CN117402846B - L-alanine dehydrogenase mutant and preparation method and application thereof - Google Patents

L-alanine dehydrogenase mutant and preparation method and application thereof Download PDF

Info

Publication number
CN117402846B
CN117402846B CN202311704466.5A CN202311704466A CN117402846B CN 117402846 B CN117402846 B CN 117402846B CN 202311704466 A CN202311704466 A CN 202311704466A CN 117402846 B CN117402846 B CN 117402846B
Authority
CN
China
Prior art keywords
alanine
alanine dehydrogenase
vector
dehydrogenase mutant
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202311704466.5A
Other languages
Chinese (zh)
Other versions
CN117402846A (en
Inventor
贾子樊
吴计划
张雅萍
孔令晓
任一臻
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wanhua Chemical Group Co Ltd
Original Assignee
Wanhua Chemical Group Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wanhua Chemical Group Co Ltd filed Critical Wanhua Chemical Group Co Ltd
Priority to CN202311704466.5A priority Critical patent/CN117402846B/en
Publication of CN117402846A publication Critical patent/CN117402846A/en
Application granted granted Critical
Publication of CN117402846B publication Critical patent/CN117402846B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C12N9/0016—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with NAD or NADP as acceptor (1.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
    • C12Y104/01001—Alanine dehydrogenase (1.4.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Abstract

The invention discloses an L-alanine dehydrogenase mutant and a preparation method and application thereof. The amino acid sequence of the L-alanine dehydrogenase mutant comprises any one of the following sequences: (1) A sequence having a G161K mutation based on the sequence shown in SEQ ID NO. 3; or, (2) a sequence obtained by substituting, deleting or adding one or at least two amino acid residues from the sequence as described in (1) and functionally identical or similar to the sequence as described in (1); or, (3) a sequence which has at least 90% sequence identity to the sequence of (1) or (2) and which is functionally identical or similar to the sequence of (1). The L-alanine dehydrogenase mutant provided by the invention has high catalytic activity, can improve the yield of L-alanine, and has higher industrial application value.

Description

L-alanine dehydrogenase mutant and preparation method and application thereof
Technical Field
The invention belongs to the technical field of genetic engineering, and relates to an L-alanine dehydrogenase mutant, a preparation method and application thereof.
Background
Alanine is mainly classified into α -alanine and β -alanine, and α -alanine is classified into L-alanine, D-alanine and DL-alanine, and among the above alanine, L-alanine is used in a relatively large amount. L-alanine is mainly used in daily chemical, medicine, food and feed fields. In the field of daily chemicals, L-alanine is mainly used for synthesizing a novel green chelating agent MGDA and an amino acid surfactant; in the field of medicine, vitamin B6, proglutide, ofloxacin and the like can be synthesized; in the food field, L-alanine is mainly used as a food flavoring agent. The existing L-alanine production methods include natural extraction, chemical synthesis, enzyme and biological fermentation. The natural extraction method and the chemical synthesis method have high production cost and heavy environmental pollution; the raw material of the enzyme method is fumaric acid from petroleum base, and the L-alanine is obtained after two steps of catalysis by enzyme, so that the method is friendly to the environment, but has higher production cost; the biological fermentation method is a current large-scale production method, has lower production cost and is more environment-friendly.
The raw material of the biological fermentation method is glucose, and L-alanine can be obtained through aerobic or anaerobic fermentation, and the production cost of the biological fermentation method is lowest compared with other methods, but the production efficiency is still lower compared with organic acid fermentation, and one of the reasons is lower efficiency of L-alanine dehydrogenase. The invention patent application CN108707617A discloses a method for obtaining L-alanine dehydrogenase synthetic gene and application in constructing high-yield L-alanine genetic engineering bacteria, comprising knocking out D-lactate dehydrogenase gene, pyruvate formate lyase gene and alanine racemase gene of escherichia coli chromosome, inserting the prepared L-alanine dehydrogenase synthetic gene between homologous arm of target gene alanine racemase gene and FRT sequence of pKD3,general purpose medicinePerforming gene replacement by RED homologous recombination technology, eliminating a selection marker gene, and simultaneously leaving the L-alanine dehydrogenase artificially synthesized gene at an alanine racemase gene locus; wherein the marker gene is chloramphenicol resistance gene, and the yield of the constructed engineering bacterium L-alanine is 5.18 mg/mL.
At present, how to increase the yield of L-alanine is still one of the problems to be solved in the field of alanine production and application.
Disclosure of Invention
Aiming at the defects and actual demands of the prior art, the invention provides an L-alanine dehydrogenase mutant, a preparation method and application thereof, so as to improve the catalytic efficiency of the L-alanine dehydrogenase and realize the efficient production of L-alanine.
In order to achieve the above purpose, the invention adopts the following technical scheme:
in a first aspect, the present invention provides an L-alanine dehydrogenase mutant, the amino acid sequence of which comprises any one of the following sequences:
(1) A sequence having a G161K mutation based on the sequence shown in SEQ ID NO. 3; or alternatively, the first and second heat exchangers may be,
(2) A sequence obtained by substituting, deleting or adding one or at least two amino acid residues of the sequence of (1) and functionally identical or similar to the sequence of (1); or alternatively, the first and second heat exchangers may be,
(3) A sequence having at least 90% sequence identity to the sequence of (1) or (2) and functionally identical or similar to the sequence of (1).
The L-alanine dehydrogenase is cloned from Pseudomonadota bacterium, the catalytic activity is improved after mutation, and compared with other L-alanine dehydrogenases, the production efficiency is improved greatly, and the method has good industrial application value.
In the present invention, a specific mutation is introduced into a wild type L-alanine dehydrogenase, glycine is changed into lysine at position 161 to obtain an L-alanine dehydrogenase mutant, and the catalytic activity of the L-alanine dehydrogenase mutant can be improved, and it is understood that on the basis of the L-alanine dehydrogenase mutant, one or at least two amino acid residues can be substituted, deleted or added by using a general technical means in the art to obtain other sequences with the same or similar functions.
In some embodiments of the invention, in addition to introducing the G161K mutation, conservative substitutions of amino acids may be further made at other sites, so that the mutated L-alanine dehydrogenase has more excellent substrate specificity. Preferably, the conservative substitution of the amino acid retains the substrate specificity of the L-alanine dehydrogenase mutant of the present invention. It will be apparent to those skilled in the art that such substitutions may occur in areas other than those described above, while still retaining the corresponding activity. Preferably, the conservative substitution variant has an amino acid conservative substitution of at least one position. Examples of conservative substitutions are those within the following amino acid groups: basic amino acids (e.g., arginine, lysine, and histidine), acidic amino acids (e.g., glutamic acid and aspartic acid), polar amino acids (e.g., glutamine, asparagine), hydrophobic amino acids (e.g., leucine, isoleucine, and valine), aromatic amino acids (e.g., phenylalanine, tryptophan, and tyrosine), and small molecule amino acids (e.g., glycine, alanine, serine, threonine, and methionine). The most common amino acid exchanges are amino acids G to a; a to G, S; v to I, L, A, T or S; i to V, L or M; l to I, M or V; m to L, I or V; p to A, S or N; f to Y, W or H; y to F, W or H; w to Y, F or H; r to K, E or D; k to R, E or D; h to Q, N, S; d to N, E, K, R or Q; e to Q, D, K, R or N; s to T or A; t to S, V or A; c to S, T or A; n to D, Q, H or S; the interchange of Q to E, N, H, K or R, and their inverse interchange. An L-alanine dehydrogenase mutant having an amino acid homology with the amino acid sequence of the above L-alanine dehydrogenase mutant, preferably having a homology of 70% to 99%, more preferably having a homology of 80% to 99%, still more preferably having a homology of 90% to 99%, most preferably having a homology of 99%, shall also fall within the scope of the present invention.
In the present invention, the term "identity" may be assessed by the naked eye or by computer software, such as the software program described in Ausubel et al eds. (2007) in Current Protocols in Molecular Biology. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position. The identity between two or more sequences may be expressed in percent (%), which may be used to evaluate the identity between related sequences. A polynucleotide sequence or amino acid sequence has a percentage (e.g., 90%, 95%, 98%, or 99%) of "sequence identity" with another sequence, meaning that when the sequences are aligned, the percentage of bases or amino acids in the two sequences that are compared are identical.
SEQ ID NO. 3 (amino acid sequence of wild-type L-alanine dehydrogenase):
MLIGCPKEIKPQEFRVGLMPSAVFELTERGHQVMMETNAGTGAGFSDEDYTSAGAEIVATAKEVFDRADMIVKVKEPQSGERAMLREGQLLFTYLHLAPDPDQTHDLLNSGCTAIAYETVTDNNGGLPLLAPMSEVAGRLAPQVGSWTLQKANGGRGVLLGGVAGVSPSRVLVIGGGVVGTQAAKVAAGMGADVTVLDRSVNRLRYLDDVFGGTFKNAYATKAITAELAAQADLIIGAVLVPGAAAPKLITRAQLSDLKPGAALVDVAIDQGGCFETSRATTHQDPIYEVDGIMHYCVANMPGAVARTSTQALGNATLPFVIA。
in a second aspect, the invention provides a nucleic acid molecule, characterized in that it encodes an L-alanine dehydrogenase mutant according to the first aspect.
Preferably, the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.
Preferably, the nucleic acid molecule comprises the sequence shown in SEQ ID NO. 4, or a sequence which has more than 90% identity to SEQ ID NO. 4 and encodes the L-alanine dehydrogenase mutant.
SEQ ID NO: 4：
ATGCTGATCGGCTGTCCAAAAGAAATCAAACCGCAAGAGTTCCGCGTCGGCCTGATGCCATCTGCCGTTTTCGAACTGACCGAGCGTGGCCACCAAGTGATGATGGAAACCAATGCGGGCACCGGTGCTGGTTTCTCTGACGAAGACTACACCAGCGCAGGTGCTGAAATTGTCGCAACCGCGAAGGAAGTTTTCGATCGTGCAGACATGATCGTTAAGGTTAAAGAGCCGCAGTCTGGTGAACGTGCAATGCTGCGTGAAGGTCAGCTGCTGTTCACCTATCTGCATCTGGCTCCGGACCCGGACCAGACTCACGACCTGCTGAACTCCGGTTGCACGGCGATTGCTTACGAAACCGTTACCGACAACAACGGTGGTCTGCCGCTGCTGGCTCCAATGAGCGAAGTTGCTGGCCGTCTGGCTCCGCAAGTCGGTTCCTGGACGCTGCAAAAAGCTAACGGCGGCCGTGGTGTACTGCTGaaaGGTGTGGCAGGTGTTTCCCCGTCTCGCGTGCTGGTAATCGGCGGCGGTGTTGTTGGTACTCAAGCAGCAAAAGTCGCCGCAGGTATGGGTGCCGATGTGACCGTGCTGGACCGTTCCGTAAACCGCCTGCGTTATCTGGACGATGTATTCGGTGGTACGTTCAAGAATGCTTACGCCACCAAGGCTATCACTGCTGAGCTGGCTGCGCAGGCGGACCTGATCATCGGTGCAGTTCTGGTGCCGGGTGCTGCCGCTCCAAAACTGATCACCCGTGCTCAGCTGAGCGATCTGAAACCGGGTGCAGCGCTGGTAGACGTAGCTATTGATCAGGGCGGCTGCTTCGAAACTTCTCGCGCTACTACGCACCAGGACCCGATCTACGAAGTTGACGGTATCATGCACTACTGTGTAGCCAACATGCCGGGTGCAGTTGCTCGTACTTCTACTCAAGCTCTGGGCAATGCAACTCTGCCATTCGTTATCGCT。
SEQ ID NO. 5 (amino acid sequence of G161K of L-alanine dehydrogenase):
MLIGCPKEIKPQEFRVGLMPSAVFELTERGHQVMMETNAGTGAGFSDEDYTSAGAEIVATAKEVFDRADMIVKVKEPQSGERAMLREGQLLFTYLHLAPDPDQTHDLLNSGCTAIAYETVTDNNGGLPLLAPMSEVAGRLAPQVGSWTLQKANGGRGVLLKGVAGVSPSRVLVIGGGVVGTQAAKVAAGMGADVTVLDRSVNRLRYLDDVFGGTFKNAYATKAITAELAAQADLIIGAVLVPGAAAPKLITRAQLSDLKPGAALVDVAIDQGGCFETSRATTHQDPIYEVDGIMHYCVANMPGAVARTSTQALGNATLPFVIA。
in a third aspect, the invention provides a recombinant vector comprising a nucleic acid molecule according to the second aspect.
In a fourth aspect, the present invention provides a recombinant cell comprising the recombinant vector of the third aspect.
In some embodiments, the starting strain of the recombinant cell is a strain that may be E.coli (e.g., BL21 (DE 3)).
The L-alanine dehydrogenase provided by the invention can be synthesized artificially or obtained by synthesizing the coding gene and then biologically expressing the coding gene, for example, the coding gene can be obtained by expressing the coding gene from a prokaryotic host (such as escherichia coli) or a eukaryotic host (such as yeast) by using a recombinant technology.
In a fifth aspect, the present invention provides a method for producing the L-alanine dehydrogenase mutant of the first aspect, comprising:
inserting a nucleic acid molecule encoding the L-alanine dehydrogenase mutant according to the first aspect into an expression vector to obtain a recombinant vector, introducing the recombinant vector into a host cell, and culturing, separating and purifying to obtain the L-alanine dehydrogenase mutant.
Preferably, the expression vector comprises any one of pRSFDuet-1 vector, pETDuet-1 vector, pACYCDuet-1 vector, pTrc99a vector or pET28a vector.
Preferably, the host cell comprises any one of E.coli, yeast, C.glutamicum, B.subtilis, and the like.
Preferably, the E.coli includes E.coli BL21 (DE 3), E.Coli Rosetta (DE 3), E.Coli BL21 (DE 3) plysS, E.Coli M15 or E.Coli Top10f', etc.
Preferably, the preparation method of the nucleic acid encoding the L-alanine dehydrogenase mutant comprises: codon optimization is carried out on a wild L-alanine dehydrogenase gene (SEQ ID NO: 1) to obtain a gene shown in SEQ ID NO: 2 so as to improve the expression efficiency of the gene, the gene shown in SEQ ID NO: 2 is inserted into an expression vector, and G161K mutation is introduced on the gene shown in SEQ ID NO: 2 by taking the inserted vector as a template.
In the present invention, the method of culturing recombinant cells and the method of isolating L-alanine dehydrogenase from the culture are all conventional methods in the art. The medium used when the recombinant cell expresses the L-alanine dehydrogenase may be a medium which is known in the art to grow the recombinant cell and produce the L-alanine dehydrogenase of the present invention, and is preferably an LB medium.
The culture method and culture conditions are not particularly required as long as the recombinant cells can be grown normally and the L-alanine dehydrogenase can be expressed.
In a sixth aspect, the invention provides the use of the L-alanine dehydrogenase mutant of the first aspect, the nucleic acid molecule of the second aspect, the recombinant vector of the third aspect, the recombinant cell of the fourth aspect or the method for producing an L-alanine dehydrogenase mutant of the fifth aspect in the production of L-alanine.
In a seventh aspect, the present invention provides a method for producing L-alanine, the method comprising:
the L-alanine is obtained by catalyzing a substrate with the L-alanine dehydrogenase mutant of the first aspect.
Preferably, the substrate comprises glucose.
Preferably, the method for preparing L-alanine specifically comprises the following steps:
inserting a nucleic acid molecule encoding the L-alanine dehydrogenase mutant according to the first aspect into an expression vector to obtain a recombinant vector, introducing the recombinant vector into a host cell, and performing fermentation and L-alanine separation and purification to obtain L-alanine.
Preferably, the fermentation comprises an aerobic fermentation stage and an anaerobic fermentation stage.
Preferably, the fermentation conditions of the aerobic fermentation stage include: the dissolved oxygen value (DO) is more than 30%, the temperature is 35-42 ℃ (such as 36 ℃,37 ℃, 38 ℃, 39 ℃, 40 ℃ or 41 ℃), and the pH is 6.0-7.2, including but not limited to 6.2, 6.4, 6.6, 6.8, 7 or 7.1.
In some embodiments, initially, the rotational speed is 100 r/min, the ventilation is 0.5 VVM, the temperature is 37 ℃, and the pH is 7.0; ammonia is used to maintain the pH to 7.0 during fermentation; as the bacterial cells continuously grow, dissolved oxygen is continuously reduced, and during the period, the ventilation quantity and the rotating speed are related to DO, so that the DO is maintained to be more than 30%, the highest ventilation quantity is 3VVM, and the highest rotating speed is 1000 r/min.
Preferably, the fermentation conditions of the anaerobic fermentation stage include: OD (optical density) 600 When reaching 10-20 (such as 11, 12, 13, 15, 16, 17, 18 or 19, etc.), IPTG is added to induce protein expression, the concentration of glucose in the culture solution is 20-30 g/L (such as 21 g/L, 22 g/L, 23 g/L, 24 g/L, 25 g/L, 26 g/L, 27 g/L, 28 g/L or 29 g/L, etc.), the dissolved oxygen value is controlled to be lower than 10%, the temperature is 35-42 ℃ (such as 36 ℃,37 ℃, 38 ℃, 39 ℃, 40 ℃, 41 ℃ and the like), and the pH is 6.0-7.2, including but not limited to 6.2, 6.4, 6.6, 6.8, 7, 7.1, and the like.
For example, waiting for OD 600 After 15, IPTG with final concentration of 0.5-mM is added, ammonia water of a pH value regulator is changed into sodium hydroxide, glucose solution is added into the fermentation tank, so that the concentration of glucose in the fermentation tank is between 20 and 30 g/L, DO is maintained to 20%, the temperature is between 35 and 42 ℃, and the pH is between 6.0 and 7.2.
In some embodiments, the fermentation medium used in the fermentation consists of: glucose 5-60 g/L (partial elimination), na 2 HPO 4 ·12H 2 O 15-16 g/L，KH 2 PO 4 2.5-3.5 g/L，NH 4 Cl 0.8-1.2 g/L, naCl 0.4-0.6 g/L, and MgSO 0.01-0.1% (by volume) before fermentation begins 4 (1 mol/L) and 0.01-0.1% (volume ratio) of trace elements; for example, it may be: glucose 40 g/L (partial elimination), na 2 HPO 4 ·12H 2 O 15.11 g/L, KH 2 PO 4 3 g/L，NH 4 Cl 1 g/L, naCl 0.5 g/L, sterilization at 121deg.C for 20 min, adding one thousandth of volume of MgSO before fermentation begins 4 (1 mol/L) and one thousandth of a volume of trace elements.
The microelements can be as follows: feCl 3 ·6H 2 O 2-3 g/L，CoCl 2 ·6H 2 O 0.2-0.4 g/L，CuCl 2 ·2H 2 O 0.1-0.2 g/L，ZnCl 2 0.2-0.4 g/L，Na 2 MO 4 ·2H 2 O 0.2-0.4 g/L，H 3 BO 3 0.07-0.08 g/L，MnCl 2 ·4H 2 O0.49-0.5 g/L; for example, it may be: feCl 3 ·6H 2 O 2.4 g/L，CoCl 2 ·6H 2 O 0.3 g/L，CuCl 2 ·2H 2 O 0.15 g/L，ZnCl 2 0.3 g/L，Na 2 MO 4 ·2H 2 O 0.3 g/L，H 3 BO 3 0.075 g/L，MnCl 2 ·4H 2 O 0.495 g/L。
In some embodiments, the seed fluid inoculum size at fermentation is 5% (v/v), initial OD 600 0.5.
In some embodiments, the medium used in the seed solution culture is LB medium.
Compared with the prior art, the invention has the following beneficial effects:
through rational design, the invention selects proper mutation sites for mutation, improves the catalytic activity of the L-alanine dehydrogenase, improves the yield of the L-alanine, reduces the cost and has higher industrial application value.
Drawings
FIG. 1 is a spectrum of a standard sample of L-alanine;
FIG. 2 is a graph showing L-alanine content of a recombinant bacterium fermentation broth containing a wild-type L-alanine dehydrogenase;
FIG. 3 is a graph showing the L-alanine content of a recombinant bacterium fermentation broth containing an L-alanine dehydrogenase mutant.
Detailed Description
The technical means adopted by the invention and the effects thereof are further described below by referring to the examples and the drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.
The specific techniques or conditions are not identified in the examples and are performed according to techniques or conditions described in the literature in this field or according to the product specifications. The reagents or equipment used were conventional products available for purchase through regular channels, with no manufacturer noted.
Example 1
Codon optimization and total synthesis of gene alds of Pseudomonadota bacterium-derived wild-type L-alanine dehydrogenase: according to the codon preference of the escherichia coli, the gene Ald (SEQ ID NO: 1) of Pseudomonadota bacterium wild-type L-alanine dehydrogenase is subjected to codon optimization, and a DNA fragment shown as SEQ ID NO: 2 is synthesized. The DNA fragment shown in SEQ ID NO. 2 is used for replacing the sequence between NcoI and EcoRI cleavage sites of pRSFDuet-1, and the rest sequences are kept unchanged, so that recombinant plasmid pRSF-Ald is obtained. The recombinant plasmid pRSF-Ald was sequenced and the results were consistent with expectations.
SEQ ID NO: 1：
Atgctaatcggatgcccaaaagagattaaaccacaagaatttcgtgtcggccttatgccaagcgcggtgttcgaactgacagagcgtggccatcaggtgatgatggaaacgaatgcaggaacaggcgcaggtttcagcgacgaagattacacttccgcaggcgcagaaatcgttgccacagcgaaagaagtttttgaccgcgctgacatgattgttaaagtgaaagagccacaatcaggcgaacgtgccatgttgcgcgaaggtcaattgttgtttacatatctacaccttgcaccagaccccgatcaaacacatgacctgttgaacagcggctgcacagcaattgcatatgaaacagtcactgataacaacggtggccttcccctattggccccgatgtcagaagttgcaggtcgtcttgcaccccaagttggttcgtggacattgcaaaaggcaaatggcggccgtggtgtcctactaggtggtgttgcaggcgttagcccatcgcgcgtgttggtcatcggcggtggcgtcgtgggcacgcaggcggccaaggttgcagcgggcatgggcgcggatgtgaccgttttggatcgttccgtcaaccgtttgcgttacttggacgatgtgtttggcggaaccttcaaaaacgcctatgcgactaaggctataacagctgaactagccgcacaggcggatttgatcatcggtgcggttttggtacctggtgcggcggcgccaaaattgatcacacgcgcacagctgtcagatttgaaaccaggtgcggcgttagtggatgttgcgattgaccaaggtgggtgttttgaaacatcgcgcgcgacaacacaccaagacccaatttatgaagtggacggcatcatgcactactgcgtggcgaacatgccaggtgcggttgcgcgcacatccacacaggcactgggcaacgcgacattgccattcgtcatcgca。
SEQ ID NO: 2：
ATGCTGATCGGCTGTCCAAAAGAAATCAAACCGCAAGAGTTCCGCGTCGGCCTGATGCCATCTGCCGTTTTCGAACTGACCGAGCGTGGCCACCAAGTGATGATGGAAACCAATGCGGGCACCGGTGCTGGTTTCTCTGACGAAGACTACACCAGCGCAGGTGCTGAAATTGTCGCAACCGCGAAGGAAGTTTTCGATCGTGCAGACATGATCGTTAAGGTTAAAGAGCCGCAGTCTGGTGAACGTGCAATGCTGCGTGAAGGTCAGCTGCTGTTCACCTATCTGCATCTGGCTCCGGACCCGGACCAGACTCACGACCTGCTGAACTCCGGTTGCACGGCGATTGCTTACGAAACCGTTACCGACAACAACGGTGGTCTGCCGCTGCTGGCTCCAATGAGCGAAGTTGCTGGCCGTCTGGCTCCGCAAGTCGGTTCCTGGACGCTGCAAAAAGCTAACGGCGGCCGTGGTGTACTGCTGGGTGGTGTGGCAGGTGTTTCCCCGTCTCGCGTGCTGGTAATCGGCGGCGGTGTTGTTGGTACTCAAGCAGCAAAAGTCGCCGCAGGTATGGGTGCCGATGTGACCGTGCTGGACCGTTCCGTAAACCGCCTGCGTTATCTGGACGATGTATTCGGTGGTACGTTCAAGAATGCTTACGCCACCAAGGCTATCACTGCTGAGCTGGCTGCGCAGGCGGACCTGATCATCGGTGCAGTTCTGGTGCCGGGTGCTGCCGCTCCAAAACTGATCACCCGTGCTCAGCTGAGCGATCTGAAACCGGGTGCAGCGCTGGTAGACGTAGCTATTGATCAGGGCGGCTGCTTCGAAACTTCTCGCGCTACTACGCACCAGGACCCGATCTACGAAGTTGACGGTATCATGCACTACTGTGTAGCCAACATGCCGGGTGCAGTTGCTCGTACTTCTACTCAAGCTCTGGGCAATGCAACTCTGCCATTCGTTATCGCT。
Example 2
E.coli recombinant strain BL21 (DE 3) -pRSF-Ald was constructed.
100. Mu.L of thawed competent E.coli BL21 (DE 3) and 5. Mu.L of pRSF-Ald plasmid were added to a 1.5mL centrifuge tube (Eppendorf tube), the mixture was subjected to heat shock at 42℃for 90s and ice bath for 30 min, 900. Mu.L of LB medium was added thereto, 1h was cultured with shaking at 37℃and the bacterial solution was spread on LB plates containing 50. Mu.g/mL Amp, and cultured overnight at 37 ℃. And (3) picking a single colony for culture to obtain BL21 (DE 3) -pRSF-Ald.
Example 3
Construction of L-alanine dehydrogenase mutants.
Using pRSF-Ald plasmid as a template, a site-directed mutation was introduced into the Ald gene shown in SEQ ID NO. 2 synthesized in example 1 using Mut Express MultiS Fast Mutagenesis Kit V kit (Nuo Wei, product catalog number C215-01) so that a G161K single point mutation occurred in the amino acid sequence of the wild-type L-alanine dehydrogenase (SEQ ID NO: 3). The primers used were G161H-F ACTGCTGaaaGGTGTGGCAGGTGTTTCCCCGT, G161H-R CCACACCtttCAG CAGTACACCACGGCCGCCG. Recombinant bacteria containing the mutated L-alanine dehydrogenase were constructed as described in example 2.
Example 4
And detecting the catalytic activity of the L-alanine dehydrogenase.
LB solid culture medium, yeast extract 5 g/L, tryptone 10 g/L, naCl 10 g/L, agar 15 g/L and pH 7.0. Sterilizing at 121deg.C for 20 min.
LB medium: yeast extract 5 g/L, tryptone 10 g/L, naCl 10 g/L, pH 7.0. Sterilizing at 121deg.C for 20 min.
Microelement FeCl 3 ·6H 2 O 2.4 g/L，CoCl 2 ·6H 2 O 0.3 g/L，CuCl 2 ·2H 2 O 0.15 g/L，ZnCl 2 0.3 g/L，Na 2 MO 4 ·2H 2 O 0.3 g/L，H 3 BO 3 0.075 g/L，MnCl 2 ·4H 2 O0.495 g/L. Sterilizing at 121deg.C for 30 min.
Fermentation medium: glucose 40 g/L (partial elimination), na 2 HPO 4 ·12H 2 O 15.11 g/L, KH 2 PO 4 3 g/L，NH 4 Cl 1 g/L, naCl 0.5 g/L, sterilization at 121deg.C for 20 min, adding one thousandth of volume of MgSO before fermentation begins 4 (1 mol/L) and one thousandth of a volume of trace elements.
1. Activating strains: each recombinant strain constructed in examples 2 and 3 preserved at-80 ℃ is streaked on LB solid medium, and then placed in an incubator at 37 ℃ for activation culture 13 h, and single colony is selected and inoculated into seed medium.
2. Seed liquid culture: the seed culture medium is LB culture medium, and the inoculated seed culture medium is cultured in a shaking table at 220 r/min and 37 ℃ for 11 h, so that the OD of the seed culture medium 600 Reaching more than 2. The seed liquid at this time may be inoculated into the fermentation medium.
3. 3L fermenter culture: the liquid loading of the 3L fermenter was 1.5. 1.5L, and the pH of the sterilized fermentation medium was about 7. The DO value in the fermenter was calibrated to 100% prior to fermentation. At this time, the seed solution was inoculated into the fermentation medium in an amount of 5% (v/v), initial OD 600 0.5. Initially, the conditions were set as: the rotation speed is 100 r/min, the ventilation rate is 0.5 VVM, the temperature is 37 ℃, and the pH value is 7.0. Ammonia was used to maintain the pH to 7.0 during fermentation. As the dissolved oxygen is continuously reduced due to the continuous growth of the thalli, the ventilation quantity and the rotating speed are related to DO during the period, so that DO is maintained to be more than 30%, the highest value of the ventilation quantity is 3VVM, and the highest value of the rotating speed1000 r/min. Waiting for OD 600 After 15, IPTG with a final concentration of 0.5. 0.5 mM is added until the OD reaches 30-35, and 600 g/L of glucose is added to the fermenter so that the concentration of glucose in the fermenter is between 20-30 g/L, ventilation is closed, the rotation speed is reduced to 100 r/min, and thus alanine fermentation is started for 30 hours.
Measurement of glucose: after centrifugation of the fermentation broth, the supernatant was diluted to a range of 0-1 g/L and measured using a biosensor SBA-40D.
OD measurement: in the aerobic growth stage, the fermentation broth is diluted to a proper multiple by pure water and measured by an ultraviolet spectrophotometer, and the wavelength is 600 nm.
Measurement of L-alanine: high performance liquid chromatography, wherein 2.4-Dinitrofluorobenzene (DNFB) is taken as a derivatization reagent, a chromatographic column is InerSustin-C18, a mobile phase A is pure acetonitrile, and a mobile phase B is acetonitrile: water=1:1, mobile phase C was 50mM sodium acetate, gradient elution, flow rate 1mL/min, uv absorbance detector, detection wavelength 360nm, column temperature 30 ℃.
According to detection, the spectrum of a standard sample of L-alanine is shown in figure 1, the spectrum of L-alanine in recombinant bacterium fermentation broth containing wild type L-alanine dehydrogenase is shown in figure 2, the spectrum of L-alanine in recombinant bacterium fermentation broth containing L-alanine dehydrogenase mutant is shown in figure 3, the yield of L-alanine of recombinant bacterium transformed into wild type L-alanine dehydrogenase is 60G/L, the yield of L-alanine of recombinant bacterium transformed into L-alanine dehydrogenase mutant (G161K) can reach 83G/L, and the yield is obviously improved, which indicates that the L-alanine dehydrogenase mutant designed by the invention has higher industrial application value.
In conclusion, by rational design and selection of proper mutation sites for mutation, the catalytic activity of the L-alanine dehydrogenase is improved, the yield of the L-alanine is further improved, the cost is reduced, and the method has high industrial application value.
The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.

Claims (10)

  1. The L-alanine dehydrogenase mutant is characterized in that the amino acid sequence of the L-alanine dehydrogenase mutant is a sequence with G161K mutation based on the sequence shown in SEQ ID NO. 3.
  2. 2. A nucleic acid molecule encoding the mutant L-alanine dehydrogenase according to claim 1.
  3. 3. The nucleic acid molecule of claim 2, wherein the nucleic acid molecule has a nucleic acid sequence as set forth in SEQ ID NO. 4.
  4. 4. A recombinant vector comprising the nucleic acid molecule of claim 2 or 3.
  5. 5. A recombinant cell comprising the recombinant vector of claim 4, wherein the recombinant cell is a non-plant cell.
  6. 6. The method for producing an L-alanine dehydrogenase mutant according to claim 1, wherein the method comprises:
    inserting a nucleic acid molecule encoding the L-alanine dehydrogenase mutant according to claim 1 into an expression vector to obtain a recombinant vector, introducing the recombinant vector into a host cell, culturing, separating and purifying to obtain the L-alanine dehydrogenase mutant.
  7. 7. The method for producing an L-alanine dehydrogenase mutant according to claim 6, wherein the expression vector comprises any one of pRSFDuet-1 vector, pETDuet-1 vector, pACYCDuet-1 vector, pTrc99a vector or pET28a vector;
    the host cell comprises any one of escherichia coli, yeast, corynebacterium glutamicum or bacillus subtilis;
    the Escherichia coli includes Escherichia coliE.Coli BL21（DE3）、E.Coli Rosetta(DE3)，E.Coli BL21(DE3)plysS，E.Coli M15 orE.Coli Top10 f'.
  8. 8. Use of the L-alanine dehydrogenase mutant according to claim 1, the nucleic acid molecule according to claim 2 or 3, the recombinant vector according to claim 4, the recombinant cell according to claim 5 or the method for producing an L-alanine dehydrogenase mutant according to claim 6 or 7 for producing L-alanine.
  9. 9. A method for producing L-alanine, comprising:
    the L-alanine is obtained by catalyzing a substrate with the L-alanine dehydrogenase mutant of claim 1.
  10. 10. The method of producing L-alanine according to claim 9, wherein the substrate comprises glucose;
    the method for preparing L-alanine specifically comprises the following steps:
    inserting a nucleic acid molecule encoding the L-alanine dehydrogenase mutant of claim 1 into an expression vector to obtain a recombinant vector, introducing the recombinant vector into a host cell, and fermenting and separating and purifying the L-alanine to obtain the L-alanine.
CN202311704466.5A 2023-12-13 2023-12-13 L-alanine dehydrogenase mutant and preparation method and application thereof Active CN117402846B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311704466.5A CN117402846B (en) 2023-12-13 2023-12-13 L-alanine dehydrogenase mutant and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311704466.5A CN117402846B (en) 2023-12-13 2023-12-13 L-alanine dehydrogenase mutant and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN117402846A CN117402846A (en) 2024-01-16
CN117402846B true CN117402846B (en) 2024-02-13

Family

ID=89487390

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311704466.5A Active CN117402846B (en) 2023-12-13 2023-12-13 L-alanine dehydrogenase mutant and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN117402846B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103074309A (en) * 2012-09-11 2013-05-01 河北师范大学 L-alanine dehydrogenase mutant zymoprotein and preparation method thereof
CN116286703A (en) * 2023-05-25 2023-06-23 鲁东大学 L-alanine dehydrogenase mutant, engineering bacterium and application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103074309A (en) * 2012-09-11 2013-05-01 河北师范大学 L-alanine dehydrogenase mutant zymoprotein and preparation method thereof
CN116286703A (en) * 2023-05-25 2023-06-23 鲁东大学 L-alanine dehydrogenase mutant, engineering bacterium and application

Also Published As

Publication number Publication date
CN117402846A (en) 2024-01-16

Similar Documents

Publication Publication Date Title
JP5069032B2 (en) Improved nitrile hydratase
CN108795916B (en) Lysine decarboxylase mutant, coding gene thereof, expression and application thereof
JP4916709B2 (en) Improved nitrile hydratase
CN111019878B (en) Recombinant escherichia coli with improved L-threonine yield as well as construction method and application thereof
CN112391372B (en) Glutamic acid decarboxylase mutant, genetically engineered bacterium and application thereof
CN114196646B (en) Olive alcohol synthetase variant A and application thereof
TWI777324B (en) Modified DAAO enzymes and their applications
US10053716B2 (en) 4-amino cinnamic acid production method using enzyme
CN117402846B (en) L-alanine dehydrogenase mutant and preparation method and application thereof
CN114032224B (en) 5-aminolevulinic acid synthetase mutant, host cell and application thereof
CN110904062B (en) Strain capable of producing L-alanine at high yield
KR101368922B1 (en) Recombinant microorganism and method for producing l-lysine
GB2433507A (en) Hydrogen production by means of a cell expression system
CN110862952B (en) 5-aminolevulinic acid production strain and construction method and application thereof
CN114806913A (en) High-yield succinic acid yeast engineering strain with mitochondrion positioning reduction TCA (trichloroacetic acid) approach as well as construction method and application thereof
CN110157691B (en) 5-amino-acetopropionic acid synthetase mutant and host cell and application thereof
CN115261293B (en) Genetically engineered bacterium for producing hydroxy adipic acid
CN117384875A (en) L-alanine dehydrogenase and preparation method and application thereof
JP2010057396A (en) New microorganism having putrescine synthesis ability, putrescine synthesis gene and production method of putrescine
CN117683758A (en) Alpha-keto acid decarboxylase mutant and preparation method and application thereof
CN117402861A (en) L-lysine decarboxylase derived from Pseudomonas mendocina and application thereof
CN116286701A (en) Rhodococcus oparius L-amino acid oxidase mutant and application thereof
CN116656634A (en) Dioxygenase mutant and application thereof in synthesis of (2S, 3R) -3-hydroxy piperidine acid
WO2024077428A1 (en) Enzyme with d-amino acid synthesis activity and use thereof
CN114276970A (en) Gene engineering bacterium for producing 1, 3-propylene glycol

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant