CN116286703A - L-alanine dehydrogenase mutant, engineering bacterium and application - Google Patents
L-alanine dehydrogenase mutant, engineering bacterium and application Download PDFInfo
- Publication number
- CN116286703A CN116286703A CN202310593931.6A CN202310593931A CN116286703A CN 116286703 A CN116286703 A CN 116286703A CN 202310593931 A CN202310593931 A CN 202310593931A CN 116286703 A CN116286703 A CN 116286703A
- Authority
- CN
- China
- Prior art keywords
- alanine dehydrogenase
- mutant
- alanine
- dehydrogenase mutant
- glycine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
- C12N9/0016—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with NAD or NADP as acceptor (1.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
- C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
- C12Y104/01001—Alanine dehydrogenase (1.4.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/185—Escherichia
- C12R2001/19—Escherichia coli
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/584—Recycling of catalysts
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses an L-alanine dehydrogenase mutant, engineering bacteria and application thereof, belonging to the technical field of biology, wherein the mutant is obtained by multi-site mutation of 129 th and 299 th positions of an amino acid sequence of an initial L-alanine dehydrogenase, in particular to mutation of 129 th leucine into phenylalanine and mutation of 299 th alanine into serine. Compared with the original L-alanine dehydrogenase, the mutant can catalyze the glyoxylate to generate glycine, the yield of the glyoxylate to generate glycine is obviously improved, the conversion concentration of the glycine product is 18.7g/L, the molar conversion rate is 92.2%, and the mutant has a certain industrial application prospect.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an L-alanine dehydrogenase mutant, engineering bacteria, and application of the L-alanine dehydrogenase mutant, the engineering bacteria and the application of the L-alanine dehydrogenase mutant.
Background
Glycine, also known as glycine, is one of the human non-essential amino acids, and is an alpha-amino acid with minimal relative molecular mass and the simplest molecular structure. Glycine is an important intermediate in fine chemical industry, and has wide application range including pesticide, medicine, food, animal feed, daily chemical product and other industries. The glycine synthesis methods at home and abroad mainly comprise chloroacetic acid ammonolysis method, schterkey (Strecker) method, hydroxyacetonitrile process, direct hydantoin method and biological synthesis method. The glycine is produced on a large scale mainly by chloroacetic acid ammonolysis in the domestic industry, and the defects of high production cost, low product purity, heavy environmental pollution and the like exist. As downstream product development is increasingly demanding on glycine quality, so is the production process of glycine.
The biosynthesis method is a method for synthesizing glycine by utilizing various microorganisms, has the advantages of high selectivity, high product yield, mild reaction conditions, no pollution to the environment and the like, and is the most potential method at present. Domestic and foreign researchers are striving to develop microorganisms and fermentation technology for the efficient synthesis of glycine, such as enhancing the expression of genes encoding enzymes involved in amino acid biosynthesis in strains of corynebacteria or deleting genes unnecessary for amino acid biosynthesis. After 90 th century, a certain company in Japan reacts microorganisms such as pseudocell genus, casein genus and alcaligenes genus with glycinamide for 45 hours at 30 ℃ and pH value of 7.9-8.1, so that the glycinamide is hydrolyzed and converted into glycine, and the conversion rate is up to 99%. The domestic scholars Zhang Zhenshu and the like mutate ATP phosphoribosyl transferase (HisG) by genetic means, so that the capacity of producing glycine by corynebacterium microorganisms is improved by nearly 2 times. However, in the whole, the technology of biosynthesis of glycine is still in the preliminary research stage, and is limited to laboratory development and research, and many technical problems still need to be overcome, such as searching for efficient active enzymes with wide application range, more effective genetic modification means and the like.
The L-alanine dehydrogenase reversibly catalyzes the oxidative deamination of alanine to pyruvate, while reducing NAD+ to NADH. Since the identification of L-alanine dehydrogenase in 1955, many studies have been reported on L-alanine dehydrogenase, and particularly in recent years, the spatial structure of the enzyme protein is resolved by a crystal structure, which provides more favorable conditions for further elucidating the catalytic mechanism of L-alanine dehydrogenase.
Disclosure of Invention
The invention aims to provide an L-alanine dehydrogenase mutant, recombinant bacterium and whole cells thereof as catalysts for synthesizing glycine.
The invention is realized by the following technical scheme:
the invention provides an L-alanine dehydrogenase mutant, which is characterized in that the mutant is shown in SEQ ID NO:2, specifically, the 129 th leucine is mutated into phenylalanine and the 299 th alanine is mutated into serine, namely, the L-alanine dehydrogenase mutant AlaDH-L129F-A299S.
Further, the nucleotide sequence of the L-alanine dehydrogenase is shown as SEQ ID NO. 1.
The L-alanine dehydrogenase is derived from bacillus stearothermophilusGeobacillus stearothermophilus）。
The invention also relates to a coding gene of the L-alanine dehydrogenase mutant.
The invention provides engineering bacteria containing the coding gene.
The invention also provides application of the L-alanine dehydrogenase mutant in catalyzing glyoxylate to synthesize glycine.
Further, the application method is that the bacterial cells obtained by fermenting and centrifuging engineering bacteria containing L-alanine dehydrogenase mutant genes are used as a whole cell catalyst, glyoxylic acid and ammonium ions are used as substrates, NADH is used as coenzyme, glucose dehydrogenase catalyzes glucose to regenerate coenzyme NADH, ammonia water is used for regulating pH to 7.0-8.0, and the reaction is carried out for 4-10 hours at the temperature of 20-45 ℃ to produce glycine.
Further, in the conversion system, the catalyst is used in an amount of 5 to 30g/L based on the weight of wet bacteria, and the concentration of the substrate glyoxylate is 5 to 20g/L.
Further, the engineering bacteria containing the L-alanine dehydrogenase mutant gene are prepared according to the following method: inoculating recombinant escherichia coli containing the L-alanine dehydrogenase mutant gene into LB slant culture, and culturing for 12-16 h based on a 37 ℃ incubator; inoculating strain in LB liquid seed culture medium, shake culturing at 37deg.C and 200r/min for 4-10 hr; inoculating the seed liquid into a fermentation culture medium according to the volume ratio of 1-10%, placing the seed liquid into a fermentation tank for culturing, wherein the initial rotating speed is 200r/min, the initial ventilation flow is 1.0L/min, the rotating speed and the ventilation flow are regulated along with the increase of the thallus concentration so as to maintain 28-32% of air saturation, regulating the pH value to be 6.7-7.0 by ammonia water, culturing at 37 ℃ for 6-10 h, adding lactose to the final concentration of 2-10 g/L, and cooling to 20-30 ℃ for induction expression; and (3) in the fermentation process, glycerol solution is fed in to maintain the glycerol concentration at 1-3 g/L, after fermentation, thalli are collected by centrifugation, and the thalli are washed twice by sterile normal saline, so that the L-alanine dehydrogenase mutant whole-cell catalyst is obtained.
Further, the preparation method of the LB slant culture medium comprises the following steps: mixing yeast extract 5g/L, peptone 10g/L, naCl 5g/L, ampicillin 100mg/L and agar 20g/L, regulating pH to 7.0-7.2, and sterilizing with 121 deg.C high pressure steam for 20 min.
Further, the preparation method of the LB liquid seed culture medium comprises the following steps: mixing yeast extract 5g/L, peptone 10g/L, naCl 5g/L and ampicillin 100mg/L, regulating pH to 7.0-7.2, and sterilizing with 121 deg.C high pressure steam for 20 min.
Further, the preparation method of the fermentation medium comprises the following steps: 15 g g/L glycerol, 5g g/L succinic acid, 12 g g/L peptone, 5g g/L, mgSO yeast extract 4 2 g/L、KH 2 PO 4 13 g/L、NH 4 Cl 3g/L, soybean meal hydrolysate 2g/L and vitamin B 1 50. μg/L and ZnSO 4 Mixing 0.1mg/L, regulating pH to 6.8-7.2, and sterilizing with high pressure steam at 121deg.C for 20 min.
Compared with the prior art, the invention has the beneficial effects that: the L-alanine dehydrogenase mutant constructed by the invention has obviously improved enzyme activity for catalyzing glyoxylate reductive amination reaction compared with the original enzyme activity, can be used for synthesizing glycine, has the highest concentration of 18.7g/L and the conversion rate of 92.2 percent, and has the application prospect of industrial development.
Detailed Description
The technical scheme of the present invention is further explained by examples below, but the scope of the present invention is not limited in any way by the examples.
Example 1: and (5) constructing an expression vector and engineering bacteria. Querying and selecting bacillus stearothermophilus in NCBI database through literature report and gene sequence homologyGeobacillus stearothermophilus) The L-alanine dehydrogenase (GenBank: WP_ 011232226.1) of (1) is synthesized by total genes (the gene sequence is SEQ ID No. 1, the amino acid sequence is SEQ ID No. 2), primers are designed, PCR amplification is carried out by homologous recombination, and subcloning is carried out to the corresponding site of the vector pET32a, thus obtaining recombinant plasmid pET32a-AlaDH. Recombinant E.coli BL21 (DE 3)/pET 32a-AlaDH expressing L-alanine dehydrogenase was obtained by heat shock transformation of E.coli BL21 (DE 3).
The recombinant vector pET32a-AlaDH is used as a template, and an error-prone PCR technology is utilized to construct a random mutation library. The forward primer AlaDH-F is 5'-acgacgacgacaaggccatggctatgaagatcggcattccaaaag-3', (acgacgacgacaaggccatggct is homology arm), and the reverse primer AlaDH-R is 5' -tcagtggtggtggtggtggtgc
tcgagtcatccctgcagcaacgaatg-3' (tcagtggtggtggtggtggtgctcgag is a homology arm). The reaction system of error-prone PCR is: PCR Grade Water 39. Mu.L, 10X TITANIUM Taq Buffer. Mu.L, mnSO 4 (8 mM) 1. Mu.L, dGTP (2 mM) 1. Mu.L, 50X Diversify dNTP Mix 1. Mu.L, primer mix 1. Mu.L, template 1. Mu.L, TITANIUM Taq Polym. Mu.L, and a total of 50. Mu.L of the system (wherein Primer mix in the reaction system is a mixed solution of 0.5. Mu.L of each of the upstream and downstream primers). The error-prone PCR reaction conditions were: 94 ℃ for 30s,1 cycle; 94℃30s,68℃1min30s,25 cycles; 1min at 68℃for 1 cycle. The error-prone PCR amplified product was detected with 1% agarose gel and purified with AxyPrep DNA gel recovery kit. Purified fragments and double digested vector pET32a (Nco I and Xho I) carries out homologous recombination reaction, and the reaction system is as follows: 4. mu.L of 5 XCE II Buffer, 2. Mu.L of Exase II, using ddH 2 O was made up to 20. Mu.L. Mixing, fusing at 37deg.C for 30min, immediately cooling on ice for 10min, and then transforming Escherichia coli BL21 (DE 3) to become competent. And culturing for 1h at 37 ℃ under 200r/min for activation, coating the activated recombinant cells on an LB plate containing 100mg/L ampicillin resistance, and culturing for overnight at 37 ℃ in an inverted manner to obtain an L-alanine dehydrogenase mutant expression library.
From the obtained L-alanine dehydrogenase mutant expression library colonies, high activity mutant strains were selected from these single colonies using a high throughput screening method. The specific screening method comprises the following steps: randomly picking 600 single colonies from a flat plate, inoculating into a 96-deep well plate, culturing for 9 hours at 37 ℃ under 200r/min with LB liquid culture medium, centrifugally collecting thalli, removing a supernatant culture medium, adding a fermentation culture medium, culturing for 6 hours at 37 ℃ under 220r/min, adding lactose to a final concentration of 2.0g/L, and cooling to 30 ℃ for induction expression; and (5) centrifugally collecting thalli, and measuring the enzyme activity. Standard enzyme activity detection system: 10g/L wet cell, 50mM substrate glyoxylic acid, 100mM glucose, 400U/mL glucose dehydrogenase, phosphate buffer pH 8.0 as reaction medium, and 1mL total system. Definition of unit enzyme activity: under standard reaction conditions, the amount of enzyme required to produce 1. Mu. Mol glycine per minute is one enzyme activity unit U. Screening to obtain 1 high-activity L-alanine dehydrogenase mutant strain, and sequencing to obtain SEQ ID NO:2 into phenylalanine and serine (AlaDH-L129F-A299S), and the corresponding engineering strains are E.coli BL21 (DE 3)/pET 32 a-AlaDH-L129F-A299S respectively;
TABLE 1L enzyme activities of alanine dehydrogenase mutants
Example 2: the recombinant bacteria are used for fermenting and producing L-alanine dehydrogenase mutant AlaDH-L129F-A299S and converting glyoxylic acid by an enzyme method to produce glycine. (1) Inoculating each mutant strain of the L-alanine dehydrogenase into LB slant culture medium at 37 ℃ for culturing for 14h; inoculating 1-ring inclined plane strain to LB liquid seed culture medium, shake culturing at 37deg.C and 200r/min for 6 hr; filling 2.0L culture medium into a 3L fermentation tank, inoculating seed liquid into the fermentation culture medium at a volume ratio of 5% of inoculation amount, enabling an initial rotation speed to be 200r/min, enabling an initial ventilation flow to be 1.0L/min, adjusting the rotation speed and the ventilation flow along with the increase of the concentration of bacteria so as to maintain a dissolved oxygen value at about 30% of air saturation, adjusting a pH value to be stabilized at 6.8 by using ammonia water with a mass-volume ratio of 25%, culturing at 37 ℃ for 8 h, adding lactose to a final concentration of 6.0g/L, and cooling to 25 ℃ for induction expression; and (3) in the fermentation process, 500g/L of glycerol solution is fed in to maintain the glycerol concentration at 10000 r/min after 2g/L of fermentation is finished, the cells are collected by centrifugation for 10min at 4 ℃, and the cells are washed twice by sterile physiological saline to obtain the L-alanine dehydrogenase mutant whole-cell catalyst respectively.
(2) The L-alanine dehydrogenase mutant E, coll BL21 (DE 3)/pET 32 a-L129F-A299S is used for producing glycine by whole cell catalysis, and the conversion conditions are as follows: glyoxylic acid 10g/L, NADH0.1g/L, ammonium chloride 10g/L, glucose 36g/L, glucose dehydrogenase (commercial) 500000U/L, ammonia water to adjust pH to 7.5, and finally alanine dehydrogenase mutant wet cells 20g/L are respectively added as catalysts, ammonia water is added in the process to adjust pH to be stable at 7.5, and the reaction is carried out for 7 hours at 30 ℃, wherein glycine concentration is 9.6g/L, and molar conversion rate is 94.7%.
Example 3: the recombinant bacteria are used for fermenting and producing L-alanine dehydrogenase mutant AlaDH-L129F-A299S and converting glyoxylic acid by an enzyme method to produce glycine. (1) Inoculating each mutant strain of the L-alanine dehydrogenase into LB slant culture medium at 37 ℃ for culturing for 12 hours; inoculating 1-ring inclined plane strain to LB liquid seed culture medium, shake culturing at 37deg.C and 200r/min for 4 hr; filling 2.0L culture medium into a 3L fermentation tank, inoculating seed liquid into the fermentation culture medium at a volume ratio of 1.0% of inoculum size, starting at a rotation speed of 200r/min and an initial aeration flow of 1.0L/min, regulating the rotation speed and the aeration flow along with the increase of the thallus concentration to maintain the dissolved oxygen value at about 28% of air saturation, regulating the pH value to be stable at 6.7 by using 25% ammonia water at a mass-volume ratio, culturing at 37 ℃ for 6h, adding lactose to a final concentration of 2.0g/L, and cooling to 20 ℃ for induction expression; and (3) in the fermentation process, 500g/L of glycerol solution is fed in to maintain the glycerol concentration at 10000 r/min after the 1g/L fermentation is finished, the cells are collected by centrifugation for 10min at 4 ℃, and the cells are washed twice by sterile physiological saline to obtain the L-alanine dehydrogenase mutant whole-cell catalyst respectively.
The L-alanine dehydrogenase mutant E, coll BL21 (DE 3)/pET 32 a-L129F-A299S is used for producing glycine by whole cell catalysis, and the conversion conditions are as follows: glyoxylic acid 5g/L, NADH0.1g/L, ammonium chloride 10g/L, glucose 18g/L, glucose dehydrogenase (commercial) 500000U/L, ammonia water to adjust pH to 7.0, finally adding L-alanine dehydrogenase mutant wet cells 5g/L as a catalyst, adding ammonia water to adjust pH to be stable at 7.0 during the process, reacting for 4 hours at 20 ℃, wherein glycine concentration is 4.9g/L, and molar conversion rate is 96.6%.
Example 4: the recombinant bacteria are used for fermenting and producing L-alanine dehydrogenase mutant AlaDH-L129F-A299S and converting glyoxylic acid by an enzyme method to produce glycine. (1) Inoculating each mutant strain of the L-alanine dehydrogenase into LB slant culture medium at 37 ℃ for 16h; inoculating 1-ring inclined plane strain to LB liquid seed culture medium, shake culturing at 37deg.C and 200r/min for 10 hr; filling 2.0L culture medium into a 3L fermentation tank, inoculating seed liquid into the fermentation culture medium at a volume ratio of 10% of inoculation amount, enabling an initial rotation speed of 200r/min and an initial ventilation flow of 1.0L/min, adjusting the rotation speed and the ventilation flow along with the increase of the concentration of bacteria so as to maintain the dissolved oxygen value at about 32% of air saturation, adjusting the pH value to be stable at 7.0 by using 25% ammonia water with a mass-volume ratio, culturing at 37 ℃ for 10h, adding lactose to a final concentration of 10.0g/L, and cooling to 30 ℃ for induction expression; and (3) in the fermentation process, 500g/L of glycerol solution is fed in to maintain the glycerol concentration at 10000 r/min after 3g/L of fermentation is finished, the cells are collected by centrifugation at 4 ℃ for 10min, and the cells are washed twice by sterile physiological saline to obtain the L-alanine dehydrogenase mutant whole-cell catalyst respectively.
(2) The L-alanine dehydrogenase mutant E, coll BL21 (DE 3)/pET 32 a-L129F-A299S is used for producing glycine by whole cell catalysis, and the conversion conditions are as follows: glyoxylic acid 20g/L, NADH0.1g/L, ammonium chloride 10g/L, glucose 72g/L, glucose dehydrogenase (commercial) 500000U/L, ammonia water to adjust pH to 8.0, and finally adding 30g/L of L-alanine dehydrogenase mutant wet cells as a catalyst, wherein ammonia water is fed in the process to adjust pH to be stable at 8.0, and the reaction is carried out for 10 hours at 45 ℃, the concentration of glycine is 18.7g/L, and the molar conversion rate is 92.2%.
SEQ ID No .1:
atgaagatcggcattccaaaagaaatcaaaaacaatgaaaaccgcgtcgccatcactccggcaggcgtgatgacgctcgtcaaagcggggcatgacgtgtatgtggagacggaagccggcgctgggtcgggtttttccgattccgagtatgaaaaagccggggcagtgatcgtgacgaaagcggaagatgcctgggcggcggagatggtgttgaaagtgaaagaaccgctggctgaggagttccgctattttcgccccggattgattttgtttacgtatttgcatttagccgcggccgaagcgctcacgaaagcgctcgtcgagcaaaaagtggtcggcatcgcttacgagacggtgcagcttgcgaacggctcgctgccgctgttgacgccgatgagtgaagtcgccggccgcatgtcggtgcaagtcggcgcccagtttctcgagaagccgcacggcgggaaaggcattttgcttggcggcgtgcccggggtgcggcgcggcaaagtgacgatcatcggcggcggcacagcggggacgaacgcggcgaaaatcgcggtcggcctcggggcggacgtgacgattttggacattaacgccgagcggctgcgcgagctcgatgatttgttcggcgaccaagtgacgacgttgatgtccaactcgtatcatatcgccgagtgcgtgcgcgaatccgatttggtcgtcggcgccgtcttgatcccgggggcgaaagcgccgaagcttgtgacggaagagatggtgcgctcgatgacgccaggctcggtgttggtcgacgtcgccattgaccaaggcggcatttttgaaacgaccgaccgcgtcacgacgcacgacgatccgacatacgtcaagcacggcgtcgtccattacgccgtcgcgaacatgccgggcgctgtgccgcgtacgtcaacattcgcgcttacgaacgtcacgatcccatacgccttgcaaatcgccaacaaaggctaccgcgccgcttgcctcgacaatccggcgctgttaaaagggatcaacacgctcgacgggcacatcgtgtacgaagcggtcgcggcggcgcacaacatgccgtatacggatgttcattcgttgctgcagggatga。
SEQ ID No .2：
MKIGIPKEIKNNENRVAITPAGVMTLVKAGHDVYVETEAGAGSGFSDSEYEKAGAVIVTKAEDAWAAEMVLKVKEPLAEEFRYFRPGLILFTYLHLAAAEALTKALVEQKVVGIAYETVQLANGSLPLLTPMSEVAGRMSVQVGAQFLEKPHGGKGILLGGVPGVRRGKVTIIGGGTAGTNAAKIAVGLGADVTILDINAERLRELDDLFGDQVTTLMSNSYHIAECVRESDLVVGAVLIPGAKAPKLVTEEMVRSMTPGSVLVDVAIDQGGIFETTDRVTTHDDPTYVKHGVVHYAVANMPGAVPRTSTFALTNVTIPYALQIANKGYRAACLDNPALLKGINTLDGHIVYEAVAAAHNMPYTDVHSLLQG。
Claims (8)
1. An L-alanine dehydrogenase mutant, characterized in that the mutant is a mutant of the amino acid sequence set forth in SEQ ID NO:2, specifically, the 129 th leucine is mutated into phenylalanine and the 299 th alanine is mutated into serine, namely, the L-alanine dehydrogenase mutant AlaDH-L129F-A299S.
2. The mutant L-alanine dehydrogenase according to claim 1, wherein the nucleotide sequence of the L-alanine dehydrogenase is as shown in SEQ ID NO. 1.
3. An L-alanine dehydrogenase mutant gene encoding the L-alanine dehydrogenase mutant of claim 1.
4. A genetically engineered bacterium, which comprises the L-alanine dehydrogenase mutant gene of claim 3.
5. Use of an L-alanine dehydrogenase mutant according to claim 1 for catalyzing glyoxylate synthesis of glycine.
6. The use of the mutant L-alanine dehydrogenase according to claim 5, wherein the glycine is produced by fermenting and centrifuging the bacterial cells obtained by fermenting and centrifuging the genetically engineered bacteria containing the mutant L-alanine dehydrogenase gene as a whole cell catalyst, glyoxylic acid and ammonium ions as substrates, NADH as a coenzyme, glucose dehydrogenase catalyzing glucose to regenerate the coenzyme NADH, ammonia water adjusting pH to 7.0 to 8.0, and reacting at 20 to 45 ℃ for 4 to 10 hours.
7. The use of the L-alanine dehydrogenase mutant according to claim 6, wherein the catalyst is used in an amount of 5 to 30g/L based on the weight of wet bacteria and the concentration of glyoxylate as a substrate is 5 to 20g/L.
8. The use of the L-alanine dehydrogenase mutant as claimed in claim 6, wherein the engineering bacterium containing the L-alanine dehydrogenase mutant gene is prepared by: inoculating recombinant escherichia coli containing the L-alanine dehydrogenase mutant gene into LB slant culture, and culturing for 12-16 h based on a 37 ℃ incubator; inoculating strain in LB liquid seed culture medium, shake culturing at 37deg.C and 200r/min for 4-10 hr; inoculating the seed liquid into a fermentation culture medium according to the volume ratio of 1-10%, placing the seed liquid into a fermentation tank for culturing, wherein the initial rotating speed is 200r/min, the initial ventilation flow is 1.0L/min, the rotating speed and the ventilation flow are regulated along with the increase of the thallus concentration so as to maintain 28-32% of air saturation, regulating the pH value to be 6.7-7.0 by ammonia water, culturing at 37 ℃ for 6-10 h, adding lactose to the final concentration of 2-10 g/L, and cooling to 20-30 ℃ for induction expression; and (3) in the fermentation process, glycerol solution is fed in to maintain the glycerol concentration at 1-3 g/L, after fermentation, thalli are collected by centrifugation, and the thalli are washed twice by sterile normal saline, so that the L-alanine dehydrogenase mutant whole-cell catalyst is obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310593931.6A CN116286703B (en) | 2023-05-25 | 2023-05-25 | L-alanine dehydrogenase mutant, engineering bacterium and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310593931.6A CN116286703B (en) | 2023-05-25 | 2023-05-25 | L-alanine dehydrogenase mutant, engineering bacterium and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116286703A true CN116286703A (en) | 2023-06-23 |
| CN116286703B CN116286703B (en) | 2023-08-08 |
Family
ID=86826230
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310593931.6A Active CN116286703B (en) | 2023-05-25 | 2023-05-25 | L-alanine dehydrogenase mutant, engineering bacterium and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116286703B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117402846A (en) * | 2023-12-13 | 2024-01-16 | 万华化学集团股份有限公司 | L-alanine dehydrogenase mutant and preparation method and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904062A (en) * | 2018-09-18 | 2020-03-24 | 安徽华恒生物科技股份有限公司 | Strain capable of producing L-alanine at high yield |
| CN111748535A (en) * | 2019-03-28 | 2020-10-09 | 安徽华恒生物科技股份有限公司 | Alanine dehydrogenase mutant and application thereof in fermentation production of L-alanine |
| CN111996178A (en) * | 2020-09-14 | 2020-11-27 | 山东阳成生物科技有限公司 | Histone alcohol phosphate aminotransferase mutant, engineering bacterium and application |
| CN114574417A (en) * | 2022-03-23 | 2022-06-03 | 江南大学 | Strain and method for producing hydroxytyrosol |
| CN114634918A (en) * | 2022-05-19 | 2022-06-17 | 鲁东大学 | D-amino acid oxidase mutant, engineering bacteria and application |
| US20220235333A1 (en) * | 2019-10-11 | 2022-07-28 | Ajinomoto Co., Inc. | Modified Phenylalanine Dehydrogenase |
| CN116064362A (en) * | 2022-12-15 | 2023-05-05 | 浙江大学 | Genetically engineered bacterium for synthesizing 12-amino lauric acid from glucose and construction and application thereof |
-
2023
- 2023-05-25 CN CN202310593931.6A patent/CN116286703B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904062A (en) * | 2018-09-18 | 2020-03-24 | 安徽华恒生物科技股份有限公司 | Strain capable of producing L-alanine at high yield |
| CN111748535A (en) * | 2019-03-28 | 2020-10-09 | 安徽华恒生物科技股份有限公司 | Alanine dehydrogenase mutant and application thereof in fermentation production of L-alanine |
| US20220235333A1 (en) * | 2019-10-11 | 2022-07-28 | Ajinomoto Co., Inc. | Modified Phenylalanine Dehydrogenase |
| CN111996178A (en) * | 2020-09-14 | 2020-11-27 | 山东阳成生物科技有限公司 | Histone alcohol phosphate aminotransferase mutant, engineering bacterium and application |
| CN114574417A (en) * | 2022-03-23 | 2022-06-03 | 江南大学 | Strain and method for producing hydroxytyrosol |
| CN114634918A (en) * | 2022-05-19 | 2022-06-17 | 鲁东大学 | D-amino acid oxidase mutant, engineering bacteria and application |
| CN116064362A (en) * | 2022-12-15 | 2023-05-05 | 浙江大学 | Genetically engineered bacterium for synthesizing 12-amino lauric acid from glucose and construction and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| VASILIS VASILIOU 等: ""Role of aldehyde dehydrogenases in endogenous and xenobiotic metabolism"", 《CHEMICO-BIOLOGICAL INTERACTIONS》, vol. 129, pages 1 - 19 * |
| 陈曦 等: ""氨基酸脱氢酶的催化机理、分子改造及合成应用"", 《微生物学报》, vol. 57, no. 8, pages 1249 - 1261 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117402846A (en) * | 2023-12-13 | 2024-01-16 | 万华化学集团股份有限公司 | L-alanine dehydrogenase mutant and preparation method and application thereof |
| CN117402846B (en) * | 2023-12-13 | 2024-02-13 | 万华化学集团股份有限公司 | L-alanine dehydrogenase mutant and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116286703B (en) | 2023-08-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100529094C (en) | Process for prodn of L-Thr | |
| CN101679964B (en) | Mutant microorganism having high putrescine productivity and method for producing putrescine using the same | |
| CN106566823B (en) | Cloning and application of glutamate decarboxylase gene | |
| CN114634918B (en) | D-amino acid oxidase mutant, engineering bacteria and application | |
| CN116286703B (en) | L-alanine dehydrogenase mutant, engineering bacterium and application | |
| CN109777763A (en) | One plant for the genetic engineering bacterium of L-thiamine production and its building and application | |
| CN112831488B (en) | Glutamic acid decarboxylase and gamma-aminobutyric acid high-yield strain | |
| CN108546698A (en) | A kind of aspartic acid enzyme mutant | |
| CN114015671B (en) | Histone alcohol phosphate aminotransferase mutant 66, engineering bacteria and application | |
| CN113151198A (en) | Mutant of gamma-glutamine synthetase, coding gene, amino acid sequence and application thereof | |
| CN113151199A (en) | Gamma-glutamine synthetase mutant with thermal stability, coding gene, amino acid sequence and application thereof | |
| CN110229774B (en) | Arginine decarboxylase gene engineering bacterium and high-density fermentation culture method thereof | |
| CN108546697B (en) | Enzyme method for preparing beta alanine | |
| CN111411066B (en) | Double-way composite neuraminic acid-producing bacillus subtilis and construction method thereof | |
| CN108441525A (en) | The Corynebacterium glutamicum and its construction method that a kind of lysine production improves | |
| CN116478942B (en) | Isoeugenol monooxygenase mutant, engineering bacteria and application | |
| CN106701649B (en) | L-glutamine producing strain and method for producing L-glutamine | |
| CN112111536A (en) | Method for producing spermidine by taking amino acid as substrate and engineering bacteria | |
| CN114058609A (en) | H-protein and application thereof | |
| CN116606824B (en) | Isoeugenol monooxygenase mutant IEM-F305W-L470E, engineering bacteria and application | |
| CN117866868B (en) | L-high proline production strain and construction method and application thereof | |
| CN116179521B (en) | Arginase mutant, recombinant thereof and application of arginase mutant in continuous catalysis | |
| CN114934037B (en) | Asparaase mutant for producing 3-aminopropionitrile | |
| CN115896076B (en) | Arginine deiminase mutant, recombinant thereof and application thereof in catalytic production of citrulline | |
| CN116656638A (en) | Membrane-combined L-amino acid deaminase mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230919 Address after: No. 1666, East Ring Road, Juancheng County, Heze City, Shandong Province 274699 Patentee after: SHANDONG YANGCHENG BIOTECH Co.,Ltd. Address before: 264025 No. 184 Hongqi Middle Road, Zhifu District, Shandong, Yantai Patentee before: LUDONG University |