CN110272856B - Recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof - Google Patents
Recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof Download PDFInfo
- Publication number
- CN110272856B CN110272856B CN201910380625.8A CN201910380625A CN110272856B CN 110272856 B CN110272856 B CN 110272856B CN 201910380625 A CN201910380625 A CN 201910380625A CN 110272856 B CN110272856 B CN 110272856B
- Authority
- CN
- China
- Prior art keywords
- threonine aldolase
- recombinant
- application
- ala
- pet28a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/02—Aldehyde-lyases (4.1.2)
- C12Y401/02042—D-Threonine aldolase (4.1.2.42)
Abstract
The invention discloses a recombinant bacterium for expressing D-threonine aldolase and a construction method and application thereof, belonging to the technical field of enzyme engineering. The recombinant strain expresses D-threonine aldolase with an amino acid sequence shown as SEQ ID NO. 2. The invention provides a D-threonine aldolase which can be used as a catalyst for synthesizing chiral beta-hydroxy-alpha-amino acid, has high catalytic efficiency (the conversion rate is more than 65%), strong stereoselectivity (e.e. > 99%, d.e. > 95%), mild reaction conditions and environmental friendliness. The D-threonine aldolase has good catalytic effect, wide substrate applicability and good application and development prospects.
Description
Technical Field
The invention relates to a recombinant bacterium for expressing D-threonine aldolase, a construction method and application thereof, belonging to the technical field of enzyme engineering.
Background
Chiral beta-hydroxy-alpha-amino acid is a very important compound, and has two functional groups of chiral hydroxy and amino acid, so that the chiral beta-hydroxy-alpha-amino acid has very wide application in the manufacture of fine chemicals such as medicines, materials and the like. The synthesis of chiral beta-hydroxy-alpha-amino acid by a chemical method has the defects of expensive catalyst, heavy metal pollution, longer synthetic route, capability of improving the stereoselectivity of the product under harsher conditions and the like, and is not beneficial to the amplification of industrial production. Compared with a chemical method, the enzyme method does not need any protecting group, has better stereoselectivity, can complete the reaction in one step and the like. Therefore, the enzymatic synthesis of the beta-hydroxy-alpha-amino acid has more potential of application and development.
Threonine aldolase is a phosphopyridoxal-dependent aldolase, is a powerful tool for forming carbon-carbon bonds in organic synthesis, can catalyze aldehydes with different substituents and glycine to perform specific aldol condensation reaction to produce beta-hydroxy-alpha-amino acid with high additional value, has high selectivity on alpha-carbon of two formed chiral centers, and has poor stereoselectivity on beta-carbon. Therefore, the development of threonine aldolase with high efficiency and high stereoselectivity has important significance for the technical transformation and upgrading of chiral intermediates (l-syn-p-methylsulfonylphenylserine) for synthesizing medicines such as thiamphenicol and florfenicol.
At present, the enzymatic production of l-syn-p-methylsulfonylphenylserine is mostly obtained by enzymatic resolution of dl-syn-p-methylsulfonylphenylserine. Wherein, the D-threonine aldolase derived from Delftia sp.RIT313 can completely resolve 300 mmol.L under a two-phase system (dichloromethane, dichloroethane, cyclohexanone)-1dl-syn-p-methylsulfonylphenylserine, the highest substrate concentration at present (Catalysis Science)&Technology,2017,7, 5964-5973). However, few studies have been reported on the enzymatic synthesis of l-syn-p-methylsulfonylphenylserine. The l-threonine aldolase from p.putida catalyzes the synthesis of l-syn-p-methylsulfonylphenylserine with p-methylsulfonylbenzaldehyde and glycine with a yield of 68% and a d.e. value of only 53% (Tetrahedron,2007,63, 918-926). The low enzyme activity and stereoselectivity are bottlenecks which restrict the application of threonine aldolase all the time, and the development of novel threonine aldolase with high activity and high stereoselectivity is urgently needed to meet the requirement of industrial application.
Disclosure of Invention
In order to solve the technical problems, the invention provides a recombinant bacterium for expressing D-threonine aldolase, and the produced D-threonine aldolase can efficiently catalyze p-methylsulfonylbenzaldehyde and glycine to synthesize l-syn-p-methylsulfonylphenylserine, wherein the yield is more than 65%, and the d.e. value is more than 95%. The process has the advantages of mild conditions, simple operation and the like.
The first purpose of the invention is to provide a recombinant bacterium for expressing D-threonine aldolase, wherein the recombinant bacterium expresses the D-threonine aldolase with an amino acid sequence shown as SEQ ID NO. 2.
Furthermore, the recombinant bacterium is a host cell which is a bacterium, a fungus, a plant, an insect or an animal cell.
Furthermore, the recombinant bacterium is an escherichia coli host bacterium. Coli BL21(DE3) is preferred.
Furthermore, the expression vector of the recombinant bacterium is a bacterial plasmid, a bacteriophage, a yeast plasmid, a plant cell virus or a mammalian cell virus.
Furthermore, the expression vector of the recombinant bacterium is a pET series expression vector. pET28a is preferred.
The second purpose of the invention is to provide a construction method of the recombinant bacterium, which comprises the following steps:
(1) constructing a recombinant plasmid pET28 a-ApDTA: connecting the D-threonine aldolase gene ApDTA with the enzyme-cut plasmid pET28a to obtain a recombinant expression vector pET28 a-ApDTA;
(2) constructing a recombinant bacterium E.coli BL21(DE3)/pET28 a-ApDTA: the constructed recombinant expression vector pET28a-ApDTA is transformed into escherichia coli BL21(DE3) competence through heat, and recombinant bacteria E.coli BL21(DE3)/pET28a-ApDTA are obtained through culture and screening.
The third purpose of the invention is to provide the application of the recombinant strain in the synthesis of chiral beta-hydroxy-alpha-amino acid.
Furthermore, the application is to synthesize the chiral beta-hydroxy-alpha-amino acid by using the D-threonine aldolase produced by the fermentation of the recombinant bacteria as a catalyst.
Further, the application is specifically to the synthesis of chiral beta-hydroxy-alpha-aryl amino acids by catalyzing aldehydes and glycine.
Further, the catalysis is carried out for 10-20 h under the conditions that the reaction temperature is 5-15 ℃ and the pH value is 5.5-6.5.
The invention has the beneficial effects that:
the invention provides a D-threonine aldolase which can be used as a catalyst for synthesizing chiral beta-hydroxy-alpha-amino acid, has high catalytic efficiency (the conversion rate is more than 65%), strong stereoselectivity (e.e. > 99%, d.e. > 95%), mild reaction conditions and environmental friendliness. The D-threonine aldolase has good catalytic effect, wide substrate applicability and good application and development prospects.
Drawings
FIG. 1 is a PCR amplification electropherogram of the gene ApDTA; m, Marker; 1, gene ApDTA;
FIG. 2 is a physical map of pET28a-ApDTA recombinant plasmid;
FIG. 3 is a protein electrophoretogram of recombinant d-threonine aldolase; m, Marker; lanes 1, 2 and 3 are the supernatant, precipitate and purified enzyme after induction by recombinant bacterium e.coli BL21(DE3)/pET28a-ApDTA, respectively;
FIG. 4 is a reaction formula of d-threonine aldolase catalyzed condensation of p-methylsulfonylbenzaldehyde and glycine to p-methylsulfonylphenylserine;
FIG. 5 HPLC chromatogram of the product l-syn-p-methylsulfonylphenylserine in the reaction solution.
Detailed Description
The present invention is further described below in conjunction with specific examples to enable those skilled in the art to better understand the present invention and to practice it, but the examples are not intended to limit the present invention.
The HPLC analysis conditions of the D-threonine aldolase catalytic reaction product are as follows: column Diamonsil Plus C18(25 cm. times.4.6 mm,5 μm) with mobile phase V (CH)3CN):V(50mmol·L-1Potassium dihydrogen phosphate solution) ═ 15:85, flow rate is 0.2-1 mL/min-1And the detection wavelength is 338nm, the column temperature is 40 ℃, and the OPA-NAC pre-column derivatization liquid phase determination is carried out. And meanwhile, taking l-syn-p-methylsulfonylphenylserine standard substance as a reference, determining the peak emergence time and the peak emergence order of the product, and determining the enzyme activity according to the peak emergence time and the peak emergence order. D-threonine aldolase activity determination: the enzyme activity determination system of the D-threonine aldolase on the substrate p-methylsulfonylbenzaldehyde is as follows: appropriate amount of enzyme solution, 5 mmol. L-1P-methylsulfonylbenzaldehyde, 50 mmol. multidot.L-1Glycine, 50. mu. mol. L-1Pyridoxal phosphate (PLP), 50. mu. mol. L-1Mn2+The reaction was shaken at 30 ℃ for 10 min. After the reaction is finished, sampling and carrying out liquid phase detection. Definition of one enzyme activity Unit (Unit): the amount of biocatalyst required to catalyse the production of 1. mu. mol l of-syn-p-methylsulfonylphenylserine per minute of p-methylsulfonylbenzaldehyde. Protein concentration was determined by the Bradford method using bovine serum albumin as a standard.
Example 1: gene mining technology for screening D-threonine aldolase based on probe enzyme sequence
According to the reported gene sequence of D-threonine aldolase (Alcaligenes xylosidases) with aldehyde condensation p-methylsulfonylphenylserine, the sequence is used as a probe to search in an NCBI database and BLAST comparison analysis is carried out, candidate enzyme genes with 40-70% homology with the probe sequence are found, enzyme genes with higher sequence consistency are selected, the source strains of the enzyme genes are ensured to be different from the probe, primers are designed according to the searched gene sequences, DNA for coding the enzymes is obtained by PCR amplification and is cloned and expressed, and finally, the high-activity and high-selectivity D-threonine aldolase is obtained by screening the activity and stereoselectivity of a target substrate (p-methylsulfonylphenylaldehyde).
Example 2: cloning of D-threonine Aldolase Gene
The recombinant plasmid pET28a-ApDTA was constructed by the "one-step cloning method" (homologous recombination).
(1) First, the above-mentioned colorless Bacillus subtilis was activated and rejuvenated at 25 ℃ using a nutrient broth agar medium (peptone 10.0g, beef extract 3.0g, NaCl5.0g, agar 15.0g, distilled water 1.0L, pH 7.0). Then after the colonies grow out, inoculating the single colonies into a liquid culture medium for culture. After obtaining the cells by centrifugation, the genome DNA of Achromobacter dermatum was extracted using a bacterial genome DNA kit.
(2) Design of primers based on the reported D-threonine aldolase gene (upstream primer: CAGCAAATGGGTCGC)GG ATCCATGTCCCAGGAAGTCATACGCG, downstream primer: TGCGGCCGCAAGCTTGTCGACTCAGCGCGAGAAGCCGCG, wherein GGATCC is BamHI cleavage site and GTCGAC is SalI cleavage site), and PCR was carried out using Bacillus achromobacter dermal genomic DNA as a template in the following system (. mu.L): MgSO (MgSO)40.6, dNTP 1.0, upstream primer 0.4, downstream primer 0.4, KOD Buffer 1.0, KOD enzyme 0.2, template 0.4, ddH2And O6.0. The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 10min, denaturation at 98 ℃ for 20s, annealing at 65 ℃ for 20s, extension at 68 ℃ for 50s, repeating 30 cycles, and extension at 68 ℃ for 10 min. The PCR product is identified by agarose gel electrophoresis, and a band (figure 1) with the interval of 800-1200 bp, namely the D-threonine aldolase gene, is recovered by an agarose gel DNA recovery kit. The resulting D-threonine aldolase gene was named ApDTA, nucleosideThe sequence is shown as SEQ ID No. 1: the total length is 1140bp, the initiation codon is ATG, and the termination codon is TGA. The sequence has no intron, the coding sequence starts from the 1 st nucleotide and ends with 1140 nucleotides, and the sequence of the coded protein is shown in SEQ ID No. 2. The sequence has been submitted to the NCBI database under GenBank accession number KNY 11228.1.
Example 3: construction and culture of recombinant escherichia coli BL21(DE3)/pET28a-ApDTA
Plasmid pET28a was double-digested with restriction enzymes BamH I and Sal I in a 37 ℃ water bath for 4h, identified by agarose gel electrophoresis, and purified and recovered with an agarose DNA recovery kit. At 37 ℃, the gene ApDTA is connected with the plasmid pET28a which is cut by enzyme by using recombinase in the recombinant kit, and the recombinant expression vector pET28a-ApDTA (figure 2) is obtained. The constructed recombinant expression vector pET28a-ApDTA is transformed into escherichia coli BL21(DE3) competence through heat, an LB solid plate containing kanamycin resistance is coated, colony PCR verification is carried out after overnight culture, and a positive clone is the gene recombinant engineering bacterium E.coli BL21(DE3)/pET28 a-ApDTA. Selecting positive clones, culturing overnight in LB culture medium, inoculating to fresh LB culture medium at 2% inoculum size the next day, and culturing to OD600When the concentration reaches 0.6-0.8, 0.2 mmol/L is added-1IPTG, induction culture at 25 ℃ for 10h, 4 ℃ and 8000 r/min-1And centrifuging for 5min to collect thalli. The collected cells were suspended in HEPES buffer (100 mmol. multidot.L)-1pH 8.0), sonicated and the protein expression was analyzed by SDS-PAGE (fig. 3). As can be seen from FIG. 3, the target protein was completely present in the supernatant (lane 1) and the precipitate was substantially free of band (lane 2), indicating efficient soluble expression of the recombinant enzyme in E.coli.
Example 4: separation and purification of D-threonine aldolase ApDTA
The induced recombinant cells were harvested and suspended in buffer A (20 mmol. multidot.L)-1Sodium phosphate, 500 mmol. L-1NaCl，20mmol·L-1Imidazole, pH 7.4), ultrasonication treatment (300W, 1 second work, 3 seconds pause) for 10min at 4 ℃ and 8000 r.min-1The supernatant was obtained after centrifugation for 20min to remove cell debris. The column used for purification is affinity column HisTrap FF crude for the preparation of purified histidine-tagged recombinant proteins. Firstly, using buffer solution A to balance nickel column, making the above-mentioned supernatant fluid pass through nickel column, continuously using buffer solution A to elute protein not combined with nickel column, after the penetrating peak is flowed out, transferring buffer solution A to buffer solution B (20 mmol. L)-1Sodium phosphate, 500 mmol. L-1NaCl，1000mmol·L-1Imidazole, pH 7.4) and eluting the recombinant protein bound to the nickel column to obtain the recombinant D-threonine aldolase. The purified protein was subjected to enzyme activity assay (p-methylsulfonylbenzaldehyde as a substrate) and SDS-PAGE analysis (FIG. 3). As shown in FIG. 3, after the nickel column purification, a single band was observed at about 40kDa, and the amount of the hetero-protein was small, indicating that the nickel column purification effect was good (lane 3). Then, the purified d-threonine aldolase was replaced with HEPES (100 mmol. multidot.L) by using HiTrap desaling Desalting column-1pH 8.0) buffer, enzymatic property analysis was performed.
Example 5: substrate profiling of recombinant ApDTA
And (3) measuring the enzyme activities of the D-threonine aldolase ApDTA for catalyzing different aldehyde substrates, wherein the measuring methods are all according to the measuring method of the D-threonine aldolase activity, and the difference is that the substrates are different. The enzyme activity measured by taking the p-methylsulfonylbenzaldehyde as a substrate is 100 percent of a control, and the enzyme activities measured by other substrates are calculated by the percentage of the two. The measurement results are shown in table 1.
TABLE 1 substrate spectra of ApDTA
As can be seen from Table 1, ApDTA shows a wide substrate spectrum, shows good activity on aliphatic, aromatic and heterocyclic aldehyde substrates, and has good application prospects.
Example 6: optimum pH of recombinant ApDTA
Preparation of 100 mmol. L-1Buffers at different pH: MES buffer (pH 5.0-6.5); HEPES buffer solution (pH 7.0-8.5); CHES buffer (pH 9.0-10.0). Measuring the condensation reaction activity of ApDTA in buffers with different pH values by using p-methylsulfonylbenzaldehyde as a substrateForce. The pH value of the optimum enzyme activity of ApDTA is 8.0, and the specific activity is 10.0-12.0 U.mg-1. In a CHES-NaOH buffer solution with the pH of 9.0-10.0, the enzyme activity is reduced rapidly. The relative lysis activity of ApDTA in buffers with different pH values is determined by taking d-threonine as a substrate. The ApDTA has low lysis activity under the condition of an acidic buffer solution (pH 5.0-6.5), and the maximum lysis activity is reached when the pH is increased to 8.0. Similarly, the activity gradually decreased with increasing buffer alkalinity.
Example 7: optimum temperature of recombinant ApDTA
And (2) respectively taking p-methylsulfonylbenzaldehyde as a substrate, measuring the enzyme activity of ApDTA at different temperatures (20-45 ℃), determining the highest enzyme activity to be 100%, and calculating the enzyme activities measured at other temperatures according to the percentage relative to the highest activity. The results show that different temperatures have certain influence on the condensation activity of ApDTA, and the ApDTA is distributed in a positive state along with the change of the reaction temperature. The optimum temperature is 30 ℃, and the enzyme activity is relatively low when the temperature is lower than or higher than 30 ℃.
Example 8: determination of kinetic parameters
The specific activity of ApDTA under different p-methylsulfonylbenzaldehyde concentrations is measured, and kinetic parameters are calculated according to a double reciprocal curve of the specific activity and the reciprocal of the substrate concentration. The kinetic parameters of ApDTA on methyl sulfone benzaldehyde are respectively Km30.0 mmol. multidot.L-1，VmaxIs 40.3. mu. mol/min-1·mg-1。
Example 9: effect of Metal ions on enzyme Activity
Determination of Mn2+，Fe2+，Mg2+，Ca2+，Al3+，Cu2+，Co2+，Ni2+And the influence of metal ions such as EDTA and metal ion chelating agents on the activity of the condensation reaction enzyme. The final concentration is 0.1 mmol.L-1Is added to the activity measuring system at 30 ℃ in HEPES buffer solution (100 mmol. L)-1pH 8.0) and the enzyme activity was measured using p-methylsulfonylbenzaldehyde as a substrate. Under the same condition, the enzyme activity measured without adding any metal ion is 100% contrast, and the metal ion is addedThe enzyme activity measured was calculated as a percentage of the control. The results show that metal ions have some activation effect on enzyme activity. Adding Mn2+The enzyme activity showed highest, indicating Mn2+Promoting the catalytic activity center or correct conformation of enzyme. Shows similar activation to the reported D-threonine aldolase derived from A.xylosidases, X.oryzae, S.pomeloyi; however, D-threonine aldolases derived from S.variicoloris and Pseudomonas sp have also been reported to be non-metal ion-dependent.
Example 10: effect of reaction temperature on recombinant threonine Aldolase ApDTA catalysis on methylsulfonaldehyde aldehyde condensation
In MES buffer (100 mmol. L) at 10 ℃ and 30 ℃ respectively-1pH 6.0), to a final concentration of 50 mmol. multidot.L-1Glycine, 5 mmol. L-1P-methylsulfonylbenzaldehyde, 50. mu. mol. L-1PLP，50μmol·L-1Mn2+The total volume of the reaction mixture was 10mL, and the reaction was carried out at 200rpm for 12 hours. Liquid chromatography analysis conversion and d.e. values. As shown in table 2.
TABLE 2 Effect of different reaction temperatures on aldehyde condensation catalysis on methylsulfonylbenzaldehyde
As can be seen from Table 2, the reaction temperature has an influence on the aldehyde condensation catalysis on methylsulfonylbenzaldehyde. Higher conversion and d.e. values are obtained at 10 ℃ than at 30 ℃ and the low temperature favours the stabilization and improvement of the d.e. value of the product, an improvement in conversion indicating that the direction of the aldehyde condensation reaction is exothermic. There is a different preference for the direction of reaction at different temperatures. At low temperature, the reaction proceeds toward a direction of low activation energy and high speed, and the reaction is kinetically controlled. Thus, a reaction temperature of 10 ℃ was chosen.
Example 11: effect of pH on recombinant threonine Aldolase ApDTA catalysis on methylsulfonaldehyde aldolase catalysis
In example 6, buffers of different pH (100 mmol. multidot.L)-1，pH6.0, 7.0, 8.0), adding the mixture to obtain a final concentration of 50 mmol.L-1Glycine, 5 mmol. L-1P-methylsulfonylbenzaldehyde, 50. mu. mol. L-1PLP，50μmol·L-1Mn2+The reaction mixture was reacted at 10 ℃ and 200rpm for 12 hours in a total volume of 10 mL. Liquid chromatography analysis conversion and d.e. values. The results are shown in Table 3.
TABLE 3 Effect of buffer pH on aldehyde condensation catalysis on methylsulfonylbenzaldehyde
| Buffer pH | Conversion rate% | d.e. value |
| 5.0 | 4％ | 83％ |
| 6.0 | 65％ | 95％ |
| 7.0 | 50％ | 75％ |
| 8.0 | 50％ | 80％ |
| 9.0 | 50％ | 94％ |
| 10.0 | 29％ | 90％ |
As can be seen from Table 3, the pH of the reaction system has a certain influence on ApDTA aldehyde condensation catalysis on methylsulfonylbenzaldehyde, the conversion rate and the d.e. value are maximized in a buffer solution with the pH of 6.0, and the d.e. value is stable in the whole reaction process. At pH 6.0, ApDTA has low lyase activity and is inhibited in the reverse reaction cleavage direction.
Example 12: application of recombinant threonine aldolase ApDTA in preparation of l-syn-p-methylsulfonylphenylserine
The reaction system was scaled up to 500mL, including MES buffer (100 mmol. multidot.L)-1，pH 6.0)、1mol·L-1Glycine, 100 mmol. L-1P-methylsulfonylbenzaldehyde 50. mu. mol. L-1PLP、50μmol·L-1Mn2+、25kU·L-1ApDTA, at 10 ℃ and 200rpm for 12 h. The reaction process is shown in figure 4, and the liquid phase analysis spectrum of the reaction product is shown in figure 5. After the reaction is finished, the mixture after the reaction is directly added with methanol with 4 times volume, the mixture is stored overnight at 4 ℃, precipitates are collected by filtration, and the precipitates are washed by the methanol to recover the glycine. The filtrate was concentrated in vacuo and passed through an alkali-treated Dowex-1 anion exchange resin, washed with water. The product (containing glycine) was eluted with 20% acetic acid, collected and the residue was concentrated in vacuo and purified on ODS column to give the desired product. The product purity is more than 99 percent, and the yield is more than 75 percent.
The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.
Sequence listing
<110> university of south of the Yangtze river
<120> recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 1140
<212> DNA
<213> (Artificial sequence)
<400> 1
atgtcccagg aagtcatacg cggcatagcg ctgcccccgc cagcgcagcc gggtgatccg 60
ttggcccaag tcgacacgcc cagcctcgtg ctggacctga cgcccttcga agccaatctg 120
cgcgccatgc aggcttgggc ggaccgccac gaggtggcct tgcggccgca cgccaaggcg 180
cacaaatgcc ccgagatcgc gcggcgccaa ctcgcgctgg gcgcgcgtgg catctgttgc 240
cagaaggtca gcgaggcgct gcctttcgtg gccgcgggca tccacgacat ccacatcagc 300
aacgaagtcg tcgggcctgc caagcttgcc ttgctgggcc agctggcgcg cgtggccaag 360
atgagcgtct gtgtggataa cgcccacaac ctggcgcagc tctcgcaagc catgacgcag 420
gcgggcgcgc agatcgacgt gctggtcgaa gtggacgtcg gccaaggccg ctgcggcgtg 480
tcggacgatg cgctggtgct ggcgctggcg caacaggcgc gtgacctgcc cggcgtgcag 540
ttcgtgggct tgcaggccta tcacggctcg gtgcagcacg cccgtacgcg tgaggagcgc 600
gcgcagatct gcaagcaggc cgcgcgtatc gcggcctcgt acgcccagct gctgcgtgaa 660
agcggcatcg cttgcgacat cattaccggg ggcggcacgg gcagcgcaga attcgacgcg 720
gcaagcggcg tctataccga actgcaagcg ggctcttacg cgttcatgga cggcgactac 780
ggcgcgaacg aatgggacgg tccgctgaaa ttccagaaca gcctgttcct gttgtccacc 840
gtcatgagcg tgccggcgcc cgaccgcgtg atcctggacg caggcctgaa gtccaccacc 900
gccgaatgcg gcccgcccgc cgtcttcgat acggcgggcc tgacctatgc ggcgattaac 960
gacgaacacg gcgtcgtgcg cgttgcgccc gatgccaccg cgcccgcgct gggcgacgtg 1020
ctgcgtctgg tgccctcgca cgtggacccg acgttcaacc tgcacgacgg cctggtcgtg 1080
gtgcgcaatg acgtcgtaga agacgtctgg gaaatcgccg cgcgcggctt ctcgcgctga 1140
<210> 2
<211> 379
<212> PRT
<213> (Artificial sequence)
<400> 2
Met Ser Gln Glu Val Ile Arg Gly Ile Ala Leu Pro Pro Pro Ala Gln
1 5 10 15
Pro Gly Asp Pro Leu Ala Gln Val Asp Thr Pro Ser Leu Val Leu Asp
20 25 30
Leu Thr Pro Phe Glu Ala Asn Leu Arg Ala Met Gln Ala Trp Ala Asp
35 40 45
Arg His Glu Val Ala Leu Arg Pro His Ala Lys Ala His Lys Cys Pro
50 55 60
Glu Ile Ala Arg Arg Gln Leu Ala Leu Gly Ala Arg Gly Ile Cys Cys
65 70 75 80
Gln Lys Val Ser Glu Ala Leu Pro Phe Val Ala Ala Gly Ile His Asp
85 90 95
Ile His Ile Ser Asn Glu Val Val Gly Pro Ala Lys Leu Ala Leu Leu
100 105 110
Gly Gln Leu Ala Arg Val Ala Lys Met Ser Val Cys Val Asp Asn Ala
115 120 125
His Asn Leu Ala Gln Leu Ser Gln Ala Met Thr Gln Ala Gly Ala Gln
130 135 140
Ile Asp Val Leu Val Glu Val Asp Val Gly Gln Gly Arg Cys Gly Val
145 150 155 160
Ser Asp Asp Ala Leu Val Leu Ala Leu Ala Gln Gln Ala Arg Asp Leu
165 170 175
Pro Gly Val Gln Phe Val Gly Leu Gln Ala Tyr His Gly Ser Val Gln
180 185 190
His Ala Arg Thr Arg Glu Glu Arg Ala Gln Ile Cys Lys Gln Ala Ala
195 200 205
Arg Ile Ala Ala Ser Tyr Ala Gln Leu Leu Arg Glu Ser Gly Ile Ala
210 215 220
Cys Asp Ile Ile Thr Gly Gly Gly Thr Gly Ser Ala Glu Phe Asp Ala
225 230 235 240
Ala Ser Gly Val Tyr Thr Glu Leu Gln Ala Gly Ser Tyr Ala Phe Met
245 250 255
Asp Gly Asp Tyr Gly Ala Asn Glu Trp Asp Gly Pro Leu Lys Phe Gln
260 265 270
Asn Ser Leu Phe Leu Leu Ser Thr Val Met Ser Val Pro Ala Pro Asp
275 280 285
Arg Val Ile Leu Asp Ala Gly Leu Lys Ser Thr Thr Ala Glu Cys Gly
290 295 300
Pro Pro Ala Val Phe Asp Thr Ala Gly Leu Thr Tyr Ala Ala Ile Asn
305 310 315 320
Asp Glu His Gly Val Val Arg Val Ala Pro Asp Ala Thr Ala Pro Ala
325 330 335
Leu Gly Asp Val Leu Arg Leu Val Pro Ser His Val Asp Pro Thr Phe
340 345 350
Asn Leu His Asp Gly Leu Val Val Val Arg Asn Asp Val Val Glu Asp
355 360 365
Val Trp Glu Ile Ala Ala Arg Gly Phe Ser Arg
370 375
Claims (5)
1. The application of a recombinant bacterium for expressing D-threonine aldolase in the synthesis of l-syn-p-methylsulfonylphenylserine is characterized in that the recombinant bacterium is prepared fromE. coli BL21(DE3) is used as a host, pET28a is used as an expression vector, and D-threonine aldolase with an amino acid sequence shown as SEQ ID NO.2 is expressed.
2. The application of claim 1, wherein the construction method of the recombinant bacterium comprises the following steps:
(1) construction of the recombinant plasmid pET28a-ApDTA: the D-threonine aldolase geneApThe DTA is connected with the digested plasmid pET28a to obtain a recombinant expression vector pET28a-ApDTA；
(2) Construction of recombinant bacteriaE. coli BL21(DE3)/pET28a-ApDTA: the constructed recombinant expression vector pET28a-ApDTA heat transfer into escherichia coli BL21(DE3) competence, and recombinant bacteria are obtained by culture and screeningE. coli BL21(DE3)/pET28a-ApDTA。
3. Use according to claim 1, characterized in that: the application is to synthesize l-syn-p-methylsulfonylphenylserine by using the D-threonine aldolase produced by fermentation of the recombinant bacteria as a catalyst.
4. Use according to claim 3, characterized in that: the application is particularly to catalyzing aldehyde and glycine to synthesize l-syn-p-methylsulfonyl phenyl serine.
5. Use according to claim 3, characterized in that: the application is that the reaction temperature is 5-15 DEG CoC, reacting for 10-20 hours under the condition that the pH value is 5.5-6.5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910380625.8A CN110272856B (en) | 2019-05-08 | 2019-05-08 | Recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910380625.8A CN110272856B (en) | 2019-05-08 | 2019-05-08 | Recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110272856A CN110272856A (en) | 2019-09-24 |
| CN110272856B true CN110272856B (en) | 2022-05-03 |
Family
ID=67959851
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910380625.8A Active CN110272856B (en) | 2019-05-08 | 2019-05-08 | Recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110272856B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114686500B (en) * | 2020-12-30 | 2023-07-14 | 华东师范大学 | 1, 4-alpha-glucan branching enzyme, coding gene, engineering strain and application |
| CN113322248B (en) * | 2021-05-12 | 2022-10-28 | 浙江工业大学 | High-temperature-resistant L-threonine aldolase and application thereof in synthesis of p-methylsulfonylphenylserine |
| CN114703169B (en) * | 2022-04-29 | 2023-10-31 | 重庆大学 | L-threonine aldolase mutant R318L/H128N and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5663361A (en) * | 1996-08-19 | 1997-09-02 | Schering Corporation | Process for preparing intermediates to florfenicol |
| CN102442930A (en) * | 2011-11-02 | 2012-05-09 | 江苏宇翔化工有限公司 | Preparation method of DL-p-methylsulfonylphenyl serine ethyl ester |
| WO2020043077A1 (en) * | 2018-08-29 | 2020-03-05 | 北京科技大学 | Method for preparing l-threo/erythro-p-methylsulfonylphenyl serine and enzyme for method |
| CN110872605A (en) * | 2018-08-29 | 2020-03-10 | 北京科技大学 | Method for preparing L-erythro-p-methylsulfonyl phenyl serine by enzyme catalysis |
| CN111139230A (en) * | 2020-01-17 | 2020-05-12 | 浙江大学 | L-threonine aldolase mutant, gene and method for preparing L-syn-p-methylsulfonylphenylserine |
| CN112175892A (en) * | 2020-09-03 | 2021-01-05 | 浙江大学 | Engineering bacterium for co-expressing L-threonine aldolase and PLP synthase and application thereof |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2923654B2 (en) * | 1989-10-25 | 1999-07-26 | 電気化学工業株式会社 | DTA gene and its use |
| EP2602319B1 (en) * | 2004-10-13 | 2016-12-07 | Mitsui Chemicals, Inc. | DNA encoding novel enzyme having D-serine synthase activity, method of producing the enzyme and method of producing D-serine by using the same |
| JP5028850B2 (en) * | 2005-08-26 | 2012-09-19 | 公益財団法人地球環境産業技術研究機構 | High stereoselectivity L-threonine aldolase and gene encoding the same |
| CN104673814B (en) * | 2015-02-27 | 2018-02-02 | 台州职业技术学院 | A kind of L threonine aldolases for coming from enterobacter cloacae and its application |
| CN113481188B (en) * | 2018-11-06 | 2023-03-24 | 王喆明 | Threonine aldolase mutant and application thereof in preparation of substituted phenylserine derivative |
| CN111849951B (en) * | 2020-04-22 | 2022-09-20 | 重庆大学 | L-threonine aldolase mutant R318M and application thereof |
| CN112387299B (en) * | 2020-11-30 | 2022-02-01 | 江南大学 | Method for preparing L-furan serine by biomass chemical-enzymatic method |
-
2019
- 2019-05-08 CN CN201910380625.8A patent/CN110272856B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5663361A (en) * | 1996-08-19 | 1997-09-02 | Schering Corporation | Process for preparing intermediates to florfenicol |
| CN102442930A (en) * | 2011-11-02 | 2012-05-09 | 江苏宇翔化工有限公司 | Preparation method of DL-p-methylsulfonylphenyl serine ethyl ester |
| WO2020043077A1 (en) * | 2018-08-29 | 2020-03-05 | 北京科技大学 | Method for preparing l-threo/erythro-p-methylsulfonylphenyl serine and enzyme for method |
| CN110872605A (en) * | 2018-08-29 | 2020-03-10 | 北京科技大学 | Method for preparing L-erythro-p-methylsulfonyl phenyl serine by enzyme catalysis |
| CN111139230A (en) * | 2020-01-17 | 2020-05-12 | 浙江大学 | L-threonine aldolase mutant, gene and method for preparing L-syn-p-methylsulfonylphenylserine |
| CN112175892A (en) * | 2020-09-03 | 2021-01-05 | 浙江大学 | Engineering bacterium for co-expressing L-threonine aldolase and PLP synthase and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110272856A (en) | 2019-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110272856B (en) | Recombinant bacterium for expressing D-threonine aldolase and construction method and application thereof | |
| CN109609474B (en) | Amino acid dehydrogenase mutant and application thereof in synthesis of L-glufosinate-ammonium | |
| CN112481224A (en) | Baeyer-Villiger monooxygenase and application thereof | |
| US20240101974A1 (en) | D-amino acid oxidase mutants and uses thereof in preparing l-glufosinate | |
| CN112410312A (en) | Cyclohexanone monooxygenase and application thereof | |
| CN114134134B (en) | L-threonine aldolase mutant and application thereof in synthesis of L-syn-p-methylsulfonyl phenylserine | |
| CN111139271A (en) | Method for asymmetrically synthesizing L-glufosinate-ammonium by single transaminase catalytic cascade reaction | |
| CN110699396B (en) | Method for preparing D-aromatic amino acid by cascade reaction | |
| CN107937364B (en) | Kidney bean epoxide hydrolase mutant with improved enantioselectivity | |
| CN112908417A (en) | Gene mining method combining functional sequence and structure simulation, NADH (nicotinamide adenine dinucleotide) preference type glufosinate dehydrogenase mutant and application | |
| CN112481320B (en) | Method for preparing (-) gamma-lactam with high catalytic efficiency | |
| CN113322248B (en) | High-temperature-resistant L-threonine aldolase and application thereof in synthesis of p-methylsulfonylphenylserine | |
| CN112522228B (en) | R-aminotransferase from pseudomonas ammoxidation and synthesis method thereof | |
| CN109593739A (en) | Recombinate ketone acid reduction enzyme mutant, gene, engineering bacteria and its application | |
| CN106119224B (en) | Esterase EstP00714 and coding gene and application thereof | |
| CN109337879B (en) | Malate dehydrogenase PbMDH and coding sequence and application thereof | |
| CN111218432B (en) | Tyrosinase precursor, encoding gene, preparation and application thereof | |
| AU2011332131B2 (en) | Compositions and methods of producing enterokinase in yeast | |
| CN112442474B (en) | Preparation method of (-) gamma-lactam | |
| CN114921433B (en) | AlphA-Aminotransferase mutant and application thereof in synthesis of L-glufosinate | |
| CN113913399B (en) | Ketopantolactone reductase from Candida maltosa Xu316 | |
| CN115747194B (en) | L-threonine aldolase mutant, gene and method for preparing L-anti-p-methylsulfonylphenyl serine | |
| CN116218803B (en) | Imine reductase, preparation method thereof and DNA (deoxyribonucleic acid) encoding imine reductase | |
| CN114085820B (en) | Ketopantolactone reductase from Candida viswanathii | |
| CN109370997B (en) | Phenylalanine aminomutase mutant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |