectable change, e.g., cell death, stunting, etc. .P. Thus, downregulation can be measured by analyzing the insect's phenotype using conventional techniques in the art.

The expression "inhibition of target gene expression" in the present invention refers to a decrease or absence (below the detection threshold) of the level of proteins and/or mRNA product of the target gene. Specificity refers to the ability to inhibit a target gene and not affect other genes in the cell, and not affect any gene in the cell to form dsRNA molecules.

"Sense" RNA in the present invention refers to an RNA transcript corresponding to a sequence or fragment present as mRNA that can be translated into a protein by a plant cell. "Antisense" RNA in the present invention refers to RNA that is complementary to all or part of the mRNA produced in a plant under normal conditions. The complementarity of the antisense RNA can be directed to any part of the transcript of a particular gene, namely a 5' non-coding sequence, a 3' non-coding sequence, an intron, or a coding sequence. The term "RNA transcript" in the present invention refers to a product obtained by transcription catalyzed by an RNA polymerase carried out on a DNA sequence. When an RNA transcript is a fully complementary copy of a DNA sequence, that RNA transcript is called a primary transcript, or is the RNA resulting from the post-transcriptional processing of the primary transcript, which is called mature RNA.

The interfering ribonucleic acid in the present invention down-regulates gene expression via RNA interference or RNAi. RNAi is a typical technique for sequence-specific regulation of gene expression mediated by a double-stranded RNA molecule (such as siRNA). miRNA contains a sense RNA strand annealed to an antisense RNA strand by complementary base pairing. The sense strand or "leading strand" in an miRNA molecule contains a nucleotide sequence that is complementary to the nucleotide sequence located within the target gene's RNA transcript. Thus, the siRNA sense strand can be annealed to the RNA transcript by Watson and Crick base pairing and targeted to the RNA in such a way that the RNA is degraded in a cellular complex called the RNAi-Induced Gene Shutdown Complex or RISC (RNAi induced silencing complex). In the case of a preferred interfering ribonucleic acid in the present invention, the silencer element may be a double-stranded region containing annealed complementary strands, of which at least one strand contains a nucleotide strand that is complementary or at least partially complementary to a target sequence in the target gene; or contains an interfering ribonucleic acid composed of them. The double-stranded region is at least about 15 to about 25 base pairs long, or about 25 to about 100 base pairs long, or even about 3000 base pairs long.

The dsRNA molecule in the present invention can serve as a precursor for active miRNA molecules that direct RNA transcripts to the RISC complex for subsequent degradation. A dsRNA molecule found in an organism or its cellular environment can be taken up by the organism and processed by an enzyme known as DICER to produce an siRNA molecule. Possibly, the dsRNA molecule can be produced in vivo, namely one or more dsRNA-encoding polynucleotides residing in a cell (e.g. bacterial cell or plant cell) are transcribed and processed by DICER in a host cell or preferably in an insect cell after uptake of a longer dsRNA precursor. dsRNA can be formed by two separate (sense and antisense) annealed RNA strands through complementary base pairing. Alternatively, the dsRNA may be a single strand that refolds to form a hairpin RNA or stem-loop structure. In the case of a single RNA, a double-stranded region or "stalk" is formed by two regions or segments of RNA, where these regions or segments are essentially sequences of inverted repeats for each other and have sufficient complementarity to ensure the formation of a double-stranded region. One or more functional double-stranded silencers may reside in a given "stem region" of the molecule. Regions of inverted repeats are usually separated by a region or segment called the "loop" region in RNA. This region may contain any nucleotide sequence that confers sufficient flexibility to allow self-pairing between flanking complementary RNA regions and, in general, the loop region is essentially single stranded and serves as a spacer region between inverted repeat sequences.

The interfering ribonucleic acid of the present invention comprises at least one double-stranded region, typically a silencing element of the interfering ribonucleic acid, which contains an RNA sense strand annealed to an antisense RNA strand by complementary base pairing, wherein the sense strand of the dsRNA molecule contains a nucleotide sequence that is complementary to the nucleotide sequence located in the RNA transcript of the target gene. The silencer, or at least one strand thereof (when the silencer is double-stranded), may be fully or partially complementary to the target sequence of the target gene. The term "fully complementary" means that all bases of the nucleotide sequence of the silencer element are complementary or "correspond" to the bases of the target sequence. The term "at least partially complementary" refers to less than 100% of the degree of correspondence that exists between the bases of the silencer element and the bases of the target sequence. One skilled in the art will appreciate that in order to mediate down regulation of target gene expression, the silencer element must be only at least partially complementary to the target sequence. It is known in the art that an RNA sequence having an insert, a deletion and a mismatch relative to a target gene can still be RNAi efficient. Preferably, the silencer and the target gene sequence have at least 80% or 85% sequence identity, preferably at least 90% or 95% sequence identity, or more preferably at least 97% or 98% sequence identity, and even more preferably at least 99% sequence identity. Perhaps, over each length of 24 partially complementary nucleotides, compared to the target sequence, the silencer element may contain 1, 2, or 3 mismatches. It is well known to one skilled in the art that the degree of complementarity shared by a silencer element and a target sequence varies depending on the expression of the target gene to be downregulated or the insect species to be controlled.

The target sequence in the present invention may be selected from any suitable region or nucleotide sequence of the target gene or its RNA transcript. For example, the target sequence can be located within the 5' UTR (from the English untranslated region - untranslated region) or 3' UTR of the target gene or RNA transcript, or in the exon or intron region of this gene.

The interfering ribonucleic acid of the present invention may comprise one or more silencers, wherein each silencer comprises or consists of a nucleotide sequence at least partially complementary to the target sequence within the target gene, and functions to down-regulate expression of the target gene upon uptake insects. The term "multiple" or "more" means at least two, at least three, at least four, etc. up to at least 10, 15, 20, or at least 30. The interfering ribonucleic acid contains multiple copies of a single silencer, ie repeats of a silencer that binds to a particular target sequence within a particular target gene. Silencing element in interfering ribonucleic acid may also contain or consist of different nucleotide sequences that are complementary to different target sequences. It will be apparent that the combination of multiple copies of the same silencer element and a silencer binding to a different target sequence also falls within the scope of the present invention.

In the present invention, in order to achieve downregulation of a particular target gene in a Coleoptera insect, different target sequences can be derived from the same target gene in the insect. In this case, the silencer elements in the interfering ribonucleic acid may be combined according to the original order of the target sequences found in the target gene, or compared to the order of the target sequences in the target gene, the silencer elements may be disorganized and randomly combined into any order of ranking in the environment of the interfering ribonucleic acid.

It is possible that the different target sequences represent the same target gene, respectively, but come from different insect species.

It is possible that different target sequences may come from different target genes. If the interfering ribonucleic acid is used to prevent and/or control pest infestations, then preferably the different target sequences are selected from the group consisting of genes regulating essential biological functions of the insect, where these biological functions include survival, growth, development, reproduction and pathogenicity, but are not limited to them. Target sequences may regulate the same or different biological pathways or processes.

In the present invention, different genes targeted by different silencers may come from the same insect. This method can be used to achieve an enhanced attack on a single insect. In particular, different target genes can be differentially expressed at different stages of the insect's life cycle, eg, mature adult stage, immature larval stage, and egg stage. Thus, the interfering ribonucleic acid of the present invention can be used to prevent and/or control insect infestations at one or more stages of the insect's life cycle. Alternatively, different genes targeted by different silencers come from different insects; thus, the interfering ribonucleic acid of the present invention can also be used simultaneously to prevent and/or control infestations by one or more types of insects.

Silencing element in the present invention may be a continuously following region of interfering ribonucleic acid or may be separated by a linker sequence. The linker sequence may contain a short random nucleotide sequence that is not complementary to any target sequence or target gene. The linker sequence may be a self-cleaving RNA sequence under certain conditions, preferably a pH sensitive linker or a hydrophobic sensitive linker. The linker may also contain a nucleotide sequence equivalent to that of the intron. The length of the linker sequence can range from 1 base pair to about 10,000 base pairs, provided that the linker will not impair the ability of the interfering ribonucleic acid to down-regulate gene expression.

In addition to one or more silencers and any linker sequence, the interfering ribonucleic acid in the present invention may also contain at least one additional polynucleotide sequence. The additional polynucleotide sequence is selected from: (1) a sequence capable of protecting an interfering ribonucleic acid from RNA processing; (2) a sequence affecting the stability of the interfering ribonucleic acid; (3) a sequence that provides protein binding to facilitate uptake of the interfering ribonucleic acid into the insect cell; (4) a sequence that facilitates large-scale production of interfering ribonucleic acid; (5) an aptamer sequence capable of binding to a receptor or binding to a molecule on the surface of an insect cell in such a manner as to facilitate uptake; or (6) a sequence that catalyzes the processing of an interfering ribonucleic acid in an insect cell and thereby enhances the effectiveness of the interfering ribonucleic acid.

The length of the interfering ribonucleic acid in the present invention should be sufficient for uptake by the insect cell and downregulation of the target gene in the insect. The upper limit of length may depend on: (1) the need for uptake of the interfering ribonucleic acid into the insect cell and (2) the need for mediating gene silencing by the processed interfering ribonucleic acid in the insect cell via an RNAi approach, and the length may also be dictated by the method of preparation and composition for delivery interfering ribonucleic acid into the cell. Preferably, the interfering ribonucleic acid in the present invention will be 19 to 10,000 nucleotides in length, preferably 50 to 5,000 nucleotides or 100 to 2,500 nucleotides, more preferably 80 to 2,000 nucleotides in length.

The interfering ribonucleic acid of the present invention may contain DNA bases, non-natural bases, or a non-natural base compound or modifications to the sugar phosphate backbone, for example, to enhance stability during storage or to enhance resistance to degradation by nucleases. In addition, the interfering ribonucleic acid can be produced chemically or enzymatically by a person skilled in the art in a manual or automatic reaction. Possibly, the interfering ribonucleic acid can be transcribed from the polynucleotide encoding it. Thus, the present invention provides an isolated polynucleotide for encoding any of the interfering ribonucleic acids.

The polynucleotide of the present invention can be inserted into a DNA construct or vector known in the art by conventional molecular cloning techniques. The DNA construct may be a recombinant DNA vector such as a bacterial, viral or yeast vector. A DNA construct is an expression construct in which a polynucleotide is operably linked to at least one regulatory sequence capable of directing the expression of the polynucleotide sequence. The term "regulatory sequence" refers to any nucleotide sequence capable of affecting the expression of an operably linked polynucleotide, including but not limited to a promoter, enhancer, and other naturally occurring or synthesized transcriptional activation elements. The regulatory sequence may be located at the 5' or 3' end of the polynucleotide sequence. The term "operably linked" refers to a functional connection between a regulatory sequence and a polynucleotide sequence, in which the connection causes the regulatory sequence to control the expression of the polynucleotide. Functionally related elements may be sequential or non-sequential.

The regulatory sequence in the present invention may be a promoter. Preferably, the promoter is an expressible plant promoter. "Expressible plant promoter" refers to a promoter that allows expression of a polynucleotide associated therewith in a plant cell. The expressible plant promoter may be a constitutive promoter. Examples of promoters driving constitutive expression in plants include, but are not limited to, the 35S promoter derived from cauliflower mosaic virus, maize ubiquitin promoters, rice GOS2 gene promoters, and the like. Alternatively, the expressible plant promoter may be a tissue-specific promoter, i.e. the promoter directs the expression of a coding sequence in several tissues, such as green tissues, at a level higher than in other plant tissues (which can be measured using conventional assays). RNA), such as the PEP carboxylase (Phosphoenolpyruvate carboxylase) promoter. Alternatively, the expressible plant promoter may be a wound-inducible promoter. By injury-induced promoter or injury-induced expression mode-directing promoter, it is meant that when a plant suffers from injury caused by mechanical factors or insect nibbling, the expression of a polynucleotide under the regulation of this promoter is significantly improved than under normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, the promoters of the potato and tomato protease inhibitor genes (pinI and pinII) and the maize protease inhibitor (MPI) genes.

Optionally, one or more transcription termination sequences may be included in an expression construct in the present invention. The term "transcriptional termination sequence" encompasses the regulatory sequence at the end of a transcription unit, and sends signals for transcription termination, 3' processing, and polyadenylation of the primary transcript. The additional regulatory element includes, but is not limited to, a transcriptional or translational enhancer that may be included in the expression construct, such as the CaMV35S dual amplifying promoter.

The method for producing any interfering ribonucleic acid in the present invention includes the following steps: (1) bringing a polynucleotide encoding an interfering ribonucleic acid, or a DNA construct containing this polynucleotide, into contact with a cell-free component; and (2) introducing into the cell a polynucleotide encoding an interfering ribonucleic acid or a DNA construct containing the polynucleotide (eg, by transformation, transfection, or injection).

In the present invention, a host cell containing any interfering ribonucleic acid of the present invention, any polynucleotide of the present invention, or a DNA construct containing these polynucleotides may be a prokaryotic cell, including but not limited to gram-positive and gram-negative bacteria cells; or a eukaryotic cell, including but not limited to a yeast cell or a plant cell. Preferably, the host cell is a bacterial cell or a plant cell. The polynucleotide or DNA construct of the present invention may be present or maintained as an extrachromosomal element in the host cell, or may be stably incorporated into the genome of the host cell.

In the present invention, in the case of an interfering nucleic acid expressed in a host cell and/or used to prevent and/or control insect infestations in the host, it is preferable that the interfering ribonucleic acid does not show significant "off-target" effects, i.e., the interfering ribonucleic acid does not affect the expression of the non-target gene in the host. Preferably, the silencer gene does not show significant complementarity with respect to a nucleotide sequence other than the given target gene sequence. The silencer element exhibits less than 30%, more preferably less than 20%, more preferably less than 10%, and even more preferably less than 5% sequence identity with any host cell or organism gene. If host genomic sequence data are available, then the identity of the silencer can be cross-checked using standard bioinformatics tools. In a region having 17 consecutive nucleotides, more preferably in a region having 18 or 19 consecutive nucleotides, and most preferably in a region having 19 or 20 or 21 consecutive nucleotides, the silencer and the gene from the host cell or organism do not have sequence identity.

In the present invention, a composition for preventing and/or controlling insect lesions comprises at least one interfering ribonucleic acid and optionally at least one suitable carrier, adjuvant or diluent, wherein the interfering ribonucleic acid functions to down-regulate target gene expression in the insect after ingestion by these insects. The interfering ribonucleic acid contains or consists of at least one silencer element, and this silencer element is a region of double-stranded RNA containing annealed complementary strands, of which one strand (sense strand) contains a nucleotide sequence at least partially complementary to the target sequence in target gene. The target gene includes, but is not limited to, genes regulating survival, growth, development, reproduction, and pathogenicity of an insect. Perhaps the composition contains at least one host cell, and the host cell contains at least one interfering ribonucleic acid or DNA construct encoding an interfering ribonucleic acid, and possibly at least one suitable carrier, adjuvant or diluent, where the interfering the nucleic acid functions to down-regulate the expression of the target gene in the insect upon ingestion by the insect of the host cell.

The composition of the present invention may be presented in any suitable form to be applied to an insect. For example, the composition may be in the form of a solid (powder, pellet, or bait), liquid (including an insecticidal spray), or gel. The composition may be a coating, paste or powder that is applied to the substrate in such a way as to protect the substrate from insect infestation.

The composition can be used to protect any substrate or material susceptible to insect infestation or damage caused by insects.

The properties of the excipient and the physical form of the composition may vary depending on the properties of the substrate that is desired to be treated. For example, the composition may be a liquid that is brushed or sprayed on the material or substrate to be treated, or printed on the material or substrate to be treated; or a coating or powder that is applied to the material or substrate to be treated.

In the present invention, the composition may be in the form of a bait. The bait is used to lure the insect to be brought into contact with the composition. Upon contact with an insect, the composition is subsequently taken up by the insect, eg by ingestion, and mediates RNAi, thereby killing the insect. The bait may contain a type of food, such as a type of protein food, such as fishmeal. Boric acid can also be used as a bait. The bait may depend on the target species. It is also possible to use an attractant, which, for example, may be a pheromone, such as a male or female pheromone. The attractant may act to bring the insect into contact with the composition and may target a particular insect or may attract insects across the spectrum, increasing the possibility of lured insects coming into contact with the composition of the present invention, thus achieving the goal of killing a mass of insects. The bait may be in any suitable form, such as in the form of a solid, paste, pellet or powder.

From a single insect to a community of insects, bait may be used. In such a case, the bait can serve as a food source for other members of the community, thus providing effective control over the mass of insects and possibly the entire insect community. The bait may also be offered in a suitable "shell" or "trap".

In addition, the composition upon contact with insects can be retained on the surface of insects. When cleaning, whether by cleaning one insect on its own or cleaning each other, the composition can be absorbed and can thus mediate its action in the insects. To do this, the composition must be sufficiently stable such that even when exposed to external environmental conditions over a period of time (for example, several days), the interfering ribonucleic acid still remains intact and can mediate RNAi.

The composition of the present invention may be in the form of a spray. Thus, the human user can directly spray the composition onto the insects. The composition is then digested by the insect and can mediate RNA interference in the body of the insect, thus exerting control over the insect. The spray is preferably a pressure spray/nebulized spray or atomizer. These particles may be of a suitable size such that they can adhere to the insect, for example adhere to an exoskeleton onto which the particles can be absorbed.

In the present invention, the composition carrier is an electrostatic powder or particle that can adhere to the insect. Possibly, the composition carrier may contain magnetic particles that can adhere to the surface of the insect. It is possible that the composition carrier contains metal particles that are initially non-magnetized, but can become magnetically polarized when exposed to an electric field provided by the body of the insect. Preferably, the composition includes a carrier that increases the insect's uptake of the interfering RNA. Such a carrier may be a lipid-based carrier, preferably comprising one or more of the following carriers: oil-in-water emulsion, micelle, cholesterol, lipopolyamine, and liposome. Other absorption enhancing agents of the construct of the present invention are also well known to those skilled in the art and include polycations, dextran, and cationic lipids such as CS096 and CS102. Optionally, the composition carrier is a nucleic acid coagulant, and the preferred coagulant includes spermidine or protamine sulfate, or derivatives thereof.

Where the composition of the present invention is suitable for preventing and/or controlling insect infestations in a plant, the composition may contain a carrier suitable in the field of agriculture. Such a carrier may be any substance that can be carried by the plant to be treated, and the substance will not unduly harm the environment or other organisms present therein, and maintain the efficacy of the interfering ribonucleic acid on the insect. In particular, the composition of the present invention may be prepared in accordance with conventional agricultural practices used in the biological pesticide industry so as to be delivered to a plant. The composition may contain an additional component capable of performing other functions, where these functions include the following: (1) enhancing or improving the uptake of interfering ribonucleic acid into the insect cell, and (2) stabilizing the active components of the composition, but are not limited to them. Such additional components contained in an interfering ribonucleic acid composition may be yeast tRNA or yeast total RNA.

The composition may be formulated for direct use or formulated as a concentrated form of the primary composition which must be diluted prior to use. Optionally, the composition may be prepared as a kit containing the ribonucleic acid or host cell containing/expressing the interfering ribonucleic acid in a container and a suitable diluent or carrier for the RNA or host cell in a separate container. In the use of the present invention, the composition can be applied to the plant or any part thereof at any stage of the plant's development, for example, during plant cultivation in the field, the composition is applied to the aerial part of the plant; or when the plant seeds are stored or after the plant seeds are sown in soil, the composition is applied to the plant seeds. In general, it is important to achieve good insect control in the early stage of plant growth, as this stage is the period when the plant is likely to suffer the most severe insect damage.

In the present invention, the composition can be applied to the insect environment through a variety of techniques, which include, but are not limited to, spraying, misting, spreading, spreading, watering, seed coating, seed treatment, soil application, and water application for irrigation. When a plant that is susceptible to insect attack is treated, the composition may be delivered to the plant or part thereof before the appearance of the insect (for prophylactic purposes) or after signs of insect infestation (for control purposes).

The composition of the present invention can be prepared containing at least one additional active agent. Thus, the composition may be provided as a "multi-part kit" and the kit contains an interfering ribonucleic acid composition in a container and one or more suitable active ingredients such as chemical or biological pesticides in a separate container. Possibly, the composition can be provided as a mixture which is stable and whose components can be used in combination with each other.

Suitable active ingredients that can be used in a complementary manner with the interfering ribonucleic acid of the present invention include, but are not limited to, the following ingredients: dursban, allethrin, resmethrin, tetrabromoethyl, dimethanol-cyclopropanecarboxylic acid (usually contained in a liquid composition); and hydramethylnon, avermectin, dursban, sulfuramide, hydroprene, fipronil (GABA (gamma-aminobutyric acid) receptor), carbamic acid isopropylphenylmethyl ester, indoxacarb, noviflumuron (chitin synthesis inhibitor), imiprotrin, abamectin (glutamate-dependent chloride channel), and imidacloprid (acetylcholine receptor) (usually contained in the composition as a bait). Preferably, in view of health and the environment, the active ingredient is known to be a pesticide such as hydramethylnon and avermectin.

The composition of the present invention may be formulated containing at least one additional agricultural agent, such as a herbicide or additional pesticide. The term "additional pesticide" or "second pesticide" refers to a pesticide in addition to the first or original interfering RNA molecule of the composition. Optionally, the composition of the present invention may be delivered in combination with at least one additional agricultural agent (eg, a herbicide or a second pesticide). The composition may be provided in combination with a herbicide selected from any herbicide known in the art, such as glyphosphate, 2,4-D, imidazolinone, sulfonylurea, and bromoxynil. The composition may be provided in combination with at least one additional pesticide, which may be selected from any pesticide known in the art and/or may contain an interfering ribonucleic acid that functions to down-regulate target gene expression in the insect after ingestion by the insect. . The target pest is an insect, and the interfering ribonucleic acid is selected from any of the interfering ribonucleic acids in the present invention. The additional pesticide contains an interfering ribonucleic acid that functions to down-regulate the expression of a known gene in any target pest. The parent interfering ribonucleic acid and the second or additional pesticide in the composition may target the same or different insects. For example, the parent interfering ribonucleic acid and the second pesticide may target different insects, or may target insects of different families or groups, such as fungi or nematodes or insects. One skilled in the art would understand how to detect synergistic effects of a combination of interfering ribonucleic acid and other agricultural chemicals. Preferably, the composition contains a first interfering ribonucleic acid and one or more additional pesticides, each of which has toxicity against the same insect, where one or more additional pesticides are selected from a potato tuber specific protein, a Bacillus thuringiensis insecticidal protein, an insecticidal protein Xenorhabdus ehlersii, Photorhabdus insecticidal protein, Bacillus laterosporus insecticidal protein, Bacillus sphaericus insecticidal protein and lignin. The different components may be delivered simultaneously or sequentially to the area or organism to be treated.

The method of preventing and/or controlling insect infestations of the present invention includes contacting the insect with an effective amount of at least one interfering ribonucleic acid, wherein the interfering ribonucleic acid functions to down-regulate the expression of the insect's desired target gene after ingestion by the insect. The desired target gene can be any insect gene involved in regulating the initiation or maintenance of the necessary biological processes required for injury in the insect, and these biological processes include, but are not limited to survival, growth, development, reproduction, and pathogenicity.

The method of preventing and/or controlling insect infestations in a crop field in the present invention comprises expressing an effective amount of an interfering ribonucleic acid in a plant, and when the method is used to control insect infestations, the term "effective amount" refers to to the amount or concentration of the interfering ribonucleic acid required to produce a phenotypic effect on the insect, such that the number of insects infecting the host is reduced and/or the amount of damage caused by the insect is reduced. The phenotypic effect may be insect death, and the use of interfering RNA achieves an insect mortality rate of at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, and more preferably at least 80% or 90 %, compared with the control insect. The phenotypic effect may also include, but is not limited to, preventing insect growth, inhibiting feeding activity, and reducing egg laying. Thus, compared with the control insect, the total number of insects attacking the host can be reduced by at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, and more preferably at least 80% or 90%. Possibly, compared to the control insect, the damage caused by insects can be reduced by at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, and more preferably at least 80% or 90%. Thus, the present invention can be used to achieve at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, and more preferably at least 80% or 90% insect control.

The method and composition of the present invention can be used to limit or eliminate the invasion of a Coleoptera pest, preferably Monolepta hieroglyphica (Motschulsky), in an environment or surface where any pest host, pest symbiont or pest may be present, by providing one or more compositions containing dsRNA molecules in the present invention, in pest food. The method is particularly useful for preventing insect attack on a plant, and the pest is defined as having a pH of about 4.5 to about 9.5, about 5 to about 9, about 6 to about 7, or about pH 7.0 in the digestive system.

The nucleotide sequence of the present invention may contain inverted repeats spaced apart by a "spacer sequence". The spacer sequence may be a region containing any of the following nucleotide sequences, as appropriate, which may stimulate the formation of a secondary structure between each repeat segment. The spacer sequence is part of the sense or antisense mRNA coding sequence. Alternatively, the spacer sequence may contain any combination of nucleotides or their homologues that can be covalently linked to the nucleic acid molecule. The spacer sequence may comprise a nucleotide sequence with a length of at least about 10-100 nucleotides, or a length of at least about 100-200 nucleotides, or a length of at least about 200-400 nucleotides, or a length of at least about 400-500 nucleotides.

In the present invention, "introducing" an interfering ribonucleic acid into a plant means an introduction that can be carried out by a direct transformation method such as Agrobacterium mediated transformation to plant tissue, microparticle bombardment, electroporation, etc.; or the introduction, which can be done by hybridizing a plant having a heterogeneous nucleotide sequence with another plant, such that the progeny have the nucleotide sequence included in their genomes. Such crossing technologies are well known to the person skilled in the art.

The present invention provides a polynucleotide and method for controlling insect infestations, having at least the following advantages:

1. The present invention discloses for the first time a plurality of target sequences for controlling the target gene c46312 of the insect pest Coleoptera, Monolepta hieroglyphica (Motschulsky) and furthermore found that a nucleic acid inhibitor derived from these target sequences can be be used directly to control pest infestations from Coleoptera.

2. High species specificity. The target sequences disclosed herein for controlling the Coleoptera insect pest, Monolepta hieroglyphica (Motschulsky), act with high specificity on Monolepta hieroglyphica (Motschulsky) and species that share close genetic affinities and have sequence identity.

3. Avoiding the development of sustainability. The present invention does not rely on the binding of a specific dsRNA to a receptor protein in the body of an insect, and thus a similar risk of developing resistance to Bt protein toxins in the insect can be effectively avoided.

4. The RNAi technology used in this document is highly efficient and specific, and the resulting dsRNA can be directly used in the field to control insect pests from Coleoptera, which is convenient, inexpensive, and good in environmental compatibility.

The technical solutions of the present invention are further detailed below by means of drawings and examples.

Description of graphic materials

Fig. 1 is an electropherogram showing the level of expression of the c46312 target gene used in the polynucleotide and method for controlling insect infestations of the present invention.

Fig. 2 is a schematic representation of the DBNR46312C1 recombinant expression vector used in the polynucleotide and method for controlling insect infestations of the present invention.

Specific embodiments of the invention

The technical solution of the polynucleotide and method for controlling insect infestations in the present invention is further illustrated below with specific examples.

Example 1 Determination of Target Sequences of Monolepta hieroglyphica (Motschulsky)

1. Isolation of the total RNA of Monolepta hieroglyphica (Motschulsky) Freshly hatched larvae of Monolepta hieroglyphica (Motschulsky) were taken as the material, and the RNA was isolated by using the conventional method with trizol, purified by the conventional method, and treated with DNase, thus obtaining a sample of total RNA with a concentration equal to or higher than 300 ng / μl, with a total amount equal to or greater than 6 μg, and OD _260/280 (from English optical density - optical density) 1.8-2.2.

2. mRNA isolation and cDNA synthesis

PolyA mRNA was isolated from the total RNA sample prepared as above using oligo(dT) magnetic beads and first strand cDNA was then synthesized using an Invitrogen Superscript II reverse transcriptase random hexamer kit.

3. Screening for target genes

One target gene, c46312 Monolepta hieroglyphica (Motschulsky), was screened from genes that are in a larval library with an average analytical expression value and may be involved in important metabolic pathways, and its full-length nucleotide sequence is shown in SEQ ID NO: 1, amino acid the sequence is shown in SEQ ID NO: 2.

4. Selection of target sequences in target genes

Four target sequences with different ORF (open reading frame) positions and/or different lengths of the c46312 target gene were selected as shown in Table 1.

Example 2 Preparation of dsRNA

The dsRNAs of the four target sequences mentioned above were synthesized, respectively, according to the instructions of the MEGAscript RNAi kit from ThermoFisher, namely, c46312_g1-01 - c46312_g1-04; the size of the products was determined by agarose gel electrophoresis with a mass concentration of 1%, and the concentrations of c46312_g1-01 - c46312_g1-04 were determined, respectively, by NanoDrop 2000 (Thermo Scientific).

Example 3 Identification of the ability to control Monolepta hieroglyphica (Motschulsky) by feeding dsRNA

Isolated and purified c46312_g1-01 - c46312_g1-04 were mixed, respectively, and equally added to the feed in the ratios of 50 µg/g feed and 5 µg/g feed (Feed formula references Development of an artificial diet for the western corn rootworm, Entomologia Experimentalis et Applicata 105: 1-11, 2002.) with c46312_g1-01-50 to c46312_g1-04-50 and c46312_g1-01-5 to c46312_g1-04-5, respectively. In the control group, irrelevant dsRNA (SEQ ID NO: 15) was added to the CK diet and other conditions were completely unchanged. Freshly hatched larvae of Monolepta hieroglyphica (Motschulsky) were fed the food prepared as above. 30 freshly hatched larvae with a hatching time of no more than 24 hours were placed in each dish, in which the mixed sdsRNA food was changed every two days, and fed up to day 14. The percentage of insect mortality was counted every two days from the start of feeding, and targets were determined on days 0, 4, 8 and 10 from the start of feeding using the specific methods below:

Step 301 Larvae fed c46312_g1-01-50 to c46312_g1-04-50 and c46312_g1-01-5 to c46312_g1-04-5, respectively, were harvested on days 0, 4, 8, and 10, respectively. and frozen with liquid nitrogen;

Step 302 Total RNA of the above larvae was isolated using the trizol method, respectively;

Step 303 cDNA was obtained by reverse transcription of the total RNA of the above larvae using the whole gold kit (TransGen Biotech ER301-01), respectively.

Step 304 Ubiquitin-C was used as an internal reference gene for PCR amplification, and after amplification, 10 μl of the amplification product was taken for agarose gel electrophoresis at a mass concentration of 1%.

Five replicates were established for each treatment in the experiment mentioned above, and the statistical results are shown in FIG. 1 and in Table 2. In Table 2, "-50" in the material number represents 50 μg of the corresponding dsRNA per g of feed, namely "50 μg/g of feed" as noted above; "-5" represents 5 µg of the corresponding dsRNA per gram of feed, namely "5 µg/g of feed" as noted above. For example, "r1-dsRNA-50" represents 50 µg of r1-dsRNA per gram of feed. "DAI (from the English days after incubation)" represents the number of days after incubation and feeding of insects.

The measured results of the expression level of the target gene in FIG. 1 showed that dsRNA (50 μg/g feed) of the c46312_g1-01 target sequence had a significant inhibitory effect on the expression of the c46312 target gene in Monolepta hieroglyphica (Motschulsky), and the expression level of the c46312 target gene was significantly down-regulated on day 4 of feeding. , the expression of the target gene c46312 was almost not detected on day 10.

The results of dsRNA feeding in Table 2 showed that dsRNA target sequences c46312_g1-01 - c46312_g1-04 of target gene c46312 had a significant lethal effect on Monolepta hieroglyphica (Motschulsky), and there were no surviving larvae in most repeats on day 14 of feeding.

Example 4 Unexpected technical effect of interfering with the expression of the same gene in different insects

The 54 kDa signal recognition particle protein, which belongs to one of the peptide chains in the signal recognition particle complex, and its main function is that when the pre-secreted protein leaves the ribosome, the 54 kD signal recognition particle protein rapidly binds to the signal sequence of the pre-secreted protein and transfers it to the membrane protein associated with the translocation chain. Related literature has shown that interfering with the expression of the gene encoding the 54 kDa signal recognition particle protein can have a lethal effect on a variety of Coleoptera insects, as reported by Julia Ulrich et al. (2015), RNA interference (RNAi) was performed on the gene encoding the protein in Tribolium castaneum by injection (injection sequence code iB_00404) and it was found that almost all Tribolium castaneum died about four days after injection. As also reported by Avet-Rochex et al. (2010), RNA interference (RNAi) was performed on a gene encoding a protein in Drosophila by injection (Table 1), and the results showed that almost all Drosophila died after injection.

Based on reports in the literature sources mentioned above and high sequence homology, the gene encoding this protein in Monolepta hieroglyphica (Motschulsky) was selected by screening. For sequences for injection into Tribolium castaneum and Drosophila, the M1 sequence was selected at the appropriate position as shown in SEQ ID NO: 16, and the M2 sequence at the mismatched position was selected as shown in SEQ ID NO: 17. Monolepta control capability hieroglyphica (Motschulsky) was determined using the dsRNA feeding method (at a ratio of 50 µg/g feed) in Example 3 of the present invention. As shown in Table 3, the results of the experiments showed that neither the M1 sequence at the corresponding position nor the M2 sequence at the inappropriate position could have a significant lethal effect on Monolepta hieroglyphica (Motschulsky), which was essentially the same as the control group. Similar experimental results were approved in the international public patent PCT WO 2018/026770, which were confirmed using RNAi of the lethal genes of Nematodes, Drosophila, etc. after obtaining the transcriptome, that is, according to several known lethal genes of Nematodes and Drosophila, RNA interference (RNAi) was carried out on the corresponding gene in the corn beetle, and there was essentially no significant lethal effect. In summary, the technical effect of interference with the expression of the same gene from different insects was unpredictable and not necessarily associated with the technical effect of known interference and sequence homology.

Example 5 Construction of Plant Expression Vectors

Two expression cassettes were synthesized according to the order p35S-RX-tNos-p35S-Hpt-tNos (X is 1-4) and linked to plant expression vectors via EcoR V and BamH I and named DBNR46312CX (X is 1-4, where schematic a depiction of the DBNR46312C1 vector is shown in Fig. 2 (cap: kanamycin resistance gene; RB: right border; pr35S: 35S cauliflower mosaic virus promoter (SEQ ID NO: 7); R1 (SEQ ID NO: 8): g1_01 nucleotide sequence ( g1_01 target sequence 1 of target gene c46312, SEQ ID NO: 3) plus spacer sequence (SEQ ID NO: 9) plus reverse complementary sequence of nucleotide sequence r1 tNos: nopaline synthase gene terminator (SEQ ID NO: 10) Hpt: hygromycin phosphotransferase gene (SEQ ID NO: 11); and LB: left border)).

Competent cells of Escherichia coli T1 were transformed with the recombinant expression vector DBNR46312C1 by the heat shock method with the following heat shock conditions: keeping 50 μl of competent Escherichia coli T1 cells and 10 μl of plasmid DNA (recombinant expression vector DBNR46312C1) at 42°C for 30 s in a water bath; shaking culture at 37° C. for 1 hour (using a shaker at 100 rpm for shaking); then cultivation at a temperature of 37°C for 12 hours on a plate with solid LB medium (10 g/l trypton, 5 g/l yeast extract, 10 g/l NaCl and 15 g/l agar, adjusting the pH to 7.5 via NaOH) containing 50 mg/l kanamycin, selecting white colonies and culturing at 37° C. overnight in liquid LB culture medium (10 g/l tryptone, 5 g/l yeast extract, 10 g/l NaCl and 50 mg/l Kanamycin, adjusted to pH 7.5 with NaOH). Plasmids in cells were isolated by alkaline method: centrifugation of the solution with bacteria at 12,000 rpm for 1 min, removal of the supernatant, and precipitated bacteria were suspended in 100 μl of ice-cold pre-chilled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid) ), 50 mM glucose, pH 8.0); adding 200 μl of freshly prepared solution II (0.2 M NaOH, 1% SDS (from the English sodium dodecyl sulfate - sodium dodecyl sulfate)), inverting the tube 4 times, mixing and placing on ice for 3-5 minutes; adding 150 µl of cold solution III (3 M potassium acetate, 5 M acetic acid), immediately mixing evenly thoroughly and placing on ice for 5-10 min; centrifugation at 4° C. and 12,000 rpm for 5 minutes, adding 2 volumes of anhydrous ethanol to the supernatant, mixing evenly, and placing at room temperature for 5 minutes; centrifugation at 4° C. and 12,000 rpm for 5 minutes, discarding the suprnatant, and washing the precipitate with 70% (v/v) ethanol, and drying; adding 30 µl of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) containing RNase (20 µg/ml) to dissolve the precipitate; incubation in a water bath at 37°C for 30 min for RNA cleavage; storage at -20°C for further use. The isolated plasmids were sequenced and identified by PCR, and the results indicated that the DBNR46312C1 recombinant expression vector had been correctly designed.

According to the method mentioned above, recombinant expression vectors DBNR46312C2-DBNR46312C4 were constructed, respectively, with the following vector structures: Cap: kanamycin resistance gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 7); RX: the nucleotide sequence of g1_0X (g1_0X is the target X sequence of target gene c46312, X is 2-4) plus the spacer sequence (SEQ ID NO: 9) plus the reverse complementary sequence of the nucleotide sequence of g1_0X); tNos: nopaline synthase gene terminator (SEQ ID NO: 10); Hpt: hygromycin phosphotransferase gene (SEQ ID NO: 11); and LB: left border. Competent cells of Escherichia coli T1 were transformed, respectively, with the recombinant expression vector DBNR46312C2-DBNR46312C4 by the heat shock method, and the plasmids in the cells were isolated by the alkaline method.

Example 6 Agrobacterium Transformation with Recombinant Expression Vectors

Agrobacterium LBA4404 (Invitrogen, Chicago, USA, cat no: 18313-015) were respectively transformed with recombinant DBN46312C1-DBNR46312C4 expression vectors, which were correctly constructed, using the liquid nitrogen method with the following transformation conditions: insertion of 100 μl of Agrobacterium LBA4404 and 3 μl of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 min and incubation in a warm water bath at 37°C for 10 min; inoculation of the transformed Agrobacterium LBA4404 into the LB tube, culture at 28°C and 200 rpm for 2 h and then spread over the LB plate containing 50 mg/l rifampicin and 100 mg/l kanamycin until until positive single clones are grown, selecting single clones for cultivation and isolating their plasmids, and testing by enzymatic digestion on the recombinant expression vectors DBNR46312C1-DBNR46312C4 with restriction endonucleases EcoR V and BamH I, and the results showed that the structures of the recombinant expression vectors DBNR46312C1-DBNR46312C4 were absolutely correct.

Example 7. Obtaining transgenic corn plants

According to the commonly used Agrobacterium infection method, sterile-cultured young embryos of maize variety Zong31 (Z31) were co-cultured with the transformed Agrobacterium in Example 6 so as to transfer the T-DNA (containing the nucleotide sequence of RX, the promoter sequence of the mosaic virus color cabbage 35S, Hpt gene and Nos terminator sequence) in the recombinant expression vectors DBNR46312C1-DBNR46312C4 constructed in Example 5 into the maize chromosome, thus producing maize plants with the included nucleotide sequence RX (X is 1-4); meanwhile, wild-type maize plants were used as a control.

With regard to Agrobacterium-mediated transformation of maize, briefly, immature young embryos are separated from maize and brought into contact with an Agrobacterium suspension, where Agrobacterium can carry out the transfer of the RX nucleotide sequence into at least one cell of one of the young embryos (stage 1: infection stage). At this stage, the young embryos were preferably immersed in a suspension of Agrobacterium (OD ₆₆₀ equal to 0.4-0.6, infection culture medium (4.3 g/l MS salts, MS vitamins, 300 mg/l casein, 68.5 g /l sucrose, 36 g/l glucose, 40 mg/l acetosyringone (AS - from the English acetosyringone) and 1 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D, pH 5.3)) for initiation inoculation. Young embryos were co-cultured with Agrobacterium for a period of time (3 days) (stage 2: co-culture stage). Preferably, young embryos were cultured on solid culture medium (4.3 g/l MS salts, MS vitamins, 300 mg/l casein, 20 g/l sucrose, 10 g/l glucose, 100 mg/l acetosyringone (AS), 1 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D) and 8 g/l agar, pH 5.8) after the infection stage. After this co-culture step, a possible "recovery" step can take place. At this "recovery" stage, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in the recovery culture medium (4.3 g/l MS salts, MS vitamins, 300 mg/l casein, 30 g/l l sucrose, 1 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D) and 3 g/l phytogel, pH 5.8), without adding a selective agent for plant transformant (step 3: recovery step). Preferably, young embryos are cultured on solid culture medium with antibiotic but no selective agent to eliminate Agrobacterium and provide a recovery step for infected cells. Then, the inoculated young embryos were cultured in a culture medium containing a selective agent (hygromycin), and the growing transformed calli were selected (step 4: selection step). Preferably, young embryos were cultured on solid culture medium for screening (4.3 g/l MS salts, MS vitamins, 300 mg/l casein, 30 g/l sucrose, 50 mg/l hygromycin, 1 mg/l 2.4 -dichlorophenoxyacetic acid (2,4-D) and 3 g/l phytogel, pH 5.8) with a selective agent, leading to selective growth of transformed cells. Then, the plants were regenerated from the calli (step 5: regeneration step). Preferably, the culi grown on the culture medium containing the selective agent were cultured on solid culture media (MS culture medium for differentiation and MS culture medium for rooting) for plant regeneration.

Resistant calli obtained from screening were transferred to MS culture medium for differentiation (4.3 g/l MS salts, MS vitamins, 300 mg/l casein, 30 g/l sucrose, 2 mg/l 6-benzyladenine, 50 mg /l hygromycin and 3 g/l phytogel, pH 5.8) and cultured at 25°C for differentiation. Differentiated seedlings were transferred to MS culture medium for rooting (2.15 g/l MS salts, MS vitamins, 300 mg/l casein, 30 g/l sucrose, 1 mg/l indole-3-acetic acid and 3 g/l phytogel , pH 5.8), cultivated at 25°C until reaching a height of about 10 cm and transferred to a greenhouse for cultivation until fruiting. In the greenhouse, the plants were cultivated at 28°C for 16 hours and then cultivated at 20°C for 8 hours every day.

Example 8. Obtaining transgenic soybean plants

According to the commonly used Agrobacterium infection method, cotyledon node tissues of soybean variety Zhonghuang13 cultured under sterile conditions were co-cultured with the transformed Agrobacterium in Example 6, so as to transfer T-DNA (containing the nucleotide sequence of RX, the promoter sequence of the Cauliflower Mosaic Virus Gene 35S , Hpt gene and Nos terminator sequence) in the recombinant expression vectors DBNR46312C1-DBNR46312C4 constructed in Example 5 into the soybean chromosome, thus producing soybean plants with the included nucleotide sequence RX (X is 1-4); meanwhile, wild-type soybean plants were used as a control.

Regarding Agrobacterium-mediated transformation of soybean, briefly, mature soybean seeds were germinated in soybean germination culture medium (3.1 g/l B5 salts, B5 vitamins, 20 g/l sucrose and 8 g/l agar, pH 5.6) , and the seeds were inoculated on a culture medium for germination and cultured under a temperature condition of 25±1°C; and photoperiod (light/dark) 16 h/8 h. After 4-6 days of germination, sterile soybean seedlings were taken, swelling at the level of bright green cotyledon nodes, hypocotyls were cut off at a level of 3-4 mm below the cotyledon nodes, the cotyledons were cut longitudinally, and apical buds, lateral buds, and germinal roots were removed. The wound was made at the level of the cotyledon node, using the blunt side of the scalpel, the wounded tissues of the cotyledon node were brought into contact with a suspension of Agrobacterium, where Agrobacterium can carry out the transfer of the RX nucleotide sequence into the injured tissues of the cotyledon node (stage 1: stage of infection). At this stage, the tissues of the cotyledon node were preferably immersed in a suspension of Agrobacterium (OD ₆₆₀ equal to 0.5-0.8, culture medium for infection (2.15 g/l MS salts, vitamins B5, 20 g/l sucrose, 10 g/l l glucose, 40 mg/l acetosyringone (AS), 4 g/l 2-morpholinoethanesulfonic acid (MES - from the English morpholine ethanesulfonic acid) and 2 mg/l zeatin (ZT, pH 5.3)) to initiate inoculation. Cotyledon node tissues were co-cultured with Agrobacterium for a period of time (3 days) (Stage 2: co-cultivation step). Preferably, the tissues of the cotyledon node were cultured on a solid culture medium (4.3 g/l MS salts, vitamins B5, 20 g/l sucrose, 10 g/l glucose, 4 g/l 2-morpholinoethanesulfonic acid (MES), 2 mg/l l zeatin and 8 g/l agar, pH 5.6) after the stage of infection. After this stage of co-cultivation, a possible "recovery" stage may take place. At this "recovery" step, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in the recovery culture medium (3.1 g/l B5 salts, vitamins B5, 1 g/l 2-morpholinoethanesulfonic acids (MES), 30 g/l sucrose, 2 mg/l zeatin (ZT), 8 g/l agar, 150 mg/l cephalosporin, 100 mg/l glutamic acid and 100 mg/l aspartic acid, pH 5.6 ), without adding a selective agent for plant transformant (step 3: recovery step). Preferably, the tissue blocks regenerated from the cotyledon nodes are cultured on solid culture medium with an antibiotic but no selective agent to eliminate Agrobacterium and provide a recovery step for the infected cells. Then, the tissue blocks regenerated from the cotyledon nodes were cultured in a culture medium containing a selective agent (hygromycin), and the growing transformed calli were selected (step 4: selection step). Preferably, tissue blocks regenerated from cotyledon nodes were cultured on solid culture medium for screening (3.1 g/l B5 salts, B5 vitamins, 1 g/l 2-morpholinoethanesulfonic acid (MES), 30 g/l sucrose, 1 mg/l 6-benzyladenine (6-BAP), 8 g/l agar, 150 mg/l cephalosporin, 100 mg/l glutamic acid, 100 mg/l aspartic acid and 50 mg/l hygromycin, pH 5.6) c selective agent, which led to the selective growth of transformed cells. Then, the plants were regenerated from the transformed cells (step 5: regeneration step). Preferably, the tissue blocks regenerated from the cotyledon nodes grown on the culture medium containing the selection agent were cultured in solid culture media (B5 culture medium for differentiation and B5 culture medium for rooting) for plant regeneration.

Resistant tissue blocks obtained as a result of screening were transferred to B5 culture medium for differentiation (3.1 g/l B5 salts, vitamins B5, 1 g/l 2-morpholinoethanesulfonic acid (MES), 30 g/l sucrose, 1 mg/l l zeatin (ZT), 8 g/l agar, 150 mg/l cephalosporin, 50 mg/l glutamic acid, 50 mg/l aspartic acid, 1 mg/l gibberellin, 1 mg/l auxin and 50 mg/l hygromycin, pH 5.6) and cultured at 25°C for differentiation. Differentiated seedlings were transferred to B5 culture medium for rooting (3.1 g/l B5 salts, vitamins B5, 1 g/l 2-morpholinoethanesulfonic acid (MES), 30 g/l sucrose, 8 g/l agar, 150 mg/l cephalosporin and 1 mg/l indole-3-butyric acid (IBA) were cultivated on a culture medium for rooting at 25°C until a height of about 10 cm was reached and transferred to a greenhouse for cultivation until fruiting. In the greenhouse, the plants were cultivated at 26°C for 16 hours and then cultivated at 20°C for 8 hours every day.

Example 9 Verification of Transgenic Maize Plants and Transgenic Soybean Plants Using TaqMan

Approximately 100 mg of leaves from maize plants, into which the nucleotide sequence RX (X is 1-4) was introduced, were taken as samples. Their genomic DNA was isolated by Qiagen's DNeasy Plant Maxi Kit, respectively, and the copy number of the Hpt gene was detected by fluorescent qPCR with a Taqman probe so as to determine the copy number of the nucleotide sequence of RX. At the same time, wild-type corn plants were used as a control and were detected and analyzed according to the above method. For these experiments, three repetitions were set and averaged.

A specific way to determine the number of copies of the Hpt gene was as follows:

Step 901 100 mg of leaves from maize plants in which the nucleotide sequence of RX was included and wild-type maize plants, respectively, were taken, ground into a homogenate in a liquid nitrogen mortar, and three replicates were taken for each sample;

Step 902 The genomic DNA of the above samples was isolated using Qiagen's DNeasy Plant Mini Kit, and the specific method may refer to its instructions for use;

Step 903 Genomic DNA concentrations of the samples mentioned above were detected using NanoDrop 2000 (Thermo Scientific);

Step 904 The genomic DNA concentrations of the above mentioned samples were adjusted to a uniform concentration value that ranged from 80 to 100 ng/µl;

Step 905 The copy numbers of the samples were identified using a fluorescence qPCR method with a Taqman probe, where samples for which copy numbers were identified and known were taken as standards, wild-type maize plants were taken as controls, and three replicates were taken for each sample and averaged; the primer and probe sequences for fluorescence qPCR, respectively, were as follows:

The following primers and probe were used to detect the Hpt nucleotide sequence:

Primer 1: cagggtgtcacgttgcaaga as shown in SEQ ID NO: 12 of the sequence listing;

Primer 2: ccgctcgtctggctaagatc as shown in SEQ ID NO: 13 of the sequence listing;

Probe 1: tgcctgaaaccgaactgcccgctg as shown in SEQ ID NO: 14 of the sequence listing;

PCR reaction system:

JumpStart™TaqReadyMix™ (Sigma) 10 µl 50x primer/probe mix 1 µl genomic DNA 3 µl water ( _ddH2O ) 6 µl

The 50x primer/probe mixture contained 45 µl of each primer at 1 mM, 50 µl of probe at 100 µM, and 860 µl of 1xTE buffer, and was stored at 4° C. in a centrifuge tube.

PCR reaction conditions:

Data was analyzed using SDS2 software. 3 (Applied Biosystems).

By analyzing the results of the Hpt gene copy number experiments, it was further demonstrated whether the RX nucleotide sequence was respectively inserted into the chromosome of detected maize plants, and whether maize plants were produced in which the RX nucleotide sequence was inserted (X is 1-4), to obtain transgenic corn plants with one copy.

According to the TaqMan method for screening transgenic corn plants mentioned above, transgenic soybean plants were detected and analyzed. It was further demonstrated, by analyzing the results of the Hpt gene copy number experiments, that the RX nucleotide sequence was inserted into the chromosomes of detected soybean plants, and these soybean plants in which the RX nucleotide sequence was inserted (X is 1-4) resulted in transgenic soybean plants with one copy.

Example 10. Identification of the insecticidal effect of transgenic corn on Monolepta hieroglyphica (Motschulsky)

Insecticidal activity against Monolepta hieroglyphica (Motschulsky) maize plants in which the nucleotide sequence RX (X is 1-4) was included was detected.

Step 1001 Ten maize transformation event lines (RX-M) DBNR46312C1-DBNR46312C4 were selected, each identified as single copy positive by taqman, and three maize transformation event lines (NGM1) identified as negative by taqman; while wild-type maize plants were used as controls (CK1); and the plants were grown in a greenhouse to the third leaf stage;

Step 1002 The materials of step 1001 were taken, and a third young leaf was taken from each seedling and cut into a size of 1×2 cm of a leaf in which the main vein was removed, and stacked and placed in a culture dish with wet filter paper laid on it;

Step 1003. 10 freshly hatched Monolepta hieroglyphica (Motschulsky) larvae with a hatching period of not more than 24 hours were placed in each dish, the lids of the dishes tightly covered the contents, the culture dishes were placed in a biological assay box with a wet piece of gauze placed on its bottom, and this box for biological analysis was placed in a chamber for biological analysis at a temperature of 24±2°C, T/C (dark/light) 24/0 and a humidity of 70%-80%;

Stage 1004 Given that freshly hatched larvae of Monolepta hieroglyphica (Motschulsky) are small and weak, and certainly suffer from mechanical damage, it was better to keep culture dishes immobile on the day when the insects were incubated and 1 day after incubation;

Step 1005 Starting from day 2 after insect incubation, the number of surviving Monolepta hieroglyphica (Motschulsky) was counted outside the culture dishes every day until the end of day 16; Monolepta hieroglyphica (Motschulsky) insects that survived in culture dishes were transferred to culture dishes filled with fresh leaves every two days, and the experimental results are shown in Table 4.

The results of the experiments in Table 4 showed that maize plants, in which the nucleotide sequence of RX (X is 1-4) was included, had a good inhibitory effect on Monolepta hieroglyphica (Motschulsky), and the survival rate (survival rate = number of survivors/analyzed number) of Monolepta hieroglyphica (Motschulsky) was about 40% on day 16.

Example 11. Identification of the insecticidal effect of transgenic soybean on Monolepta hieroglyphica (Motschulsky)

The insecticidal effect against Monolepta hieroglyphica of soybean plants was detected, in which the nucleotide sequence RX (X is 1-4) was included.

Step 1101 Ten soybean transformation event lines DBNR46312C1-DBNR46312C4 (RX-S) were selected, each identified as single copy positive by taqman, and three soybean transformation event lines (NGM2) identified as negative by taqman; while wild-type soybean plants were used as control (CK2); and the plants were grown in a greenhouse until ternate leaves grew;

Step 1102 The materials from step 1101 were taken, and a piece of trifoliate leaf about 2×2 cm in size was taken from each seedling and placed and stirred in a culture dish with wet filter paper laid thereon;

Step 1103: 15 freshly hatched larvae of Monolepta hieroglyphica (Motschulsky) were placed in each dish with a hatch time of not more than 24 hours, the lids of the dishes tightly covered the contents, the culture dishes were placed in a biological assay box with a wet piece of gauze laid on its bottom, and box for biological analysis was placed in the chamber for biological analysis at a temperature of 24±2°C, T/C 24/0 and a humidity of 70%-80%;

Stage 1104 Given that freshly hatched Monolepta hieroglyphica (Motschulsky) larvae are small and weak and certainly suffer from mechanical damage, it was best to keep the culture dishes still on the day when the insects were incubated and 1 day after incubation;

Step 1105 Starting from day 2 after insect incubation, the number of surviving Monolepta hieroglyphica (Motschulsky) was counted outside the culture dishes every day until the end of day 16; Monolepta hieroglyphica (Motschulsky) insects that survived in culture dishes were transferred to culture dishes filled with fresh leaves every two days, and the experimental results are shown in Table 5.

The results of the experiments in Table 5 showed that soybean plants in which the nucleotide sequence of RX (X is 1-4) was included had a good inhibitory effect on Monolepta hieroglyphica (Motschulsky), and the survival rate (survival rate = number of survivors/analyzed number) of Monolepta hieroglyphica (Motschulsky) was up to 50% on day 16.

Example 12. Composition

The formula of an agriculturally acceptable carrier vector for dsRNA (1 L system): 50 mM NaHPO ₄ (pH 7.0), 10 mM β-mercaptoethanol, 10 mM EDTA, sodium hexadecylsulfonate with a mass fraction of 0.1% and octylphenyl polyethylene glycol ether with a mass fraction of 0.1%, bring to 1 l with H ₂ O.

The formula mentioned above was a buffer-based formula, provided that any purified dsRNA is directly added to the buffer so that the final concentration satisfies the requirement, such as 50 mg/l. The formula may also be prepared as a concentrated formulation, if desired.

In conclusion, the present invention discloses for the first time the c46312 target gene and its target sequence for controlling the insect pest Coleoptera, Monolepta hieroglyphica (Motschulsky), and transgenic plants (corn and soybean) obtained by using RNAi technology. Transgenic plants control Monolepta hieroglyphica (Motschulsky) invasion effectively and specifically by introducing dsRNA sequences derived from target sequences, and Monolepta hieroglyphica (Motschulsky) may not have the same risk of developing resistance to Bt protein toxins, with the advantage of good compatibility with environment, convenience and low cost.

Finally, it should be noted that the above examples are used only to illustrate and not limit the technical solution of the present invention; and while the present invention has been illustrated in detail with reference to preferred examples, one skilled in the art should understand that modifications or equivalent substitutions may be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.

--->

SEQUENCE LIST

<110> BEIJING DABEINONG BIOTECHNOLOGY CO., LTD.

<120> POLYNUCLEOTIDE AND METHOD FOR DAMAGE CONTROL

INSECTS

<130> FP1190318P

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1009

<212> DNA

<213> Monolepta hieroglyphica

<400> 1

atgtcgtcaa acatacaaaa agcccagcaa ctaatggctg aggcagaaaa gaaggttttct 60

tcaagaggat tctttggctc tttgtttggt ggctcaagtc gaattgaaga tgctgtagaa 120

tgttaccaaa gggctgcaaa cctcttcaaa atggccaaga gttgggatgc tgcaggaaag 180

gcattctgtg aagcagccaa cctgcatgct agaagtggtg ctcgtcatga tgctgccaca 240

aactatgttg atgcagcaaa ttgttataaa aaggctgata taagtgaggc tgtaaactgt 300

ttgataaaag ccatagacat ttacactgag atgggtcgct tcactatggc tgcaaaacat 360

caccaaacta ttgcagaaat gtatgagact gatgctgtcg acctagagag agctgtgcaa 420

cactatgagc aagctgctga ctacttcaga ggggaggaaa gcaattcctc cgctaataaa 480

tgccttctga aagtggccca atatgcagcc caacttgaaa attatgaaaa agcaatacag 540

atctaccaag aagtggctta ttccgccctc gaaagctccc tcttgaagta cagtgctaaa 600

gaatatttgt ttagagctgc cctttgtcac ctttgtgttg atgtactcaa tgcccaacat 660

gccatagaaa gttatatcca aaggtatccg gcatttcaag attctcgtga atataaactt 720

ttgaaaacgc ttatagaaca cattgaggaa caaaatgtcg atggctacac agatgcagtg 780

aaagactatg attccatttc tcgcctggat caatggtata caacaattct tttacgtatt 840

aaaaaacaac tcaacgagag ccccgacttg cgctaaattg tatttattgg aattccttat 900

tgttcatatt tgttacgtgt tataataaaa gacccatagt ttattttattg ttgaattatt 960

agttaaattt tttatgtctt atgcataaaa gttatttggt ctggagata 1009

<210> 2

<211> 291

<212> PRT

<213> Monolepta hieroglyphica

<400> 2

Met Ser Ser Asn Ile Gln Lys Ala Gln Gln Leu Met Ala Glu Ala Glu

1 5 10 15

Lys Lys Val Ser Ser Arg Gly Phe Phe Gly Ser Leu Phe Gly Gly Ser

20 25 30

Ser Arg Ile Glu Asp Ala Val Glu Cys Tyr Gln Arg Ala Ala Asn Leu

35 40 45

Phe Lys Met Ala Lys Ser Trp Asp Ala Ala Gly Lys Ala Phe Cys Glu

50 55 60

Ala Ala Asn Leu His Ala Arg Ser Gly Ala Arg His Asp Ala Ala Thr

65 70 75 80

Asn Tyr Val Asp Ala Ala Asn Cys Tyr Lys Lys Ala Asp Ile Ser Glu

85 90 95

Ala Val Asn Cys Leu Ile Lys Ala Ile Asp Ile Tyr Thr Glu Met Gly

100 105 110

Arg Phe Thr Met Ala Ala Lys His His Gln Thr Ile Ala Glu Met Tyr

115 120 125

Glu Thr Asp Ala Val Asp Leu Glu Arg Ala Val Gln His Tyr Glu Gln

130 135 140

Ala Ala Asp Tyr Phe Arg Gly Glu Glu Ser Asn Ser Ser Ala Asn Lys

145 150 155 160

Cys Leu Leu Lys Val Ala Gln Tyr Ala Ala Gln Leu Glu Asn Tyr Glu

165 170 175

Lys Ala Ile Gln Ile Tyr Gln Glu Val Ala Tyr Ser Ala Leu Glu Ser

180 185 190

Ser Leu Leu Lys Tyr Ser Ala Lys Glu Tyr Leu Phe Arg Ala Ala Leu

195 200 205

Cys His Leu Cys Val Asp Val Leu Asn Ala Gln His Ala Ile Glu Ser

210 215 220

Tyr Ile Gln Arg Tyr Pro Ala Phe Gln Asp Ser Arg Glu Tyr Lys Leu

225 230 235 240

Leu Lys Thr Leu Ile Glu His Ile Glu Glu Gln Asn Val Asp Gly Tyr

245 250 255

Thr Asp Ala Val Lys Asp Tyr Asp Ser Ile Ser Arg Leu Asp Gln Trp

260 265 270

Tyr Thr Thr Ile Leu Leu Arg Ile Lys Lys Gln Leu Asn Glu Ser Pro

275 280 285

Asp Leu Arg

290

<210> 3

<211> 541

<212> DNA

<213> Monolepta hieroglyphica

<400> 3

gatgggtcgc ttcactatgg ctgcaaaaca tcaccaaact attgcagaaa tgtatgagac 60

tgatgctgtc gacctagaga gagctgtgca acactatgag caagctgctg actacttcag 120

aggggaggaa agcaattcct ccgctaataa atgccttctg aaagtggccc aatatgcagc 180

ccaacttgaa aattatgaaa aagcaataca gatctaccaa gaagtggctt attccgccct 240

cgaaagctcc ctcttgaagt acagtgctaa agaatatttg tttagagctg ccctttgtca 300

cctttgtgtt gatgtactca atgcccaaca tgccatagaa agttatatcc aaaggtatcc 360

ggcatttcaa gattctcgtg aatataaact tttgaaaacg cttatagaac acattgagga 420

acaaaatgtc gatggctaca cagatgcagt gaaagactat gattccattt ctcgcctgga 480

tcaatggtat acaacaattc ttttacgtat taaaaaacaa ctcaacgaga gccccgactt 540

g 541

<210> 4

<211> 308

<212> DNA

<213> Monolepta hieroglyphica

<400> 4

gcccagcaac taatggctga ggcagaaaag aaggtttctt caagaggatt ctttggctct 60

ttgtttggtg gctcaagtcg aattgaagat gctgtagaat gttaccaaag ggctgcaaac 120

ctcttcaaaa tggccaagag ttgggatgct gcaggaaagg cattctgtga agcagccaac 180

ctgcatgcta gaagtggtgc tcgtcatgat gctgccacaa actatgttga tgcagcaaat 240

tgttataaaa aggctgatat aagtgaggct gtaaactgtt tgataaaagc catagacatt 300

tacactga 308

<210> 5

<211> 123

<212> DNA

<213> Monolepta hieroglyphica

<400> 5

catgatgctg ccacaaacta tgttgatgca gcaaattgtt ataaaaaggc tgatataagt 60

gaggctgtaa actgtttgat aaaagccata gacatttaca ctgagatgggg tcgcttcact 120

atg 123

<210> 6

<211> 373

<212> DNA

<213> Monolepta hieroglyphica

<400> 6

ctattgcaga aatgtatgag actgatgctg tcgacctaga gagagctgtg caacactatg 60

agcaagctgc tgactacttc agagggggagg aaagcaattc ctccgctaat aaatgccttc 120

tgaaagtggc ccaatatgca gcccaacttg aaaattatga aaaagcaata cagatctacc 180

aagaagtggc ttattccgcc ctcgaaagct ccctcttgaa gtacagtgct aaagaatatt 240

tgtttagagc tgccctttgt cacctttgtg ttgatgtact caatgcccaa catgccatag 300

360

cgcttataga aca 373

<210> 7

<211> 328

<212> DNA

<213> Cauliflower mosaic virus

<400> 7

ccattgccca gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta 60

caaatgccat cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg 120

tcccaaagat ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac 180

gtcttcaaag caagtggatt gatgtgatat ctccactgac gtaagggatg acgcacaatc 240

ccactatcct tcgcaagacc cttcctctat ataaggaagt tcatttcatt tggagaggac 300

acgctgacaa gctgactcta gcagatct 328

<210> 8

<211> 1232

<212> DNA

<213> Artificial sequence - nucleotide sequence R1

<400> 8

gatgggtcgc ttcactatgg ctgcaaaaca tcaccaaact attgcagaaa tgtatgagac 60

tgatgctgtc gacctagaga gagctgtgca acactatgag caagctgctg actacttcag 120

aggggaggaa agcaattcct ccgctaataa atgccttctg aaagtggccc aatatgcagc 180

ccaacttgaa aattatgaaa aagcaataca gatctaccaa gaagtggctt attccgccct 240

cgaaagctcc ctcttgaagt acagtgctaa agaatatttg tttagagctg ccctttgtca 300

cctttgtgtt gatgtactca atgcccaaca tgccatagaa agttatatcc aaaggtatcc 360

ggcatttcaa gattctcgtg aatataaact tttgaaaacg cttatagaac acattgagga 420

acaaaatgtc gatggctaca cagatgcagt gaaagactat gattccattt ctcgcctgga 480

tcaatggtat acaacaattc ttttacgtat taaaaaacaa ctcaacgaga gccccgactt 540

gaagtactgc gatcgcgtta acgctttatc acgatacctt ctaccacata tcactaacaa 600

catcaacact catcactctc gacgacatcc actcgatcac tactctcaca cgaccgatta 660

actcctcatc cacgcggccg cctgcaggag ccaagtcggg gctctcgttg agttgttttt 720

taatacgtaa aagaattgtt gtataccatt gatccaggcg agaaatggaa tcatagtctt 780

tcactgcatc tgtgtagcca tcgacatttt gttcctcaat gtgttctata agcgttttca 840

aaagtttata ttcacgagaa tcttgaaatg ccggatacct ttggatataa ctttctatgg 900

catgttgggc attgagtaca tcaacacaaa ggtgacaaag ggcagctcta aacaaatatt 960

ctttagcact gtacttcaag agggagcttt cgagggcgga ataagccact tcttggtaga 1020

tctgtattgc tttttcataa ttttcaagtt gggctgcata ttgggccact ttcagaaggc 1080

1140

gttgcacagc tctctctagg tcgacagcat cagtctcata catttctgca atagtttggt 1200

gatgttttgc agccatagtg aagcgaccca tc 1232

<210> 9

<211> 150

<212> DNA

<213> Artificial sequence - spacer sequence

<400> 9

aagtactgcg atcgcgttaa cgctttatca cgataccttc taccacatat cactaacaac 60

atcaacactc atcactctcg acgacatcca ctcgatcact actctcacac gaccgattaa 120

ctcctcatcc acgcggccgc ctgcaggagc 150

<210> 10

<211> 253

<212> DNA

<213> Agrobacterium tumefaciens

<400> 10

gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60

atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120

atgacgttat ttatgagatg ggtttttatg

gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240

atgttactag atc 253

<210> 11

<211> 1026

<212> DNA

<213> Salmonella enterica

<400> 11

atgaaaaagc ctgaactcac cgcgacgtct gtcgagaagt ttctgatcga aaagttcgac 60

agcgtctccg acctgatgca gctctcggag ggcgaagaat ctcgtgcttt cagcttcgat 120

gtaggagggc gtggatatgt cctgcgggta aatagctgcg ccgatggttt ctacaaagat 180

cgttatgttt atcggcactt tgcatcggcc gcgctcccga ttccggaagt gcttgacatt 240

ggggaattca gcgagagcct gacctattgc atctcccgcc gtgcacaggg tgtcacgttg 300

caagacctgc ctgaaaccga actgcccgct gttctgcagc cggtcgcgga ggccatggat 360

gcgatcgctg cggccgatct tagccagacg agcgggttcg gcccattcgg accgcaagga 420

atcggtcaat acactacatg gcgtgatttc atatgcgcga ttgctgatcc ccatgtgtat 480

cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag 540

ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc ggatttcggc 600

tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg gagcgaggcg 660

atgttcgggg attcccaata cgaggtcgcc aacatcttct tctggaggcc gtggttggct 720

tgtatggagc agcagacgcg ctacttcgag cggaggcatc cggagcttgc aggatcgccg 780

cggctccggg cgtatatgct ccgcattggt cttgaccaac tctatcagag cttggttgac 840

ggcaatttcg atgatgcagc ttgggcgcag ggtcgatgcg acgcaatcgt ccgatccgga 900

gccgggactg tcgggcgtac acaaatcgcc cgcagaagcg cggccgtctg gaccgatggc 960

tgtgtagaag tactcgccga tagtggaaac cgacgcccca gcactcgtcc gagggcaaag 1020

gaatag 1026

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence - primer 1

<400> 12

cagggtgtca cgttgcaaga 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence - primer 2

<400> 13

ccgctcgtct ggctaagatc 20

<210> 14

<211> 24

<212> DNA

<213> Artificial sequence - probe

<400> 14

tgcctgaaac cgaactgccc gctg 24

<210> 15

<211> 334

<212> DNA

<213> Artificial sequence - irrelevant dsRNA

<400> 15

ggaaatcgcc actgctaaga aaaatggaca gaaaaataag agagcggcac ttcaagcact 60

caagcggaag aagcggtatg agaaacagtt gcagcagatt gatggaacat tatcaactat 120

tgaaatgcag agagaagctt tagagggtgc caacactaat acagctgttc tcacaacaat 180

gaaagatgct gcggacgccc tcaaagctgc tcacaaacac atggatgtcg atcaagttca 240

tgatatgatg gatgacattg ccgaacagca agatgtagct agagaaattt ctgatgccat 300

atccaaccca gttgcatttg gtcatgatat tgat 334

<210> 16

<211> 541

<212> DNA

<213> Monolepta hieroglyphica

<400> 16

atttgttgat actagtggta gacataaaca agaagaatca ctatttgaag aaatgttggc 60

agtttctaat gctgtgagac cagataatat tattttcgtt atggatgcaa ctattggtca 120

agcttgtgag tctcaggcta aagctttcaa agaaaaggta gatgtaggct ctgtaattat 180

aacaaaatta gatggacatg caaaaggagg tggtgcactc agtgctgtgg cagccactaa 240

cagtcctatt atattcattg gtacaggaga acatatagat gacttagaac cttttaaaac 300

360

aaacgaatta aagttagagg ataatgaaga attgttagaa aaaattaaac atgggcaatt 420

cacactcaga gacatgtatg aacagttcca aaatattatg aaaatgggac ctttctcaca 480

aataatggga atgatccctg gatttagcca agatttcatg tcaaaaggaa gtgaacaaga 540

a 541

<210> 17

<211> 394

<212> DNA

<213> Monolepta hieroglyphica

<400> 17

aataatggac agtatgaatg attatgaatt agataaccga gatggtgcaa aattatttac 60

aaagcaaaat ggtagagtta ttagagttgc acaagggtct ggtgttacag aaagagaagt 120

aaaagatttg atcacgcaat acacgaagtt tgccgccgta gtaaagaaaa tgggcggcat 180

aaagggtctt tttaaaggcg gcgatatggc taaaaatgtc aatcacaacc aaatggccaa 240

acttaatcaa caaatggcca agatgatgga tcctcgagtg cttcagcaaa tgggcggcat 300

ggctggatta cagaacatga tgagacagct acaagcggggc gcggcaggag gcttgggagg 360

tttggggtaac cttatggggtg gttttgggagg gaaa 394

one

<---

Claims (27)

1. An isolated polynucleotide for inhibiting the growth of the insect pest Monolepta hieroglyphica, containing a polynucleotide sequence selected from: (a) a polynucleotide sequence as shown in SEQ ID NO: 1; or (b) a polynucleotide sequence of at least 123 consecutive nucleotides of SEQ ID NO: 1, wherein the double-stranded RNA containing at least one strand complementary to the polynucleotide sequence, when ingested by the insect pest Monolepta hieroglyphica, inhibits the growth of the insect pest Monolepta hieroglyphica; or (c) any of the polynucleotide sequences as shown in SEQ ID NO: 3 - SEQ ID NO: 6; or (d) a polynucleotide sequence that hybridizes to a polynucleotide sequence as defined in any of (a)-(c) above under stringent conditions. 2. A polynucleotide according to claim 1, characterized in that said polynucleotide further comprises a complementary sequence to a polynucleotide sequence as defined in any of (a)-(c) in claim 1. 3. Expression cassette containing a polynucleotide according to any one of paragraphs. 12. 4. Expression vector containing a polynucleotide according to any one of paragraphs. 12. 5. The use of a polynucleotide according to any one of paragraphs. 1, 2 to prevent the expression of the target sequence in the insect pest Monolepta hieroglyphica or to inhibit the growth of the insect pest Monolepta hieroglyphica. 6. A ribonucleic acid, characterized in that said ribonucleic acid acts to down-regulate the expression of at least one target gene in the Monolepta hieroglyphica insect pest after ingestion by the pest insect, said ribonucleic acid comprising at least one silencer element, wherein the specified silencer element is a region of double-stranded RNA containing complementary strands that are annealed and of which one strand contains or consists of a sequence of at least 15, 17, 19 or 21 consecutive nucleotides that is complementary or at least partially complementary to the target sequence in the gene -target, wherein the specified target gene is a polynucleotide sequence as shown in SEQ ID NO: 1, where the specified target sequence is selected from: (a) a polynucleotide sequence of at least 123 consecutive nucleotides of SEQ ID NO: 1; and (b) any of the polynucleotide sequences as shown in SEQ ID NO: 3 - SEQ ID NO: 6. 7. Ribonucleic acid according to claim 6, characterized in that said ribonucleic acid contains at least two silencing elements, each of which contains or consists of a nucleotide sequence at least partially complementary to the target sequence in the target gene; preferably, characterized in that each of the silencers contains or consists of a different nucleotide sequence that is complementary to a different target sequence; preferably, characterized in that said different target sequence is derived from a single target gene or from a target gene other than said target gene; preferably, characterized in that the target gene, different from the target gene, comes from the same insect pest of the order Coleoptera or a different insect pest of the order Coleoptera; preferably, characterized in that the insect pest of the Coleoptera order is Monolepta hieroglyphica (Motschulsky). 8. Ribonucleic acid according to claim 6 or 7, characterized in that said ribonucleic acid additionally contains a spacer sequence; preferably, characterized in that said spacer sequence is SEQ ID NO: 9. 9. Composition for suppressing the invasion of the insect pest Monolepta hieroglyphica, characterized in that it contains at least one of the ribonucleic acids according to any one of paragraphs. 6-8 or a host cell expressing or capable of expressing a ribonucleic acid according to any one of paragraphs. 6-8 and at least one suitable carrier, adjuvant or diluent; preferably, characterized in that said host cell is a bacterial cell. 10. Composition for suppressing the invasion of the insect pest Monolepta hieroglyphica according to claim 9, characterized in that said composition is a solid, liquid or gel; preferably, characterized in that said composition is an insecticidal spray. 11. Composition for suppressing the invasion of the insect pest Monolepta hieroglyphica according to claim 9 or 10, characterized in that said composition further comprises at least one pesticide, said pesticide being a chemical pesticide, a potato tuber specific protein, a Bacillus insecticidal protein thuringiensis, Xenorhabdus ehlersii insecticidal protein, Photorhabdus insecticidal protein, Bacillus laterosporus insecticidal protein or Bacillus sphaericus insecticidal protein. 12. The use of a composition to suppress the invasion of the insect pest Monolepta hieroglyphica (Motschulsky) according to any one of paragraphs. 9-11 to prevent the invasion of the insect pest Monolepta hieroglyphica (Motschulsky). 13. A method of suppressing the invasion of an insect pest Monolepta hieroglyphica, characterized in that said method includes bringing the insect pest Monolepta hieroglyphica into contact with an effective amount of at least one of the ribonucleic acids according to any one of paragraphs. 6-8. 14. A method for increasing plant resistance to the Monolepta hieroglyphica insect, obtaining a plant capable of controlling the Monolepta hieroglyphica insect pest, or protecting a plant from damage caused by the Monolepta hieroglyphica insect pest, characterized in that said method comprises introducing a polynucleotide according to any one of claims . 1, 2, expression cassette according to p. 3 or expression vector according to p. 4 or ribonucleic acid according to any one of paragraphs. 6-8 into a plant, wherein the plant into which said administration is carried out has an inhibitory effect on the growth of the insect pest Monolepta hieroglyphica when said plant is ingested by the insect pest Monolepta hieroglyphica. 15. The method according to claim 13 or 14, characterized in that the plant is soybean, wheat, barley, corn, tobacco, rice, rapeseed, cotton or sunflowers.

Images