CN110272856A - A kind of recombinant bacterium that expressing D-Thr aldolase and its construction method and application - Google Patents

A kind of recombinant bacterium that expressing D-Thr aldolase and its construction method and application Download PDF

Info

Publication number
CN110272856A
CN110272856A CN201910380625.8A CN201910380625A CN110272856A CN 110272856 A CN110272856 A CN 110272856A CN 201910380625 A CN201910380625 A CN 201910380625A CN 110272856 A CN110272856 A CN 110272856A
Authority
CN
China
Prior art keywords
recombinant bacterium
apdta
thr
recombinant
aldolase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910380625.8A
Other languages
Chinese (zh)
Other versions
CN110272856B (en
Inventor
倪晔
龚磊
许国超
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN201910380625.8A priority Critical patent/CN110272856B/en
Publication of CN110272856A publication Critical patent/CN110272856A/en
Application granted granted Critical
Publication of CN110272856B publication Critical patent/CN110272856B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/02—Aldehyde-lyases (4.1.2)
    • C12Y401/02042—D-Threonine aldolase (4.1.2.42)

Abstract

The invention discloses a kind of recombinant bacterium for expressing D-Thr aldolase and its construction method and applications, belong to technical field of enzyme engineering.Recombinant bacterium of the invention expresses amino acid sequence D-Thr aldolase as shown in SEQ ID NO.2.The present invention provides a kind of D-Thr aldolases can be used as catalyst applied to the synthesis of chiral beta-hydroxy-a-amino acid, its high catalytic efficiency (conversion ratio > 65%), stereoselectivity strong (e.e. > 99%, d.e. > 95%), applicable reaction condition are mild, environmental-friendly.D-Thr aldolase catalytic effect of the invention is good, and substrate applicability is wide, has good application and development prospect.

Description

A kind of recombinant bacterium that expressing D-Thr aldolase and its construction method and application
Technical field
The present invention relates to a kind of recombinant bacterium for expressing D-Thr aldolase and its construction method and applications, belong to enzyme engineering Technical field.
Background technique
Chiral beta-hydroxy-a-amino acid is a kind of very important compound, because it is with chiral hydroxyl group and amino acid two A functional group has very extensive application in the manufacture of the fine chemicals such as medicine, material.Chemical method synthesizing chiral beta-hydroxyl Base-a-amino acid have expensive catalyst, heavy metal pollution, synthetic route is longer and can just mention under more exacting terms The disadvantages of stereoselectivity of high product, is unfavorable for industrial amplification.Compared with chemical method, enzyme process does not need any protection Base, has many advantages, such as better stereoselectivity, and reaction can be completed with a step.Therefore, enzymatic clarification beta-hydroxy-alpha-amino acid is more Potentiality with application and development.
Threonine aldolase is the aldolase of a kind of phosphopyridoxal pyridoxal phosphate dependent form, is carbon-carbon bond formation in organic synthesis Powerful tool, it can be catalyzed aldehyde with different substituents and glycine occurs special aldol reaction and produces height The beta-hydroxy-alpha-amino acid of attached value has the selectivity of height in α-carbon of two chiral centres of formation, and β-carbon is vertical Body is selectively poor.Therefore, efficient, highly-solid selectively threonine aldolase is developed, for synthesizing Thiamphenicol, fluorobenzene Buddhist nun The technology shifts upgrading for examining the chiral intermediate (l-syn- pmethylsulfonyl phenyleneserine) of equal drugs is of great significance.
Currently, being by dl-syn- pairs of Enzymatic Resolution mostly for the Production by Enzymes of l-syn- pmethylsulfonyl phenyleneserine Methylsulfonyl benzene serine obtains.Wherein, under two-phase system (methylene chloride, dichloroethanes, cyclohexanone), Delftia is derived from The D-Thr aldolase of sp.RIT313 can split 300mmolL completely-1Dl-syn- pmethylsulfonyl phenyleneserine is mesh Preceding highest concentration of substrate (Catalysis Science&Technology, 2017,7,5964-5973).However, enzymatic clarification l- The research report of syn- pmethylsulfonyl phenyleneserine is less.L- threonine aldolase from P.putida is catalyzed to methylsulfonyl It is only 53% that benzaldehyde and glycine synthesis l-syn- pmethylsulfonyl phenyleneserine yield, which are 68%, d.e. value, (Tetrahedron,2007,63,918-926).Lower enzyme activity and stereoselectivity are all to restrict threonine aldehyde all the time The bottleneck of contracting enzyme application, is badly in need of developing the novel threonine aldolase for having high activity and highly-solid selectively to meet industry Change the requirement of application.
Summary of the invention
In order to solve the above technical problems, the present invention provides a kind of recombinant bacterium for expressing D-Thr aldolase, the D- of production Threonine aldolase can efficient catalytic l-syn- pmethylsulfonyl phenyleneserine is synthesized to methyl sulfone benzaldehyde and glycine, yield is 65% or more, d.e. value are 95% or more.The process has mild condition, simple operation and other advantages.
The first purpose of the invention is to provide a kind of recombinant bacterium for expressing D-Thr aldolase, the recombinant bacterium expression Amino acid sequence D-Thr aldolase as shown in SEQ ID NO.2.
Further, the recombinant bacterium is to be bacterium, fungi, plant, insect or zooblast as host cell.
Further, the recombinant bacterium is using Escherichia coli as host strain.It is preferred that e. coli bl21 (DE3).
Further, the expression vector of the recombinant bacterium is bacterial plasmid, bacteriophage, yeast plasmid, plant cell disease Poison or mammalian cell virus.
Further, the expression vector of the recombinant bacterium is pET series expression vector.It is preferred that pET28a.
A second object of the present invention is to provide the construction methods of the recombinant bacterium, include the following steps:
(1) construction recombination plasmid pET28a-ApDTA: by the plasmid of D-Thr aldolase gene ApDTA and digestion PET28a is attached, and obtains recombinant expression carrier pET28a-ApDTA；
(2) recombinant bacterium E.coli BL21 (DE3)/pET28a-ApDTA: the recombinant expression carrier that will be built is constructed PET28a-ApDTA heat is transferred in e. coli bl21 (DE3) competence, and culture screening obtains recombinant bacterium E.coli BL21 (DE3)/pET28a-ApDTA。
Third object of the present invention is to provide the recombinant bacterium answering in the synthesis of chiral beta-hydroxy-a-amino acid With.
Further, the application is using the D-Thr aldolase of the recombinant bacterium fermenting and producing as catalysis Agent, synthesis of chiral beta-hydroxy-alpha-amino acid.
Further, the application is specifically to be catalyzed aldehyde and glycine synthesizing chiral beta-hydroxyl-alpha-aryl amino acid.
Further, the catalysis reaction temperature be 5~15 DEG C, pH be 5.5~6.5 under conditions of reaction 10~ 20h。
The beneficial effects of the present invention are:
The present invention provides a kind of D-Thr aldolases can be used as catalyst applied to chiral beta-hydroxy-a-amino acid Synthesis, high catalytic efficiency (conversion ratio > 65%), stereoselectivity strong (e.e. > 99%, d.e. > 95%), applicable reaction item Part is mild, environmental-friendly.D-Thr aldolase catalytic effect of the invention is good, and substrate applicability is wide, has application well Development prospect.
Detailed description of the invention
The PCR amplification electropherogram that Fig. 1 is Gene A pDTA is composed；M, Marker；1, Gene A pDTA；
Fig. 2 is pET28a-ApDTA recombinant plasmid physical map；
Fig. 3 is the protein electrophoresis figure for recombinating d- threonine aldolase；M, Marker；Swimming lane 1,2,3 is respectively recombinant bacterium Supernatant, precipitating and enzyme after purification after E.coli BL21 (DE3)/pET28a-ApDTA induction；
Fig. 4 is that the catalysis of d- threonine aldolase is pmethylsulfonyl phenyleneserine to methyl sulfone benzaldehyde and glycine condensation Reaction equation；
The HPLC map of Fig. 5 reaction solution product l-syn- pmethylsulfonyl phenyleneserine.
Specific embodiment
The present invention is further explained in the light of specific embodiments, so that those skilled in the art can be preferably Understand the present invention and can be practiced, but illustrated embodiment is not as a limitation of the invention.
D-Thr aldolase catalytic reaction products HPLC analysis condition are as follows: chromatographic column Diamonsil Plus C18 (25cm × 4.6mm, 5 μm), mobile phase are V (CH3CN):V(50mmol·L-1Potassium dihydrogen phosphate)=15:85, flow velocity is 0.2~1mLmin-1, Detection wavelength 338nm, column temperature is 40 DEG C, OPA-NAC pre-column derivatization liquid phase measurement.Simultaneously with l- Syn- pmethylsulfonyl phenyleneserine standard items compare, and determine product appearance time and order, and carry out enzyme activity on this basis Power measurement.D-Thr aldolase vitality test: D-Thr aldolase is to substrate to the enzyme activity determination of methyl sulfone benzaldehyde System are as follows: appropriate enzyme solution, 5mmolL-1To methyl sulfone benzaldehyde, 50mmolL-1Glycine, 50 μm of olL-1Phosphoric acid pyrrole is trembled Aldehyde (PLP), 50 μm of olL-1Mn2+In 30 DEG C of oscillating reactions 10min.After reaction, sampling carries out liquid phase detection.One enzyme The definition of unit of activity (Unit): catalysis generates 1 μm of ol l-syn- pmethylsulfonyl phenyleneserine to methyl sulfone benzaldehyde per minute The amount of required biocatalyst.It uses bovine serum albumin as standard, measures protein concentration with Bradford method.
Embodiment 1: the gene excavating technology screening D-Thr aldolase based on probe enzyme sequence
According to the reported D-Thr aldolase (Alcaligenes for being condensed into pmethylsulfonyl phenyleneserine with aldehyde Xylosoxydans gene order) carries out retrieving in ncbi database and BLAST is compared and divided using this sequence as probe The candidate enzyme gene for having 40%~70% homology with probe sequence is found in analysis, chooses the higher enzyme gene of sequence identity, And guarantee that the source bacterial strain of these enzyme genes and probe be not of the same race, and then according to the gene order design primer retrieved, utilize PCR amplification obtains the DNA of encoding such enzymes, and they is cloned and is expressed, finally by target substrates (to methylsulfonyl Benzaldehyde) carry out active and stereoselectivity screening, i.e. acquisition high activity, highly selective D-Thr aldolase.
The clone of embodiment 2:D- threonine aldolase gene
Using " one-step cloning method " (homologous recombination) construction recombination plasmid pET28a-ApDTA.
(1) first using nutrient agar culture medium (peptone 10.0g, beef extract 3.0g, NaCl5.0g, fine jade Rouge 15.0g, distilled water 1.0L, pH 7.0), the above-mentioned colourless dialister bacterium of skin formula of rejuvenation is activated at 25 DEG C.Then bacterium colony to be grown Afterwards, single colonie is accessed in fluid nutrient medium and is cultivated.After centrifugation obtains thallus, skin is extracted using bacterial genomes DNA kit The colourless dialister bacterium genomic DNA of formula.
(2) according to reported D-Thr aldolase gene design primer (upstream primer: CAGCAAATGGGTCGCGG ATCCATGTCCCAGGAAGTCATACGCG, downstream primer: TGCGGCCGCAAGCTTGTCGACTCAGCGCGAGAAGCCGCG, Wherein GGATCC is I restriction enzyme site of BamH, and GTCGAC is I restriction enzyme site of Sal), using the colourless dialister bacterium genomic DNA of skin formula as mould Plate carries out PCR, following (μ L): the MgSO of system40.6, dNTP 1.0, upstream primer 0.4, downstream primer 0.4, KOD Buffer 1.0, KOD enzymes 0.2, template 0.4, ddH2O 6.0.PCR reaction condition are as follows: 95 DEG C of 10min of initial denaturation are denaturalized 98 DEG C of 20s, and 65 DEG C Anneal 20s, 68 DEG C of extension 50s, repeats 30 circulations, 68 DEG C of extension 10min.PCR product identifies through agarose gel electrophoresis, and Utilize the band (Fig. 1) in the agarose gel DNA QIAquick Gel Extraction Kit recycling section 800~1200bp, i.e. D-Thr aldolase gene. Gained D-Thr aldolase gene is named as ApDTA, and nucleotide sequence is as shown in SEQ ID No.1: overall length 1140bp rises Beginning codon is ATG, terminator codon TGA.Intronless in sequence, coded sequence is from the 1st nucleotide to 1140 Nucleotide stops, and encoded protein sequence is as shown in SEQ ID No.2.Sequence has been filed on to ncbi database, and GenBank is stepped on Record number is KNY11228.1.
Embodiment 3: recombination bacillus coli BL21 (DE3)/pET28a-ApDTA building and culture
With restriction enzyme BamH I and Sal I by plasmid pET28a the double digestion 4h in 37 DEG C of water-baths, through agarose Gel electrophoresis identification, and utilize agarose DNA QIAquick Gel Extraction Kit purification and recovery target fragment.At 37 DEG C, recombination kit is utilized In recombinase the plasmid pET28a of Gene A pDTA and digestion is attached to get recombinant expression carrier pET28a- ApDTA (Fig. 2).The recombinant expression carrier pET28a-ApDTA heat built is transferred in e. coli bl21 (DE3) competence, It is coated with resistance LB solid plate containing kanamycin, bacterium colony PCR verifying is carried out after being incubated overnight, positive clone molecule is gene weight Group engineering bacteria E.coli BL21 (DE3)/pET28a-ApDTA.Picking positive clone molecule is incubated overnight in LB culture medium, next day It transfers in fresh LB by 2% inoculum concentration, culture to OD600When reaching 0.6~0.8,0.2mmolL is added-1IPTG, After 25 DEG C of Fiber differentiation 10h, 4 DEG C, 8000rmin-1It is centrifuged 5min and collects thallus.The thallus gathered is suspended in HEPES to delay Fliud flushing (100mmolL-1, pH 8.0) in, ultrasonication, and pass through the expression (Fig. 3) of SDS-PAGE analysis albumen.By Fig. 3 is it is found that destination protein all in supernatant (swimming lane 1), illustrates recombinase big without band (swimming lane 2) substantially in precipitating Solution expression with high efficiency in enterobacteria.
Embodiment 4:D- threonine aldolase ApDTA's isolates and purifies
It harvests the recombinant cell of induction and is suspended in buffer solution A (20mmolL-1Sodium phosphate, 500mmolL-1NaCl, 20mmol·L-1Imidazoles, pH 7.4) in, ultrasonication processing (300W works 1 second, suspends 3 seconds) 10min, 4 DEG C, 8000r min-1Centrifugation 20min obtains supernatant after removing cell fragment.Purifying the pillar used is affinity column HisTrap FF crude, It is used to prepare the recombinant protein of purifying histidine mark.Nickel column is balanced using buffer solution A first, and above-mentioned supernatant is crossed into nickel Column continues to use albumen of the buffer solution A elution not in conjunction with nickel column, after peak to be penetrated is flow to end, from buffer solution A to buffer solution B (20mmol·L-1Sodium phosphate, 500mmolL-1NaCl, 1000mmolL-1Imidazoles, pH 7.4) gradient elution is carried out, it will tie The recombinant protein closed in nickel column elutes, and obtains recombination D-Thr aldolase.Enzyme activity is carried out to albumen after purification Measurement (being substrate to methyl sulfone benzaldehyde) and SDS-PAGE analyze (Fig. 3).From the figure 3, it may be seen that after ni-sepharose purification, on the left side 40kDa Right display single slice, and foreign protein is less, illustrates ni-sepharose purification effect preferably (swimming lane 3).HiTrap is utilized later Desalting desalting column replaces d- threonine aldolase after purification to HEPES (100mmolL-1, pH 8.0) and buffer In, carry out characterization analysis.
Embodiment 5: the substrate spectrum analysis of ApDTA is recombinated
Measurement D-Thr aldolase A pDTA is catalyzed the enzyme activity of different aldehyde substrates, and measuring method is according to D-Thr Aldolase vigour-testing method, difference are substrate difference.It is 100% using the enzyme activity measured to methyl sulfone benzaldehyde as substrate Control, the enzyme activity that other substrates measure are calculated with the percentage of the two.Measurement result is as shown in table 1.
The substrate of 1 ApDTA of table is composed
As shown in Table 1, ApDTA shows wider substrate spectrum, shows to aliphatic, aromatic series and heterocyclic aldehyde substrate Good activity, has a good application prospect.
Embodiment 6: the optimal pH of ApDTA is recombinated
Prepare 100mmolL-1The buffer of different pH: MES buffer (pH 5.0~6.5)；HEPES buffer solution (pH 7.0~8.5)；CHES buffer (pH 9.0~10.0).Using to methyl sulfone benzaldehyde, as substrate, measurement ApDTA is buffered in different pH The condensation reaction vigor of liquid.The most suitable enzyme activity pH of ApDTA is 8.0, and Rate activity is 10.0~12.0Umg-1.It is 9.0 in pH In~10.0 CHES-NaOH buffer, enzyme activity decline is very fast.Using d- threonine as substrate, measurement ApDTA is slow in different pH The opposite cracking vigor of fliud flushing.Under the conditions of acidic buffer (pH 5.0~6.5), the cracking vigor of ApDTA is lower, with pH When being increased to 8.0, reach maximum cracking vigor.Equally, with the increase of buffer alkalinity, vigor is gradually reduced.
Embodiment 7: the optimum temperature of ApDTA is recombinated
Respectively, as substrate, to measure enzyme activity of the ApDTA under different temperatures (20~45 DEG C) to methyl sulfone benzaldehyde, survey The highest enzyme activity obtained is set to 100%, and the enzyme activity measured at a temperature of other relative to the percentage of highest vigor to calculate.Knot Fruit shows that different temperature generates certain influence to the condensation vigor of ApDTA, is in inclined normal distribution with reaction temperature variation.Most Thermophilic degree is 30 DEG C, relatively relatively low below or above 30 DEG C of enzyme activities.
Embodiment 8: Determination of Kinetic Parameters
Rate activity of the ApDTA when difference is to methylsulfonyl benzaldehyde concentration is measured, and dense according to Rate activity and substrate The inverse of degree makees double reciprocal curve, computational dynamics parameter.The ApDTA of measurement is to the kinetic parameter to methyl sulfone benzaldehyde point It Wei not KmFor 30.0mmolL-1, VmaxFor 40.3 μm of olmin-1·mg-1。
Embodiment 9: influence of the metal ion to enzyme activity
Measure Mn2+, Fe2+, Mg2+, Ca2+, Al3+, Cu2+, Co2+, Ni2+With metal ions and the metal ion-chelant such as EDTA Influence of the agent to condensation reaction enzyme activity.By final concentration of 0.1mmolL-1Chlorate or sulphate form metal from Son is added in live body system, under the conditions of 30 DEG C, in HEPES buffer solution (100mmolL-1, pH 8.0) in methylsulfonyl benzene Formaldehyde is that substrate measures its enzyme activity.Under equal conditions, the enzyme activity that any metal ion measures is not added and is set to 100% control, The enzyme activity that metal ion measures is added and is calculated with the percentage compareed.The results show that metal ion has certain journey to enzyme activity Degree ground activation.Mn is added2+When the enzyme activity highest that is shown, show Mn2+Catalytic active center or correct for enzyme Conformation has facilitation.A.xylosoxidans, the D-Thr aldehyde of X.oryzae, S.pomeroyi are derived from reported Contracting enzyme shows similar activation；However, also it has been reported that deriving from S.variicoloris and Pseudomonas sp. D-Thr aldolase belong to nonmetallic ion dependent form.
Embodiment 10: reaction temperature is to recombination threonine aldolase ApDTA catalysis to the contracting reaction of methyl sulfone benzaldehyde aldehyde It influences
Respectively at 10 DEG C and 30 DEG C, in MES buffer (100mmolL-1, pH 6.0) in, it is added final concentration of 50mmol·L-1Glycine, 5mmolL-1To methyl sulfone benzaldehyde, 50 μm of olL-1PLP, 50 μm of olL-1Mn2+, reaction solution Total volume is 10mL, and 200rpm reacts 12h.Liquid-phase chromatographic analysis conversion ratio and d.e. value.As shown in table 2.
Influence of the 2 differential responses temperature of table to aldehyde contracting catalysis to methyl sulfone benzaldehyde
From table 2 it can be seen that reaction temperature has a certain impact to aldehyde contracting catalysis to methyl sulfone benzaldehyde.In 10 DEG C of conditions It is lower to obtain higher conversion ratio and d.e. value than 30 DEG C, and favors low temperature is in the stabilization and raising of product d.e. value, conversion ratio Raising illustrates that aldehyde contracting the Direction of Reaction is exothermic reaction.There is different Preferences to the Direction of Reaction at different temperatures.In low temperature Under, it reacts low towards activation energy, fireballing direction and carries out, react by dynamics Controlling.Therefore, select reaction temperature for 10 ℃。
Influence of the embodiment 11:pH to recombination threonine aldolase ApDTA catalysis to the contracting catalysis of methyl sulfone benzaldehyde aldehyde
The difference pH buffer (100mmolL in embodiment 6-1, pH 6.0,7.0,8.0) in, be added final concentration of 50mmol·L-1Glycine, 5mmolL-1To methyl sulfone benzaldehyde, 50 μm of olL-1PLP, 50 μm of olL-1Mn2+, reaction solution Total volume is 10mL, and at 10 DEG C, 200rpm reacts 12h.Liquid-phase chromatographic analysis conversion ratio and d.e. value.The results are shown in Table 3.
Influence of 3 pH of buffer of table to aldehyde contracting catalysis to methyl sulfone benzaldehyde
PH of buffer Conversion ratio % D.e. it is worth
5.0 4% 83%
6.0 65% 95%
7.0 50% 75%
8.0 50% 80%
9.0 50% 94%
10.0 29% 90%
From table 3 it can be seen that the pH of reaction system has a certain impact to the contracting catalysis of ApDTA aldehyde to methyl sulfone benzaldehyde, In the buffer of pH 6.0, conversion ratio and d.e. value reach maximum, and d.e. value is relatively stable in entire reaction process.? When pH 6.0, the cracking enzyme activity of ApDTA is lower, and back reaction cracking direction is suppressed.
Embodiment 12: recombination threonine aldolase ApDTA is used to prepare l-syn- pmethylsulfonyl phenyleneserine
Reaction system is amplified to 500mL, including MES buffer (100mmolL-1, pH 6.0), 1molL-1Sweet ammonia Acid, 100mmolL-1To methyl sulfone benzaldehyde, 50 μm of olL-1PLP、50μmol·L-1Mn2+、25kU·L-1ApDTA, 10 DEG C, 200rpm reacts 12h.Reaction process such as Fig. 4, liquid phase analysis map such as Fig. 5 of reaction product.To after reaction, directly Mixture after reaction is added to the methanol of 4 times of volumes, 4 DEG C save overnight, sediment are collected by filtration, and washed with methanol Recycle glycine.By alkali-treated Dowex-1 anion exchange resin after filter vacuum concentration, washed with water.It produces Object (containing glycine) is eluted with 20% acetic acid, is collected and is concentrated in vacuo residue, and purify on ODS column, obtain purpose Product.99% or more product purity, 75% or more yield.
Embodiment described above is only to absolutely prove preferred embodiment that is of the invention and being lifted, protection model of the invention It encloses without being limited thereto.Those skilled in the art's made equivalent substitute or transformation on the basis of the present invention, in the present invention Protection scope within.Protection scope of the present invention is subject to claims.
Sequence table
<110>Southern Yangtze University
<120>a kind of recombinant bacterium for expressing D-Thr aldolase and its construction method and application
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 1140
<212> DNA
<213>(artificial sequence)
<400> 1
atgtcccagg aagtcatacg cggcatagcg ctgcccccgc cagcgcagcc gggtgatccg 60
ttggcccaag tcgacacgcc cagcctcgtg ctggacctga cgcccttcga agccaatctg 120
cgcgccatgc aggcttgggc ggaccgccac gaggtggcct tgcggccgca cgccaaggcg 180
cacaaatgcc ccgagatcgc gcggcgccaa ctcgcgctgg gcgcgcgtgg catctgttgc 240
cagaaggtca gcgaggcgct gcctttcgtg gccgcgggca tccacgacat ccacatcagc 300
aacgaagtcg tcgggcctgc caagcttgcc ttgctgggcc agctggcgcg cgtggccaag 360
atgagcgtct gtgtggataa cgcccacaac ctggcgcagc tctcgcaagc catgacgcag 420
gcgggcgcgc agatcgacgt gctggtcgaa gtggacgtcg gccaaggccg ctgcggcgtg 480
tcggacgatg cgctggtgct ggcgctggcg caacaggcgc gtgacctgcc cggcgtgcag 540
ttcgtgggct tgcaggccta tcacggctcg gtgcagcacg cccgtacgcg tgaggagcgc 600
gcgcagatct gcaagcaggc cgcgcgtatc gcggcctcgt acgcccagct gctgcgtgaa 660
agcggcatcg cttgcgacat cattaccggg ggcggcacgg gcagcgcaga attcgacgcg 720
gcaagcggcg tctataccga actgcaagcg ggctcttacg cgttcatgga cggcgactac 780
ggcgcgaacg aatgggacgg tccgctgaaa ttccagaaca gcctgttcct gttgtccacc 840
gtcatgagcg tgccggcgcc cgaccgcgtg atcctggacg caggcctgaa gtccaccacc 900
gccgaatgcg gcccgcccgc cgtcttcgat acggcgggcc tgacctatgc ggcgattaac 960
gacgaacacg gcgtcgtgcg cgttgcgccc gatgccaccg cgcccgcgct gggcgacgtg 1020
ctgcgtctgg tgccctcgca cgtggacccg acgttcaacc tgcacgacgg cctggtcgtg 1080
gtgcgcaatg acgtcgtaga agacgtctgg gaaatcgccg cgcgcggctt ctcgcgctga 1140
<210> 2
<211> 379
<212> PRT
<213>(artificial sequence)
<400> 2
Met Ser Gln Glu Val Ile Arg Gly Ile Ala Leu Pro Pro Pro Ala Gln
1 5 10 15
Pro Gly Asp Pro Leu Ala Gln Val Asp Thr Pro Ser Leu Val Leu Asp
20 25 30
Leu Thr Pro Phe Glu Ala Asn Leu Arg Ala Met Gln Ala Trp Ala Asp
35 40 45
Arg His Glu Val Ala Leu Arg Pro His Ala Lys Ala His Lys Cys Pro
50 55 60
Glu Ile Ala Arg Arg Gln Leu Ala Leu Gly Ala Arg Gly Ile Cys Cys
65 70 75 80
Gln Lys Val Ser Glu Ala Leu Pro Phe Val Ala Ala Gly Ile His Asp
85 90 95
Ile His Ile Ser Asn Glu Val Val Gly Pro Ala Lys Leu Ala Leu Leu
100 105 110
Gly Gln Leu Ala Arg Val Ala Lys Met Ser Val Cys Val Asp Asn Ala
115 120 125
His Asn Leu Ala Gln Leu Ser Gln Ala Met Thr Gln Ala Gly Ala Gln
130 135 140
Ile Asp Val Leu Val Glu Val Asp Val Gly Gln Gly Arg Cys Gly Val
145 150 155 160
Ser Asp Asp Ala Leu Val Leu Ala Leu Ala Gln Gln Ala Arg Asp Leu
165 170 175
Pro Gly Val Gln Phe Val Gly Leu Gln Ala Tyr His Gly Ser Val Gln
180 185 190
His Ala Arg Thr Arg Glu Glu Arg Ala Gln Ile Cys Lys Gln Ala Ala
195 200 205
Arg Ile Ala Ala Ser Tyr Ala Gln Leu Leu Arg Glu Ser Gly Ile Ala
210 215 220
Cys Asp Ile Ile Thr Gly Gly Gly Thr Gly Ser Ala Glu Phe Asp Ala
225 230 235 240
Ala Ser Gly Val Tyr Thr Glu Leu Gln Ala Gly Ser Tyr Ala Phe Met
245 250 255
Asp Gly Asp Tyr Gly Ala Asn Glu Trp Asp Gly Pro Leu Lys Phe Gln
260 265 270
Asn Ser Leu Phe Leu Leu Ser Thr Val Met Ser Val Pro Ala Pro Asp
275 280 285
Arg Val Ile Leu Asp Ala Gly Leu Lys Ser Thr Thr Ala Glu Cys Gly
290 295 300
Pro Pro Ala Val Phe Asp Thr Ala Gly Leu Thr Tyr Ala Ala Ile Asn
305 310 315 320
Asp Glu His Gly Val Val Arg Val Ala Pro Asp Ala Thr Ala Pro Ala
325 330 335
Leu Gly Asp Val Leu Arg Leu Val Pro Ser His Val Asp Pro Thr Phe
340 345 350
Asn Leu His Asp Gly Leu Val Val Val Arg Asn Asp Val Val Glu Asp
355 360 365
Val Trp Glu Ile Ala Ala Arg Gly Phe Ser Arg
370 375

Claims (10)

1. a kind of recombinant bacterium for expressing D-Thr aldolase, which is characterized in that the recombinant bacterium expresses amino acid sequence such as D-Thr aldolase shown in SEQ ID NO.2.
2. recombinant bacterium according to claim 1, which is characterized in that the recombinant bacterium be be bacterium, fungi, plant, Insect or zooblast are host cell.
3. recombinant bacterium according to claim 2, which is characterized in that the recombinant bacterium is using Escherichia coli as host strain.
4. recombinant bacterium according to claim 1, which is characterized in that the expression vector of the recombinant bacterium be bacterial plasmid, Bacteriophage, yeast plasmid, plant cell virus or mammalian cell virus.
5. recombinant bacterium according to claim 4, which is characterized in that the expression vector of the recombinant bacterium is PET series of tables Up to carrier.
6. a kind of construction method of the described in any item recombinant bacteriums of Claims 1 to 5, which comprises the steps of:
(1) construction recombination plasmid pET28a-ApDTA: by the plasmid pET28a of D-Thr aldolase gene ApDTA and digestion It is attached, obtains recombinant expression carrier pET28a-ApDTA；
(2) recombinant bacterium E.coli BL21 (DE3)/pET28a-ApDTA: the recombinant expression carrier pET28a- that will be built is constructed ApDTA heat is transferred in e. coli bl21 (DE3) competence, culture screening obtain recombinant bacterium E.coli BL21 (DE3)/ pET28a-ApDTA。
7. application of any one of Claims 1 to 5 recombinant bacterium in the synthesis of chiral beta-hydroxy-a-amino acid.
8. application according to claim 7, which is characterized in that the application is to utilize the recombinant bacterium fermenting and producing D-Thr aldolase is as catalyst, synthesis of chiral beta-hydroxy-alpha-amino acid.
9. application according to claim 8, which is characterized in that the application is specifically to be catalyzed aldehyde and glycine synthesis of chiral Beta-hydroxy-alpha-amino acid.
10. application according to claim 8, which is characterized in that the catalysis is 5~15 DEG C in reaction temperature, and pH is 10~20h is reacted under conditions of 5.5~6.5.
CN201910380625.8A 2019-05-08 2019-05-08 Recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof Active CN110272856B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910380625.8A CN110272856B (en) 2019-05-08 2019-05-08 Recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910380625.8A CN110272856B (en) 2019-05-08 2019-05-08 Recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof

Publications (2)

Publication Number Publication Date
CN110272856A true CN110272856A (en) 2019-09-24
CN110272856B CN110272856B (en) 2022-05-03

Family

ID=67959851

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910380625.8A Active CN110272856B (en) 2019-05-08 2019-05-08 Recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof

Country Status (1)

Country Link
CN (1) CN110272856B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113322248A (en) * 2021-05-12 2021-08-31 浙江工业大学 High-temperature-resistant L-threonine aldolase and application thereof in synthesis of p-methylsulfonylphenylserine
CN114686500A (en) * 2020-12-30 2022-07-01 华东师范大学 1, 4-alpha-glucan branching enzyme, coding gene, engineering strain and application
CN114703169A (en) * 2022-04-29 2022-07-05 重庆大学 L-threonine aldolase mutant R318L/H128N and application thereof

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH03139283A (en) * 1989-10-25 1991-06-13 Denki Kagaku Kogyo Kk Dta gene and its use
US5663361A (en) * 1996-08-19 1997-09-02 Schering Corporation Process for preparing intermediates to florfenicol
JP2007190009A (en) * 2005-08-26 2007-08-02 Research Institute Of Innovative Technology For The Earth Highly stereoselective l-threoninealdolase and gene encoding the same
CN101040047A (en) * 2004-10-13 2007-09-19 三井化学株式会社 DNA encoding novel enzyme having D-serine synthase activity, method of producing the enzyme and method of producing d-serine by using the same
CN102442930A (en) * 2011-11-02 2012-05-09 江苏宇翔化工有限公司 Preparation method of DL-p-methylsulfonylphenyl serine ethyl ester
CN104673814A (en) * 2015-02-27 2015-06-03 台州职业技术学院 L-threonine aldolase from enterobacter cloacae and application thereof
CN109402098A (en) * 2018-11-06 2019-03-01 王喆明 Threonine aldolase, mutant and its preparing the application in substituted benzene serine derivative
WO2020043077A1 (en) * 2018-08-29 2020-03-05 北京科技大学 Method for preparing l-threo/erythro-p-methylsulfonylphenyl serine and enzyme for method
CN110872605A (en) * 2018-08-29 2020-03-10 北京科技大学 Method for preparing L-erythro-p-methylsulfonyl phenyl serine by enzyme catalysis
CN111139230A (en) * 2020-01-17 2020-05-12 浙江大学 L-threonine aldolase mutant, gene and method for preparing L-syn-p-methylsulfonylphenylserine
CN111849951A (en) * 2020-04-22 2020-10-30 重庆大学 L-threonine aldolase mutant R318M and application thereof
CN112175892A (en) * 2020-09-03 2021-01-05 浙江大学 Engineering bacterium for co-expressing L-threonine aldolase and PLP synthase and application thereof
CN112387299A (en) * 2020-11-30 2021-02-23 江南大学 Method for preparing L-furan serine by biomass chemical-enzymatic method

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH03139283A (en) * 1989-10-25 1991-06-13 Denki Kagaku Kogyo Kk Dta gene and its use
US5663361A (en) * 1996-08-19 1997-09-02 Schering Corporation Process for preparing intermediates to florfenicol
CN101040047A (en) * 2004-10-13 2007-09-19 三井化学株式会社 DNA encoding novel enzyme having D-serine synthase activity, method of producing the enzyme and method of producing d-serine by using the same
JP2007190009A (en) * 2005-08-26 2007-08-02 Research Institute Of Innovative Technology For The Earth Highly stereoselective l-threoninealdolase and gene encoding the same
CN102442930A (en) * 2011-11-02 2012-05-09 江苏宇翔化工有限公司 Preparation method of DL-p-methylsulfonylphenyl serine ethyl ester
CN104673814A (en) * 2015-02-27 2015-06-03 台州职业技术学院 L-threonine aldolase from enterobacter cloacae and application thereof
CN110872605A (en) * 2018-08-29 2020-03-10 北京科技大学 Method for preparing L-erythro-p-methylsulfonyl phenyl serine by enzyme catalysis
WO2020043077A1 (en) * 2018-08-29 2020-03-05 北京科技大学 Method for preparing l-threo/erythro-p-methylsulfonylphenyl serine and enzyme for method
CN109402098A (en) * 2018-11-06 2019-03-01 王喆明 Threonine aldolase, mutant and its preparing the application in substituted benzene serine derivative
CN111139230A (en) * 2020-01-17 2020-05-12 浙江大学 L-threonine aldolase mutant, gene and method for preparing L-syn-p-methylsulfonylphenylserine
CN111849951A (en) * 2020-04-22 2020-10-30 重庆大学 L-threonine aldolase mutant R318M and application thereof
CN112175892A (en) * 2020-09-03 2021-01-05 浙江大学 Engineering bacterium for co-expressing L-threonine aldolase and PLP synthase and application thereof
CN112387299A (en) * 2020-11-30 2021-02-23 江南大学 Method for preparing L-furan serine by biomass chemical-enzymatic method

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
JI-QUAN LIU等: "A Novel Metal-activated Pyridoxal Enzyme with a Unique Primary Structure, Low Specificity D-Threonine Aldolase from Arthrobacter sp. Strain DK-38", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 *
JI-QUAN LIU等: "Gene Cloning, Nucleotide Sequencing, and Purification and Characterization of the Low-Specificity L-Threonine Aldolase from Pseudomonas sp. Strain NCIMB 10558", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 *
LEI GONG等: "Sustainable one-pot chemo-enzymatic synthesis of chiral furan amino acid from biomass via magnetic solid acid and threonine aldolase", 《BIORESOURCE TECHNOLOGY 》 *
NCBI: "DSD1 family PLP-dependent enzyme [Achromobacter piechaudii]", 《GENBANK》 *
李利宏等: "Pseudomonas putida KT2440低特异性L-苏氨酸醛缩酶的表达、酶学性质及温度稳定性提高", 《微生物学报》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114686500A (en) * 2020-12-30 2022-07-01 华东师范大学 1, 4-alpha-glucan branching enzyme, coding gene, engineering strain and application
CN113322248A (en) * 2021-05-12 2021-08-31 浙江工业大学 High-temperature-resistant L-threonine aldolase and application thereof in synthesis of p-methylsulfonylphenylserine
CN114703169A (en) * 2022-04-29 2022-07-05 重庆大学 L-threonine aldolase mutant R318L/H128N and application thereof
CN114703169B (en) * 2022-04-29 2023-10-31 重庆大学 L-threonine aldolase mutant R318L/H128N and application thereof

Also Published As

Publication number Publication date
CN110272856B (en) 2022-05-03

Similar Documents

Publication Publication Date Title
CN110272856A (en) A kind of recombinant bacterium that expressing D-Thr aldolase and its construction method and application
CN108467860B (en) Method for high yield of gamma-aminobutyric acid
CN109609474A (en) A kind of amino acid dehydrogenase mutant and its application in synthesis L-glufosinate-ammonium
CN106497895B (en) Leucine dehydrogenase mutant, encoding gene, carrier, engineering bacteria and its application
CN104745556A (en) Recombinant halohydrin dehalogenase, and mutant and engineering strain and applications thereof
CN105936909A (en) Alcohol dehydrogenase, gene and recombinase thereof, and application of alcohol dehydrogenase in synthesis of chiral diaryl secondary alcohol
CN105505846A (en) Recombined spore with surface displaying glutamate dehydrogenase and construction method and application thereof
CN112626057B (en) Chimeric plant nitrilase mutant, coding gene and application thereof
CN104152506A (en) Method catalytically synthesizing (S)-N, N-dimethyl-3-hydroxy-(2-thiofuran)-1-propylamine((S)-DHTP) by aldehyde ketone reductase recombinant strain crude enzyme system
CN104263713A (en) Tistrella mobilis, halohydrin dehalogenase, gene, vector, recombinant strain and application of halohydrin dehalogenase
CN113736763B (en) Myrosinase Rmmr and application thereof in preparation of sulforaphane and sulforaphane
CN111139271A (en) Method for asymmetrically synthesizing L-glufosinate-ammonium by single transaminase catalytic cascade reaction
CN105296509B (en) A kind of malate dehydrogenase gene RKMDH2 and its recombinant expression carrier
CN105200020B (en) A kind of high substrate specificity bacillus pumilus CotA laccase being transformed by compound point mutation
CN109370998A (en) A kind of ω-transaminase mutant I215F that catalytic efficiency improves
CN110819601A (en) Reductive amination enzyme, coding gene, recombinant vector, recombinant cell and application thereof
CN105296513A (en) Marine esterase as well as coding gene E22 and application thereof
CN109486780A (en) A kind of ω-transaminase mutant that catalytic efficiency improves
CN112481320B (en) Method for preparing (-) gamma-lactam with high catalytic efficiency
CN113088504B (en) Modified acid phosphatase and application thereof
CN112522228B (en) R-aminotransferase from pseudomonas ammoxidation and synthesis method thereof
CN105886517B (en) A kind of malate dehydrogenase gene RKMDH1 and its recombinant expression carrier
CN108277216A (en) High activity S- cyanalcohols lyases and its application
CN111218432B (en) Tyrosinase precursor, encoding gene, preparation and application thereof
CN112442474B (en) Preparation method of (-) gamma-lactam

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant