WO2024077428A1 - Enzyme with d-amino acid synthesis activity and use thereof - Google Patents

Abstract

Provided is an enzyme with D-amino acid synthesis activity. The enzyme has an amino acid sequence as shown in SEQ ID NO: 10. Compared with an original strain before mutation, the enzyme has a higher catalytic activity for D-amino acid synthesis, a higher enzyme activity and a higher conversion rate of D-amino acid, and remains more than 76% active in the pH 4-9 range.

Description

Enzyme with D-amino acid synthesis activity and its application Technical Field

The present invention relates to the field of biological enzymes, in particular to enzymes with D-amino acid synthesis activity and applications thereof.

Background technique

D-serine can be used as a raw material for medicines such as D-cycloserine and lacosamide. The current production methods mainly include chemical splitting, biological splitting and microbial enzyme conversion. The chemical splitting method generally uses DL-serine as a raw material and splits it with a chiral splitting agent to obtain D-serine. The yield is low and the cost is high. The physical splitting method has poor selectivity, and the optical purity of the prepared D-serine product is low and does not meet the quality requirements. The chemical enzyme method uses a combination of chemical method and enzyme to produce D-serine. Its characteristics are that aminoacylase is used to split N-acetyl DL-serine, and then it is obtained through organic solvent extraction, desalination, hydrolysis and other processes. The aminoacylase production process not only has a low yield, but also produces a large amount of wastewater, waste salt and other "three wastes" problems, leading to environmental pollution. It is a production process that is gradually being eliminated by the country. Biological splitting methods include L-serine deaminase splitting method, tryptophan enzyme method, and aminoacylase splitting method. The characteristics are that DL-serine and L-serine are split or deaminated by enzymes, and L-serine and DL-serine are used as raw materials. The cost of the raw materials themselves is relatively high, and due to the low enzyme activity, the recovery rate of D-serine is low and the optical purity is low. The microbial enzyme method has the advantages of high stereoselectivity and cheap raw materials, and is the method currently used.

Threonine aldolases (TAs) are glycine-dependent aldolases that use pyridoxal phosphate as a coenzyme. Under physiological conditions, they catalyze the cleavage of threonine into glycine and acetaldehyde, and undertake the functions of threonine catabolism and glycine synthesis. In vitro, TAs can catalyze the alcohol-aldehyde condensation reaction of different types of aldehydes with α-amino acids to generate β-hydroxy-α-amino acids with two chiral centers, which can be used as important precursors for medicines. According to their different activities on stereoisomers of threonine, TAs can be divided into L-threonine aldolases (L-TAs) and D-threonine aldolases (D-TAs). To date, research Researchers have obtained the following information from Pseudomonas aeruginosa, Arthrobacter sp., Chlamydomonas reinhardtii, Delftia sp. RIT313, Pseudomonas sp., Pseudomonas protegens, Singularimonas variicoloris, Silicibacter pomeroyi, Alcaligenes xylosoxidans, and Achromobacterium dermatophyte. D-TA was identified in the strains, most of which responded to D-threonine, D-β-hydroxyphenylserine, p-methylsulfonylphenylserine, etc., but not to D-serine (Fesko et al., Appl Microbiol Biotechnol (2016) 100: 2579-2590; Franz and Stewart, Advances in Applied Microbiology, (2014) 88: 57-101; Chen et al., Catalysis Science & Technology, (2017); CN110272856A).

Japanese patents JP1983116690A, JP1993168484A, and JP1991139283A reported that D-TA from Arthrobactar DK-19 and Xanthomonas can catalyze the preparation of D-β-hydroxyamino acids from glycine and aldehyde compounds (formaldehyde or saturated alkyl aldehydes), but there are no reports on the preparation of D-serine.

Patents CN200580034899.8, CN201210341207.6, and CN201410240606.2 of Mitsui & Co., Ltd. of Japan disclose novel enzymes with D-serine synthesis activity derived from Achromobacter xylosoxidans, Achromobacter denitrificans, which can synthesize D-serine with a reaction yield of 70% using 100 mM glycine and formaldehyde. However, the tolerance range of the reaction conditions is pH 6-9. In actual production, the pH is controlled by adding methanol, which will have large fluctuations. Excessive acidity or alkalinity will have a great influence on the enzyme activity.

Summary of the invention

In order to solve the problem of lack of efficient method for preparing D-amino acids in the prior art, the present invention provides an enzyme with D-amino acid synthesis activity and its application, and utilizes the enzyme to catalyze glycine to prepare D-amino acids in vitro.

The present invention screened out a PLP-dependent enzyme of the Bordetella petrii DSD1 family from threonine aldolase-like enzymes from four different sources and found that it had D-amino acid synthesis activity. The codons were first optimized and the gene sequence was synthesized, and then the encoding gene was mutated, specifically mutating the glycine at position 130 to lysine (G130K).

In the present invention, the term "codon optimization" refers to redesigning the gene sequence according to the codon preference of protein systems of different species, so as to achieve high-level protein expression. The present invention optimizes four enzyme encoding genes from different sources through the Jcat website to make them suitable for expression in Escherichia coli.

In order to solve the problems existing in the prior art, the first aspect of the present invention provides an enzyme with D-amino acid synthesis activity, and the amino acid sequence of the enzyme with D-amino acid synthesis activity is shown in SEQ ID NO:10.

The above-mentioned enzyme with D-amino acid synthesis activity has higher enzyme activity and higher activity in catalyzing the synthesis of D-amino acids. It has a good conversion rate for D-amino acids under the condition of pH 4-9, among which the conversion rate of D-serine can reach as high as 96.6%.

The second aspect of the present invention provides an isolated nucleic acid, which encodes an enzyme with D-amino acid synthesis activity as described in the first aspect of the present invention, and the nucleotide sequence of the nucleic acid is shown in SEQ ID NO:9.

The third aspect of the present invention provides a recombinant expression vector, which comprises the nucleic acid as described in the second aspect of the present invention.

The above-mentioned recombinant vector can be constructed by connecting the nucleotide sequence of the mutant of the enzyme having D-amino acid synthesis activity of the present invention to various vectors by conventional methods in the art. The above-mentioned recombinant vector can be various conventional vectors in the art, and is not limited to a certain vector used in the examples of the present invention.

The fourth aspect of the present invention provides a transformant, wherein the transformant comprises the isolated nucleic acid as described in the second aspect of the present invention or the recombinant expression vector as described in the third aspect of the present invention in a host microorganism. Preferably, the host microorganism can be Escherichia coli, Bacillus subtilis, Corynebacterium or yeast, more preferably Escherichia coli.

The host microorganism can be any conventional host microorganism in the art, and any host microorganism that satisfies the conditions that the enzyme with D-amino acid synthesis activity can be effectively expressed can be used. When the host microorganism is Escherichia coli, the recombinant DNA can be introduced into the host microorganism using conventional means in the art such as competent cell method or electroporation method treated with calcium chloride. The transformant can be used to synthesize D-amino acids, such as D-threonine or D-serine, in a reaction system in the presence of amino acids, and the conversion rate of D-threonine or D-serine is good.

The fifth aspect of the present invention provides a method for preparing the enzyme having D-amino acid synthesis activity as described in the first aspect of the present invention, the steps of the preparation method comprising:

The transformant as described in the fourth aspect of the present invention is cultured to express the enzyme having D-amino acid synthesis activity.

Preferably, the enzyme having D-amino acid synthesis activity is present in a crude enzyme solution, and the preparation steps of the crude enzyme solution include:

(1) inoculating the transformant into a medium containing antibiotics, such as LB medium, and shaking culture;

(2) adding an inducer such as IPTG to the culture medium in (1) for induction, and collecting the bacterial cells after centrifugation;

(3) crushing the bacterial cells to obtain a crude enzyme solution containing the enzyme having D-amino acid synthesis activity; preferably, the crushing step also includes washing and suspending the bacterial cells.

The above-mentioned preparation method can be carried out according to the method conventionally used in the host microorganism culture. The culture medium for culturing the above-mentioned transformant contains carbon sources, nitrogen sources, inorganic salts, etc. that can be assimilated by the microorganism, and the transformant can be efficiently cultured, and can be any one of a natural culture medium and a synthetic culture medium. When culturing a microorganism transformed by an expression vector using an inducible promoter as a promoter, an inducer can be added to the culture medium as needed. After the culture is completed, the bacteria can be collected by means of centrifugation or filtration. In order to prepare a crude enzyme solution, cells can be destroyed by methods such as ultrasound, mechanical wall breaking, repeated freezing and thawing, osmotic pressure or surfactants, and the cell disruption solution is the crude enzyme solution; the crude enzyme solution can be purified by centrifugation, ion exchange resin, nickel column affinity chromatography or ammonium sulfate precipitation.

Specifically, the antibiotic may be 50 mg/L kanamycin; and/or,

The shaking culture conditions in (1) may be 37° C. until OD ₆₀₀ is 0.1-2.0, such as 0.4-1.0; and/or,

(2) The final concentration of IPTG may be 0.05-0.5 mM, such as 0.1 mM; and/or, the induction temperature may be 20-40° C., such as 30° C.; and/or,

The disruption described in (3) may be ultrasonic disruption; and/or, the washing may use 20 mM Tris-HCl, pH 6.8; and/or, the disruption stopping condition may be clarification of the bacterial solution.

The sixth aspect of the present invention provides a method for preparing a D-amino acid, which comprises the following steps: mixing an amino acid substrate, a cosubstrate for generating a side chain and pyridoxal phosphate in a reaction system containing an enzyme having D-amino acid synthesis activity as described in the first aspect of the present invention, to obtain; and further using a buffer such as a glycine buffer or a Hepes buffer.

Preferably, the D-amino acid is D-serine or D-threonine.

In some specific embodiments,

The amino acid substrate is glycine;

The co-substrate is an aldehyde substance such as formaldehyde or acetaldehyde.

In some specific embodiments,

The concentration of the amino acid substrate is 5-500 g/L, for example, 7.5 g/L or 400 g/L;

When the co-substrate is acetaldehyde, the concentration of the acetaldehyde is 10-20 g/L, preferably 15.4 g/L;

The concentration of pyridoxal phosphate is 1-40 mg/L, preferably 2.47-35 mg/L;

The concentration of the buffer is 50-200 mM;

The amount of the enzyme having D-amino acid synthesis activity is 0.1-1%, preferably 0.5%,

The pH of the reaction system is 3-11, preferably 4-9, more preferably 7;

The temperature of the reaction system is 25-45° C., and the stirring speed is 20-200 rpm.

In some specific embodiments,

The enzyme having D-amino acid synthesis activity is present in a crude enzyme solution, and the crude enzyme solution is prepared by the preparation method as described in the fifth aspect of the present invention.

The seventh aspect of the present invention provides an application of the enzyme having D-amino acid synthesis activity as described in the first aspect of the present invention in the preparation of D-amino acid. Preferably, the D-amino acid is D-serine or D-threonine.

On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

The reagents and raw materials used in the present invention are commercially available.

The positive and progressive effects of the present invention are:

Compared with the original strain before mutation, the enzyme with D-amino acid synthesis activity obtained after mutation, namely the threonine aldolase expressed by E. coli BDSA(K), has higher activity in catalyzing the synthesis of D-amino acids. The enzyme activity is 10 times higher than that of the original strain, and the conversion rate of D-serine can be increased by up to about 21 times, and it still has more than 76% activity in the pH range of 4-9.

Detailed ways

The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

The metal-dependent pyridoxalase from Aspergillus niger CBS513.88, the DSD1 family PLP-dependent enzyme from Bordetella petrii, the alanine racemase from Delftia tsuruhatensis, and the DSD1 family PLP-dependent enzyme from Janthinobacterium sp. Marseille were optimized and their gene sequences were synthesized. The above enzymes are collectively referred to as threonine aldolase-like enzymes, and their DNA and protein sequences were downloaded. Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. was commissioned to optimize the codons of Escherichia coli and synthesize the gene sequences.

Among them, the DNA sequence of Aspergillus niger CBS513.88 metal-dependent pyridoxalase after codon optimization is 1104bp (as shown in SEQ ID NO:1), and the protein sequence is (as shown in SEQ ID NO:2); the DNA sequence of Bordetella petrii DSD1 family PLP-dependent enzyme after codon optimization is 1137bp (as shown in SEQ ID NO:3), and the protein sequence is (as shown in SEQ ID NO:4); the DNA sequence of Delftia tsuruhatensis alanine racemase after codon optimization is 1137bp (as shown in SEQ ID NO:5), and the protein sequence is (as shown in SEQ ID NO:6); The DNA sequence after optimization was 1140bp (as shown in SEQ ID NO:5), and the protein sequence was (as shown in SEQ ID NO:6); the DNA sequence after codon optimization of the PLP-dependent enzyme of the DSD1 family of Janthinobacterium sp. Marseille was 1140bp (as shown in SEQ ID NO:7), and the protein sequence was (as shown in SEQ ID NO:8).

Plasmid pet28a was purchased from Wuhan Miaoling Biotechnology Co., Ltd., Escherichia coli DH5α is commonly used in this field; DNA polymerase (Q5 High-Fidelity DNA Polymerase) was purchased from Gene Co., Ltd.; restriction endonucleases (SacI, SalI), DNA marker, plasmid mini-extraction kit, DNA gel recovery and purification kit were all purchased from Takara Biotechnology (Dalian) Co., Ltd.; Onestep cloning cloning and recombination kit was purchased from NEB Beijing; kanamycin sulfate was purchased from Biosharp; sucrose and other chemical reagents were all of Chinese medicine analytical grade. The plasmid extraction operation steps refer to the instructions of the plasmid mini-extraction kit; the DNA gel recovery operation steps refer to the instructions of the DNA gel recovery kit; the DNA fragment recombination and connection operation steps refer to the instructions of the Onestep cloning cloning and recombination kit.

Example 1 Construction of Threonine Aldolase Expression Vector

Using the threonine aldolase vector as a template, primers an-F (SEQ ID NO: 15)/an-R (SEQ ID NO: 16) were designed to amplify the metal-dependent pyridoxalase gene from Aspergillus niger CBS51 3.88, and the amplified product was named ADTA, corresponding to the above SEQ ID NO: 1 and 2; primers bp-F (SEQ ID NO: 17)/bp-R (SEQ ID NO: 18) were designed to amplify the DSD1 family PLP-dependent enzyme gene from Bordetella petrii, and the amplified product was named BDTA, corresponding to the above SEQ ID NO :3 and 4; primers dt-F (SEQ ID NO:19)/dt-R (SEQ ID NO:20) were designed to amplify the alanine racemase gene from Delftia tsuruhatensis, and the amplified product was named DDTA, corresponding to the above SEQ ID NO:5 and 6; primers jb-F (SEQ ID NO:21)/jb-R (SEQ ID NO:22) were designed to amplify the PLP-dependent enzyme gene of the DSD1 family from Janthinobacterium sp. Marseille, and the amplified product was named JDTA, corresponding to the above SEQ ID NO:7 and 8. The enzyme used was Q5 high-fidelity enzyme. an-F: TCCGAATTCGAGCTCATGTATACTCCGCGTATCGG (SEQ ID NO:15)

an-R:CCGCAAGCTTGTCGACCTAAACCTTACCACGCGCG (SEQ ID NO:16)

bp-F:TCCGAATTCGAGCTCATGGCTAATCCGCCAGCTGC (SEQ ID NO: 17)

bp-R:CGCAAGCTTGTCGACTCAAGACAGACCACGTGCAG (SEQ ID NO:18)

dt-F:ATCCGAATTCGAGCTCATGCCACTGCACGATGATG (SEQ ID NO:19)

dt-R:CGCAAGCTTGTCGACTCAAGACAGGCCACGAGCTG (SEQ ID NO:20)

jb-F:ATCCGAATTCGAGCTCATGAAAGATGTGTCCACCC (SEQ ID NO:21)

jb-R: CCGCAAGCTTGTCGACTTAGGACAGGCCGCGCGCG (SEQ ID NO:22)

High-fidelity Q5 High-Fidelity DNA Polymerase PCR amplified the nucleotide fragment DTA of about 1.1kb. The PCR reaction system (50μl) was: 5×Q5 reaction buffer 10μl, 10mM dNTP 1μl, 2.5μl of each primer, template depending on the sample concentration, Q5 enzyme 0.5μl, add water to 50μl. The reaction conditions were: 98℃30s, 98℃10s, 55℃-72℃30s, 72℃1.5min, 33 cycles; 72℃2min. 1% agarose gel electrophoresis was used for detection and DNA gel recovery kit was used to purify and recover 4 PCR products of 1.1kb.

Plasmid pet28a was digested with restriction endonucleases SacI and SalI at the same time, and the digestion products were recovered by a gel recovery kit. The double digestion products (i.e., SacI and SalI double digested plasmid pet28a) and the amplified target gene fragment were recombined using the Onestep cloning recombination kit. The recombinant products were transformed into Escherichia coli BL21 and spread on a plate containing kanamycin sulfate. After overnight culture at 37°C, transformants were selected and sent to Jinkairui Biotechnology Co., Ltd. for sequencing. The correctly sequenced transformants, i.e., those containing the recombinant plasmids, were named pet28a-ADTA, pet28a-BDTA, pet28a-DDTA, and pet28a-JDTA, respectively.

Example 2 Expression of Threonine Aldolase

pet28a-ADTA, pet28a-BDTA, pet28a-DDTA, and pet28a-JDTA were transformed into E. coli strain BL21(DE3)CodonPlus RIPL by the calcium chloride method. The recombinant E. coli strains generated by the transformation experiments were designated: E. coli ADTA, E. coli BDTA, E. coli DDTA, and E. coli JDTA.

The recombinant E. coli strain was cultured at 37°C in LB medium containing 50 mg/L kanamycin until OD ₆₀₀ reached 0.4-1.0. Then, 0.1-0.5 mM IPTG was added to the medium, and the bacteria were cultured at 30°C for another 4-16 hours. The E. coli cells were then collected by centrifugation and frozen at -20°C (solid content ratio was about 10%).

Example 3 Detection of Threonine Aldolase Activity

1) Enzyme activity detection principle and definition

Threonine aldolase can hydrolyze DL-phenylserine to generate glycine and benzaldehyde, which has a characteristic strong absorption at 279nm. Add enzyme solution to the reaction solution, measure the absorbance after the reaction, and determine the benzaldehyde concentration in the reaction solution based on the absorbance benzaldehyde concentration regression equation.

Substrate preparation: 0.92 g DL-phenylserine, 5.0 mg pyridoxal phosphate, 30 mg hexadecyltrimethylammonium bromide, dilute to 100 mL with pure water.

Enzyme activity unit (U): 1 μmol DL-phenylserine reacts for 1 min to produce 1 μmol benzaldehyde, which is 1 U.

C: Benzaldehyde concentration calculated by the standard curve, μmol/mL

V: total volume of reaction solution, mL

n: dilution factor

m: Weight of wet cells added to the reaction solution, g

T: reaction time, 30min

2) Detection of threonine aldolase activity

0.5g of bacteria was added with diluent to make up to 10mL, and 1mL was taken and added with diluent to make up to 10mL as bacterial suspension. 0.1mL D-TA ADTA, D-TA BDTA, D-TA DDTA, and D-TA JDTA bacterial suspension were added to 9.9mL substrate respectively, and placed in a 30℃ water bath. After reacting for 30min, 10mL 0.5mol/L hydrochloric acid solution was added to terminate the reaction, and then centrifuged at 10000rpm for 2min. The absorbance of the supernatant was measured at 279nm.

The results of enzyme activity detection are shown in Table 1. The results show that no obvious activity was detected in the recombinant strains D-TA ADTA, D-TA DDTA, and D-TA JDTA. D-TA BDTA has threonine aldolase activity and can hydrolyze DL-phenylserine to produce glycine and benzaldehyde, but the enzyme activity is low, only 18U/g.

Example 4 Mutation and expression of threonine aldolase

By structural analysis and site-directed mutagenesis of the threonine aldolase from Bordetella, the glycine at position 130 in the loop region was mutated to lysine (G130K), arginine (G130R), and histidine (G130H), respectively, and a basic amino acid with a higher matching degree was introduced at this position to increase its pH tolerance. Then, the coding genes of threonine aldolase BDSA(K), BDSA(R), and BDSA(H) were obtained by artificial synthesis. The nucleotide sequence of the mutated threonine aldolase gene fragment BDSA(K) is shown in SEQ ID NO:9, and the amino acid sequence is shown in SEQ ID NO:10; the nucleotide sequence of the mutated threonine aldolase gene fragment BDSA(R) is shown in SEQ ID NO:11, and the amino acid sequence is shown in SEQ ID NO:12; the nucleotide sequence of the mutated threonine aldolase gene fragment BDSA(H) is shown in SEQ ID NO:13, and the amino acid sequence is shown in SEQ ID NO:14.

New threonine aldolase expression strains E. coli BDSA (K), E. coli BDSA (R), and E. coli BDSA (H) were constructed according to the methods of Examples 1 and 2, and fermentation and enzyme activity detection were carried out according to the method of Example 3. At the same time, the strain E. coli BDTA before mutation was used as a control. The enzyme activity detection results are shown in Table 1. The results show that after the glycine at position 130 was mutated to lysine, the enzyme activity of the recombinant strain was increased by about 10 times compared with the original strain.

Table 1 Comparison of threonine aldolase activity from different sources

Strains	Benzaldehyde concentration (μmol/mL)	Absorbance (279nm)	Enzyme activity (U/g)
E.coli ADTA	-	0.025	-
E.coli BDTA	4.9	1.36	17.96
E.coli DDTA	-	0.007	-
E.coli JDTA	-	0.013	-
E. coli BDSA(K)	49.8	13.805	182.55

E. coli BDSA(R)	-	0.152	-
E. coli BDSA(H)	-	0.004	-

Example 5 Synthesis of D-serine by Threonine Aldolase BDSA (K)

The product D-serine of the D-threonine aldolase catalyzed reaction was determined by pre-column derivatization with o-phthalaldehyde-acetylcysteine (OPA-NAC). The HPLC analysis conditions were as follows: chromatographic column C18 (4.6*250mm, 5μm); mobile phase 0.05mol/L sodium acetate:methanol=75:25 (V/V); flow rate 1.0ml/mim; detection wavelength 334nm; column temperature 20°C.

Dissolve 80g glycine and 0.6g magnesium chloride in pure water, adjust the solution pH to 4 with NaOH, add 7mg pyridoxal phosphate, dilute to 200mL with pure water, add 9g BDTA wet bacteria and 9g BDSA (K) wet bacteria respectively. Maintain the temperature of the reaction system at 35℃, and add 37% formaldehyde solution to control the pH value to 4. When the pH value of the reaction solution no longer increases, stop the reaction and take samples for testing.

Dissolve 80g glycine and 0.6g magnesium chloride in pure water, adjust the solution pH to 7 with NaOH, add 7mg pyridoxal phosphate, dilute to 200mL with pure water, add 9g BDTA wet bacteria and 9g BDSA (K) wet bacteria respectively. Maintain the temperature of the reaction system at 35℃, and add 37% formaldehyde solution to control the pH value to 7. When the pH value of the reaction solution no longer increases, stop the reaction and take samples for testing.

Dissolve 80g glycine and 0.6g magnesium chloride in pure water, adjust the solution pH to 9 with NaOH, add 7mg pyridoxal phosphate, dilute to 200mL with pure water, add 9g BDTA wet bacteria and 9g BDSA (K) wet bacteria respectively. Maintain the temperature of the reaction system at 35℃, and add 37% formaldehyde solution to control the pH value to 9. When the pH value of the reaction solution no longer increases, stop the reaction and take samples for testing.

Table 2 Conversion rate of D-serine under different conditions

According to Table 2, compared with the original strain before mutation, the mutated strain E. coli BDSA (K) still has higher activity at pH 4, and the conversion rate of D-serine can reach 76.4%. At pH 7, the enzyme activity is the highest, and the D-serine conversion rate can reach 96.6%, which is 21 times that of the original strain. At pH 9, the conversion rate of D-serine is 104 times that of the original strain, and the optical purity of D-serine is greater than 99%.

Example 6 Synthesis of D-threonine by Threonine Aldolase BDSA (K)

D-threonine, the product of D-threonine aldolase catalytic reaction, was pre-column derivatized with OPA reagent, using an amino column, mobile phase A: sodium dihydrogen phosphate solution with pH value 7.80, mobile phase B: acetonitrile: methanol: water 45:45:10, gradient elution, column temperature 40°C, detection wavelength: 338nm, flow rate: 2mL/min, programmed injection.

A mixture of 7.5 g glycine, 15.4 g acetaldehyde, 2.47 mg pyridoxal phosphate, 0.16 g MnCl ₂ , 100 mM Hepes and NaOH (pH adjusted to 7) was fixed to 1 L, 1 mL BDSA (K) enzyme solution was added, and BDTA was used as a control. The reaction mixture was incubated at 30°C for 2 h, diluted twice with 1 M HCl, and sampled for detection.

Table 3 Conversion rate of D-threonine synthesized by different enzymes

Strains	pH	D-Threonine concentration (mg/ml)	Conversion rate%	ee value
E.coli BDTA	7	0.51	4.32%	96.37%
E. coli BDSA(K)	7	3.71	31.35%	98.52%

According to the test results in Table 3, compared with the original strain before mutation, the threonine aldolase expressed by E. coli BDSA(K) has higher activity in catalyzing the synthesis of D-threonine, and the conversion rate is increased by about 8 times.

Although the specific embodiments of the present invention are described above, it should be understood by those skilled in the art that these are only examples, and various changes or modifications may be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the protection scope of the present invention is limited by the appended claims.

Claims (10)

1. An enzyme with D-amino acid synthesis activity, characterized in that the amino acid sequence of the enzyme with D-amino acid synthesis activity is as shown in SEQ ID NO:10.
2. A separated nucleic acid, characterized in that the nucleic acid encodes the enzyme with D-amino acid synthesis activity as described in claim 1, and the nucleotide sequence of the nucleic acid is shown in SEQ ID NO:9.
3. A recombinant expression vector, characterized in that the recombinant expression vector comprises the nucleic acid according to claim 2.
4. A transformant, characterized in that the transformant comprises the isolated nucleic acid according to claim 2 or the recombinant expression vector according to claim 3 in a host microorganism; preferably, the host microorganism is Escherichia coli, Bacillus subtilis, Corynebacterium or yeast, more preferably Escherichia coli.
5. A method for preparing an enzyme having D-amino acid synthesis activity as claimed in claim 1, characterized in that the steps of the preparation method include:

   Cultivating the transformant according to claim 4 to express the enzyme having D-amino acid synthesis activity, thereby obtaining;

   Preferably, the enzyme having D-amino acid synthesis activity is present in a crude enzyme solution, and the preparation steps of the crude enzyme solution include:

   (1) inoculating the transformant into a medium containing antibiotics, such as LB medium, and shaking culture;

   (2) adding an inducer such as IPTG to the culture medium in (1) for induction, and collecting the bacterial cells after centrifugation;

   (3) crushing the bacterial cells to obtain a crude enzyme solution containing the enzyme having D-amino acid synthesis activity; preferably, the crushing step also includes washing and suspending the bacterial cells.
6. A method for preparing D-amino acid, characterized in that the method comprises the following steps: mixing an amino acid substrate, a cosubstrate for generating a side chain and pyridoxal phosphate in a reaction system containing the enzyme having D-amino acid synthesis activity as claimed in claim 1, to obtain; further using a buffer such as a glycine buffer or a Hepes buffer;

   Preferably, the D-amino acid is D-serine or D-threonine.
7. The preparation method according to claim 6, characterized in that

   The amino acid substrate is glycine;

   The co-substrate is an aldehyde substance such as formaldehyde or acetaldehyde.
8. The preparation method according to claim 6, characterized in that

   The concentration of the amino acid substrate is 5-500 g/L, for example, 7.5 g/L or 400 g/L;

   When the co-substrate is acetaldehyde, the concentration of the acetaldehyde is 10-20 g/L, preferably 15.4 g/L;

   The concentration of pyridoxal phosphate is 1-40 mg/L, preferably 2.47-35 mg/L

   The concentration of the buffer is 50-200 mM;

   The amount of the enzyme having D-amino acid synthesis activity is 0.1-1%, preferably 0.5%,

   The pH of the reaction system is 3-11, preferably 4-9, more preferably 7;

   The temperature of the reaction system is 25-45° C., and the stirring speed is 20-200 rpm.
9. The preparation method according to claim 6, characterized in that the enzyme having D-amino acid synthesis activity is present in a crude enzyme solution, and the crude enzyme solution is prepared by the preparation method according to claim 5.
10. A use of the enzyme having D-amino acid synthesis activity as claimed in claim 1 in the preparation of D-amino acids, wherein preferably, the D-amino acid is D-serine or D-threonine.